ID: 1186514541

View in Genome Browser
Species Human (GRCh38)
Location X:10156808-10156830
Sequence CCAGAGAAAACCCGGCGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 75}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514541_1186514546 -6 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 59
1186514541_1186514548 -1 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514541_1186514551 15 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514551 X:10156846-10156868 GGGTAGGAGGCGAATGACACTGG 0: 1
1: 0
2: 2
3: 12
4: 133
1186514541_1186514547 -5 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG 0: 1
1: 0
2: 1
3: 5
4: 37
1186514541_1186514545 -7 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514545 X:10156824-10156846 TCTCTGGACACGAATGCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1186514541_1186514555 25 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514555 X:10156856-10156878 CGAATGACACTGGCACGGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 24
1186514541_1186514552 20 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514552 X:10156851-10156873 GGAGGCGAATGACACTGGCACGG 0: 1
1: 0
2: 0
3: 9
4: 120
1186514541_1186514553 23 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG 0: 1
1: 0
2: 0
3: 2
4: 59
1186514541_1186514544 -8 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1186514541_1186514549 2 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514549 X:10156833-10156855 ACGAATGCTCCGGGGGTAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1186514541_1186514554 24 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514554 X:10156855-10156877 GCGAATGACACTGGCACGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514541 Original CRISPR CCAGAGAAAACCCGGCGTCC CGG (reversed) Intergenic
905400310 1:37697336-37697358 CCAGAGGAAACCAGGCTTCTAGG + Intronic
908658578 1:66414131-66414153 ACAGGGAAAACTCGGTGTCCAGG - Intergenic
912953030 1:114133726-114133748 CCAGAGCAAACCGGGCCTGCAGG - Intronic
916442922 1:164845273-164845295 CAAGAGAAAAGCAGGTGTCCCGG - Intronic
1062822715 10:547142-547164 CCAGAGGGAACCCGGAATCCCGG + Intronic
1063514997 10:6687145-6687167 CCAGGGAAAACTTGGCTTCCTGG + Intergenic
1079675053 11:23216876-23216898 CCAGAGAAAACCAGTTGGCCTGG - Intergenic
1084361218 11:68669736-68669758 CCAGAGAAAGCCCCGGCTCCTGG - Intergenic
1084456865 11:69273068-69273090 CCAAAGGAAACTCTGCGTCCTGG - Intergenic
1084515151 11:69633999-69634021 CCAGAGAATAGCCGGGGTCTAGG + Intergenic
1102456731 12:113075555-113075577 CCAGAGATAACCCAAGGTCCAGG - Intronic
1106460345 13:29962682-29962704 ACAGAGGAAACCTGGGGTCCCGG + Intergenic
1110292062 13:73818921-73818943 TTAGAGAAACCCCGGCTTCCAGG + Intronic
1113760328 13:112842002-112842024 CCAGAGAAAAAACAGAGTCCCGG + Intronic
1114055674 14:18965386-18965408 CAAGAGAAAGCCTGGCCTCCTGG - Intergenic
1114106872 14:19436377-19436399 CAAGAGAAAGCCTGGCCTCCTGG + Intergenic
1115980906 14:39050456-39050478 CAAGAGAAAACCTGGCTTGCAGG + Intronic
1118918595 14:70129257-70129279 CCACAGAAAACTTGGTGTCCTGG + Intronic
1121246419 14:92464308-92464330 CCAGACAGAACCAGGCATCCAGG + Intronic
1122428764 14:101626963-101626985 CTAGAGATAACCAGGCGTTCTGG - Intergenic
1127836508 15:62795060-62795082 CCAGAGACAGCCCTGCCTCCCGG - Intronic
1132524994 16:410065-410087 CCAGAGCAAGACGGGCGTCCTGG - Intronic
1134434217 16:14240506-14240528 CCACAGAAAACCCCGCGTTGAGG - Intronic
1136037257 16:27549747-27549769 CCAGAGAAACTCCTGCGTGCAGG + Exonic
1150440300 17:65185904-65185926 CCAGAGAACACCAGGCAGCCAGG + Intronic
1151820683 17:76495139-76495161 CCCGTGAAAACCCGGCTGCCGGG - Intronic
1152890911 17:82881165-82881187 CGAGAGAGACCCCAGCGTCCAGG - Intronic
1158859897 18:61581970-61581992 GCAGAGAAAACCCAGCCTCCCGG + Intergenic
1167154541 19:47730129-47730151 CCAGACAAACCCCGGAGTCAGGG + Intronic
1168422998 19:56217490-56217512 CCGCAGAAATGCCGGCGTCCGGG + Intergenic
931586773 2:63838463-63838485 CCAGACAAAAACTGGCTTCCAGG + Intergenic
931646182 2:64424243-64424265 CCAGGGAAAAGCCAGCCTCCTGG - Intergenic
933846188 2:86328982-86329004 CCAGGAAGAACCCGGCATCCTGG + Intronic
934529362 2:95075432-95075454 CCACAGAAAACCTGGCGTGGAGG + Intergenic
934757204 2:96832559-96832581 CCACAGCAGGCCCGGCGTCCCGG + Exonic
939107732 2:137969130-137969152 GCAGAGAAAGCCCGTCGTCATGG - Intronic
944158401 2:196633569-196633591 CCAGAGAAAACCCGCAGACACGG - Intergenic
947160198 2:227207054-227207076 CCAGAGGAAATCCTGAGTCCTGG + Intronic
948643358 2:239388883-239388905 CCTGGGAAAACCCGGGGCCCTGG - Intronic
1170774647 20:19364819-19364841 CCAGAGAAAACCTGAGGTCTGGG - Intronic
1172205721 20:33161608-33161630 CCAGAGAGAACTTGGCCTCCTGG + Intergenic
1175519651 20:59591916-59591938 CCAGAGAAGACCCAGAGGCCTGG - Intronic
1175856067 20:62121886-62121908 CCCGGGAACACCCGGCGCCCAGG + Intergenic
1177903463 21:26946411-26946433 CCAGAGAAAATCCAGAATCCGGG + Intronic
1180052137 21:45336056-45336078 CCAGAGAGAGCCCAGGGTCCGGG + Intergenic
1182586586 22:31346988-31347010 CCAGAGAGGGCCCGGGGTCCTGG + Intergenic
1183366421 22:37409419-37409441 CCAGAGACAGCCAGGGGTCCTGG + Intronic
1185116220 22:48939778-48939800 GCAGGGAAAACCCGGCCTCGGGG - Intergenic
1185379849 22:50503336-50503358 CCAGAGCACTCCCGGCGACCTGG + Exonic
955251471 3:57287330-57287352 CCAGAGAACCCCCGGCAGCCTGG + Intronic
959748238 3:109802905-109802927 CCAGAGCAAACACTGTGTCCAGG - Intergenic
963713774 3:148779485-148779507 CCAGAGAAATCCCAGTGTCTTGG - Intergenic
968558399 4:1261977-1261999 CGAGCGACACCCCGGCGTCCTGG - Intergenic
968958952 4:3733208-3733230 CCAGAGGACACCCGCCCTCCTGG + Intergenic
970194336 4:13540804-13540826 TCAGAGAAAACGCGGCGTCCAGG + Intergenic
976390216 4:84498448-84498470 GCCGAGAAAAGCAGGCGTCCCGG + Exonic
985652156 5:1112214-1112236 GCAGCGAAAGCCCCGCGTCCCGG - Intergenic
987366295 5:17152004-17152026 CCAGAAACAACCAAGCGTCCTGG - Intronic
992212148 5:74491351-74491373 CCTGAGAAAACTCGACTTCCAGG - Intergenic
1002418323 5:179132421-179132443 CCAGAGAAATACCAGGGTCCTGG - Intronic
1002929074 6:1620885-1620907 CCTGAGAACACCCGGGGTCTGGG - Intergenic
1012506885 6:99957170-99957192 CCAGAGAAAAATCAGGGTCCAGG + Intronic
1016329969 6:142945460-142945482 GCAGGAAAAACCCAGCGTCCAGG + Intergenic
1017673111 6:156786249-156786271 CCAGAGCAAACCCAGAGTCTAGG + Intronic
1019171640 6:170136365-170136387 CCAGAGAGAAGCCAGCGTGCCGG - Intergenic
1022506570 7:30911539-30911561 CCAGAGAAATCCAGGTGTCTCGG - Intergenic
1033683841 7:143621109-143621131 CCAGACCATACCCGGCGTCAGGG + Intronic
1033700771 7:143836529-143836551 CCAGACCATACCCGGCGTCAGGG - Intergenic
1034386298 7:150743893-150743915 ACAGAGAAAGCCCTGCGTACAGG - Exonic
1034735636 7:153426815-153426837 CCAGAGAACTCCTGGAGTCCAGG - Intergenic
1035051444 7:156001188-156001210 ACAGAGAACACCCGGCGTGCAGG - Intergenic
1038128079 8:24696716-24696738 CCAGAGAAAAACTGGTGTTCTGG + Intergenic
1048524759 8:135192187-135192209 CCTGAGAAAACCCTCAGTCCTGG + Intergenic
1060771067 9:126332622-126332644 CCAGTGAAAGCCCGGGGTCTGGG - Intronic
1061948005 9:133919580-133919602 TCAGGAAAAACCCGGTGTCCTGG - Intronic
1062120205 9:134829995-134830017 CCAAAGAAAACCCGGGCTCCTGG + Exonic
1186273963 X:7920017-7920039 CCAGAGAAACCCCTGCCTCTTGG + Intronic
1186514541 X:10156808-10156830 CCAGAGAAAACCCGGCGTCCCGG - Intergenic
1189545390 X:42037358-42037380 CCATAGAAAACCCTTCATCCTGG - Intergenic
1196251187 X:113462131-113462153 CCAGTGCAAACTCGGCCTCCTGG + Intergenic