ID: 1186514542

View in Genome Browser
Species Human (GRCh38)
Location X:10156808-10156830
Sequence CCGGGACGCCGGGTTTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514532_1186514542 6 Left 1186514532 X:10156779-10156801 CCAGCCCCTGAGGGTGGGGCGTC 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 40
1186514531_1186514542 7 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 40
1186514524_1186514542 29 Left 1186514524 X:10156756-10156778 CCGGTCACAGAATTCCGTGCAGC No data
Right 1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 40
1186514534_1186514542 1 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 40
1186514526_1186514542 15 Left 1186514526 X:10156770-10156792 CCGTGCAGCCCAGCCCCTGAGGG 0: 1
1: 3
2: 10
3: 82
4: 532
Right 1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 40
1186514535_1186514542 0 Left 1186514535 X:10156785-10156807 CCTGAGGGTGGGGCGTCCTGTCT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 40
1186514533_1186514542 2 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514542 Original CRISPR CCGGGACGCCGGGTTTTCTC TGG Intergenic
1062822714 10:547142-547164 CCGGGATTCCGGGTTCCCTCTGG - Intronic
1074866149 10:117545426-117545448 CCGGAACGCCGGGTCTCCACCGG - Intronic
1113760327 13:112842002-112842024 CCGGGACTCTGTTTTTTCTCTGG - Intronic
1119296892 14:73539788-73539810 CCGGGGCACTGGGGTTTCTCGGG + Intronic
1119301127 14:73571702-73571724 CCGGGGCACTGGGGTTTCTCGGG + Intronic
1127836509 15:62795060-62795082 CCGGGAGGCAGGGCTGTCTCTGG + Intronic
1143568675 17:7740754-7740776 CCGGGAAGGCGGGTTCCCTCCGG - Intronic
1151740505 17:75978973-75978995 CGGCGGCGCCGGGTTTTCTCGGG + Exonic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1163114691 19:15181673-15181695 CCGGGCCGCAGGGGTTGCTCAGG + Exonic
1168422997 19:56217490-56217512 CCCGGACGCCGGCATTTCTGCGG - Intergenic
930026787 2:47033970-47033992 CACGAAAGCCGGGTTTTCTCCGG - Intronic
934757203 2:96832559-96832581 CCGGGACGCCGGGCCTGCTGTGG - Exonic
944158402 2:196633569-196633591 CCGTGTCTGCGGGTTTTCTCTGG + Intergenic
946706073 2:222460089-222460111 CAGGGCCTCCGGGTTTGCTCGGG + Intronic
947820036 2:233063133-233063155 CAGGGCAGCCGGGTTTTCTGCGG + Intronic
948643359 2:239388883-239388905 CCAGGGCCCCGGGTTTTCCCAGG + Intronic
1175856066 20:62121886-62121908 CCTGGGCGCCGGGTGTTCCCGGG - Intergenic
970439538 4:16068157-16068179 TCAGGACTCCGGGTTCTCTCAGG - Intronic
992212149 5:74491351-74491373 CCTGGAAGTCGAGTTTTCTCAGG + Intergenic
1002929075 6:1620885-1620907 CCCAGACCCCGGGTGTTCTCAGG + Intergenic
1014009827 6:116462489-116462511 CCGAGAGGCCGAGCTTTCTCAGG + Intronic
1018612919 6:165661730-165661752 CAGGGACGCCGGGGTTTCCCAGG - Intronic
1019171641 6:170136365-170136387 CCGGCACGCTGGCTTCTCTCTGG + Intergenic
1019563945 7:1670578-1670600 CCGGGCCCCCGGGCTTTGTCGGG - Intergenic
1022506571 7:30911539-30911561 CCGAGACACCTGGATTTCTCTGG + Intergenic
1032071893 7:128812941-128812963 CAGGGAGGCAGGGTTTCCTCTGG + Intronic
1036181014 8:6585437-6585459 CGGGAACGCCGGCTTTTCCCGGG + Intronic
1048524758 8:135192187-135192209 CCAGGACTGAGGGTTTTCTCAGG - Intergenic
1060544205 9:124450867-124450889 TCAGGACACCGTGTTTTCTCAGG + Intergenic
1061897522 9:133656143-133656165 CCGGGACGCTGGGTGCACTCAGG + Intronic
1062111814 9:134785991-134786013 CTGGGACTCCGAGTTTTCCCTGG - Exonic
1062120204 9:134829995-134830017 CCAGGAGCCCGGGTTTTCTTTGG - Exonic
1203761161 EBV:13428-13450 CCGGGCCGCCGGGGTCCCTCCGG - Intergenic
1203762090 EBV:16500-16522 CCGGGCCGCCGGGGTCCCTCCGG - Intergenic
1203763019 EBV:19572-19594 CCGGGCCGCCGGGGTCCCTCCGG - Intergenic
1203763948 EBV:22644-22666 CCGGGCCGCCGGGGTCCCTCCGG - Intergenic
1203764877 EBV:25716-25738 CCGGGCCGCCGGGGTCCCTCCGG - Intergenic
1203765806 EBV:28788-28810 CCGGGCCGCCGGGGTCCCTCCGG - Intergenic
1203766735 EBV:31860-31882 CCGGGCCGCCGGGGTCCCTCCGG - Intergenic
1203767664 EBV:34932-34954 CCGGGCCGCCGGGGTCCCTCCGG - Intergenic
1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG + Intergenic
1189333442 X:40156351-40156373 CCGCGCGGCCGGGTTTTTTCGGG + Intronic