ID: 1186514543

View in Genome Browser
Species Human (GRCh38)
Location X:10156816-10156838
Sequence ATTCGTGTCCAGAGAAAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 82}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514543_1186514555 17 Left 1186514543 X:10156816-10156838 CCGGGTTTTCTCTGGACACGAAT 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1186514555 X:10156856-10156878 CGAATGACACTGGCACGGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 24
1186514543_1186514551 7 Left 1186514543 X:10156816-10156838 CCGGGTTTTCTCTGGACACGAAT 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1186514551 X:10156846-10156868 GGGTAGGAGGCGAATGACACTGG 0: 1
1: 0
2: 2
3: 12
4: 133
1186514543_1186514552 12 Left 1186514543 X:10156816-10156838 CCGGGTTTTCTCTGGACACGAAT 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1186514552 X:10156851-10156873 GGAGGCGAATGACACTGGCACGG 0: 1
1: 0
2: 0
3: 9
4: 120
1186514543_1186514549 -6 Left 1186514543 X:10156816-10156838 CCGGGTTTTCTCTGGACACGAAT 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1186514549 X:10156833-10156855 ACGAATGCTCCGGGGGTAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1186514543_1186514556 23 Left 1186514543 X:10156816-10156838 CCGGGTTTTCTCTGGACACGAAT 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1186514556 X:10156862-10156884 ACACTGGCACGGCGGGGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 95
1186514543_1186514553 15 Left 1186514543 X:10156816-10156838 CCGGGTTTTCTCTGGACACGAAT 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG 0: 1
1: 0
2: 0
3: 2
4: 59
1186514543_1186514548 -9 Left 1186514543 X:10156816-10156838 CCGGGTTTTCTCTGGACACGAAT 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514543_1186514554 16 Left 1186514543 X:10156816-10156838 CCGGGTTTTCTCTGGACACGAAT 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1186514554 X:10156855-10156877 GCGAATGACACTGGCACGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514543 Original CRISPR ATTCGTGTCCAGAGAAAACC CGG (reversed) Intergenic
901124936 1:6922597-6922619 ATGCATGTCCTGAGAAAAGCCGG + Intronic
910653382 1:89593915-89593937 ATTGGTGTTAAGAGAAAACCAGG - Exonic
911568430 1:99492866-99492888 ACTCATTTCCAGAGAAAACCGGG + Intergenic
912721754 1:112026088-112026110 AATCCTGTCCAGAGAAATCTTGG - Intergenic
1065247778 10:23776156-23776178 ATTCAAGTTCAGAGGAAACCAGG - Intronic
1066204699 10:33176800-33176822 ATAAGTGTCCAGAGAAAAGCAGG + Intergenic
1068843323 10:61640608-61640630 ATTCGTGTGCTGGGAAAAACTGG + Intergenic
1068950401 10:62770884-62770906 ATGCCTGTCCAAGGAAAACCGGG + Intergenic
1071882255 10:89911870-89911892 TTTCCTGTTCAGAGAAAACTGGG + Intergenic
1073911166 10:108346414-108346436 ATTCGTGACCAGTAACAACCAGG + Intergenic
1076850315 10:133089208-133089230 ATCCGTGCCCTGTGAAAACCTGG + Intronic
1081411277 11:42761125-42761147 ATTGGATTCCAGAGAGAACCAGG - Intergenic
1082077193 11:47983075-47983097 ATTGATGTCCAGAGAAGACAGGG + Intronic
1082212127 11:49517883-49517905 ATTGGAGTCCTGAGAAAGCCTGG - Intergenic
1083263025 11:61533275-61533297 ATGGGTCTCCAGGGAAAACCAGG - Intronic
1086637461 11:89106630-89106652 ATTGGAGTCCTGAGAAAGCCTGG + Intergenic
1086752797 11:90518943-90518965 ATTGTTGTCCAGAGAAATGCTGG + Intergenic
1091477558 12:790952-790974 ATTCATTTCCATAGAAGACCTGG - Intronic
1104770662 12:131361851-131361873 ATCCATGCACAGAGAAAACCTGG + Intergenic
1110064111 13:71080628-71080650 ATTCTTGTCCAATGAAAAGCAGG + Intergenic
1113508469 13:110832620-110832642 AGTTGTGTCCCGTGAAAACCAGG + Intergenic
1117549043 14:56816336-56816358 AATCGTGTCTAATGAAAACCTGG + Intergenic
1120958764 14:90105727-90105749 ATTTGTGTCCAAAGAGAGCCAGG + Intronic
1131795816 15:96015814-96015836 CTTTGTGTCCAGAGTAAACTAGG - Intergenic
1132365491 15:101253542-101253564 ACTAGTGTCCAGTGAAAAGCTGG + Intergenic
1133758052 16:8777202-8777224 ATTGGTGTCAAAAGATAACCAGG - Intronic
1134370652 16:13621036-13621058 CTTCCTGTCCAGAGAAAGACAGG - Intergenic
1136012853 16:27375418-27375440 ATTGGTGGCCAAAGAAAAGCAGG - Intergenic
1138480828 16:57302169-57302191 ATTCTTGTCCACAGAAATACAGG + Intergenic
1140672200 16:77290475-77290497 ATGCCTGGCCAGAGAAAATCAGG + Intronic
1140822783 16:78678856-78678878 AGTCGTCTCCAGAGTAAACTGGG - Intronic
1140913863 16:79477622-79477644 ATTCAGGTGAAGAGAAAACCAGG - Intergenic
1148489646 17:48014751-48014773 ATTCGTGTGCAGAGGGAACAAGG - Intergenic
1148830143 17:50426013-50426035 CTTCGGATCCAGAGGAAACCAGG + Intergenic
1153949773 18:10048201-10048223 ATTCTTGTCCTGAGAACACAAGG - Intergenic
1156610709 18:38720811-38720833 ATTCTTCTCCAGTGAAATCCAGG + Intergenic
1159028944 18:63211414-63211436 ATTTGAGTCGAGAGAAAACAAGG - Intronic
1161034280 19:2075747-2075769 GTTCGTCTCCCGATAAAACCTGG + Intronic
925590941 2:5508246-5508268 ATTTATGTTCAGAGAAAACCGGG - Intergenic
930297820 2:49577775-49577797 CTTTGTGTAAAGAGAAAACCTGG + Intergenic
931427604 2:62185341-62185363 ACTCATGTCCAGAGAAAACACGG - Intergenic
935963182 2:108447514-108447536 ATTCCTGTCCAATGACAACCAGG + Intergenic
942121123 2:172778516-172778538 ATTCCTGTGCAGAGATAATCAGG - Intronic
943590909 2:189795564-189795586 ATCTGTGTCCAGAGAAAACAAGG + Intronic
944502760 2:200378859-200378881 ATTCACGTCCAAAGAAAACATGG - Intronic
945529885 2:210939297-210939319 ATTGCTTTGCAGAGAAAACCAGG - Intergenic
946588606 2:221218514-221218536 ATTCGTTTTCAGTGAAAACCAGG + Intergenic
1174983432 20:55422677-55422699 ATTCATGTCTTGAGAAAAACAGG + Intergenic
1175392333 20:58635306-58635328 TTTTGTGTCCAGGGAACACCTGG + Intergenic
1176841306 21:13845425-13845447 ATGCCTCTCCAGAGAAACCCAGG - Intergenic
1177787837 21:25691656-25691678 ATTCATGTCTTCAGAAAACCAGG - Intronic
1179823621 21:43951766-43951788 CTATGTGTGCAGAGAAAACCAGG + Intronic
1179953421 21:44724278-44724300 ATCTGTGTCCTTAGAAAACCGGG - Intergenic
1184913792 22:47553114-47553136 ATTCGGGTCCACCCAAAACCTGG + Intergenic
949143674 3:668213-668235 GTACGTTTTCAGAGAAAACCTGG + Intergenic
950244474 3:11403431-11403453 GTTTGTGTTCAGAGAAAATCTGG + Intronic
950710995 3:14812563-14812585 ATTTGTCTCCAGTGTAAACCTGG + Intergenic
950734611 3:14995639-14995661 AAACGTGTCCACAGAAAAACTGG - Intronic
956095470 3:65711655-65711677 ATTGGTGTCCTGAGAAAAAGAGG + Intronic
956585741 3:70862568-70862590 ATTCATGCCCAGAGAAAAATGGG + Intergenic
956839108 3:73120721-73120743 ATCCTTGGCCAGAGAAAACAGGG - Intergenic
959663055 3:108890809-108890831 ATTAGTGTCCAGAGAGGCCCAGG + Intergenic
962620868 3:137177081-137177103 ATTCATGTCCATAGACAATCTGG - Intergenic
962777577 3:138677383-138677405 ATTCATTTTCAGACAAAACCCGG + Intronic
966594570 3:181713576-181713598 ATTTTTGTACAGAGAAAACCTGG + Exonic
966986829 3:185188255-185188277 ACTCTTGTCCAAAGAATACCAGG - Intergenic
969446677 4:7248809-7248831 ATTCGTGGCCTGAGAAAGGCTGG + Intronic
981820576 4:148882030-148882052 ATTACTGTTCAGGGAAAACCTGG - Intergenic
982306267 4:153934425-153934447 ATTCTTGTTGAGAGAAAACATGG + Intergenic
984463252 4:180061984-180062006 ATATGTCTTCAGAGAAAACCGGG + Intergenic
987675845 5:21071629-21071651 ATTCATGTCCTGAGAGAAACAGG + Intergenic
991000899 5:61781754-61781776 ATTTGTGTCCAAAGAAGACAAGG - Intergenic
994827316 5:104730882-104730904 AATTGTTTCCAGAGATAACCGGG - Intergenic
995575409 5:113526572-113526594 ATTCATTTTCAAAGAAAACCGGG + Exonic
1001025269 5:168218895-168218917 AGTCGTGTCCACACAGAACCTGG + Exonic
1004523478 6:16383897-16383919 ATCCGTGTAAAGAGAAAATCAGG + Intronic
1009863449 6:69365758-69365780 ATTCATGTCCAGAGAAAAACTGG - Intronic
1010822034 6:80426114-80426136 CTTCCTGTTCACAGAAAACCTGG - Intergenic
1013864329 6:114676514-114676536 AATTGTGTCAAGAGAAACCCTGG - Intergenic
1022584909 7:31599424-31599446 ATTCATGTCCAGAGTTAACCAGG - Intronic
1028732301 7:94165576-94165598 ATTCCTGTGAAGATAAAACCAGG - Intergenic
1033306163 7:140227379-140227401 AATCATGTCCAGAGCAAAGCAGG + Intergenic
1037991097 8:23321734-23321756 ATTCATGTTCAGAAAAAAACTGG - Intronic
1043466169 8:80509391-80509413 ATTTGTGTTCTGAGAAAATCTGG + Intronic
1044957081 8:97492284-97492306 CTTCTTATCCAGAGCAAACCTGG + Intergenic
1047376525 8:124302880-124302902 ATTTTTGTACAGAGAAAAACAGG + Intergenic
1050452629 9:5799378-5799400 ATTCATGTGCAGAGAAAAGTGGG + Intronic
1056616953 9:88176913-88176935 ATTCGTGGACTGAGAAAAGCAGG - Intergenic
1057893372 9:98886619-98886641 ATTGTTGTCCAGACAAAGCCAGG - Intergenic
1059583835 9:115583546-115583568 ATTCATTCCCAGAGAAAACCTGG - Intergenic
1062443238 9:136582887-136582909 CTTCGTCTCCAGAGAGACCCAGG + Intergenic
1186514543 X:10156816-10156838 ATTCGTGTCCAGAGAAAACCCGG - Intergenic
1188735019 X:33702539-33702561 ATTGGTAGCCAGAGAAAACCAGG + Intergenic
1193532630 X:82674718-82674740 TCTGGTGTCCAGAGAAAATCAGG + Intergenic
1194460636 X:94163097-94163119 ATTCTTGTCCAGATAGAATCAGG - Intergenic