ID: 1186514544

View in Genome Browser
Species Human (GRCh38)
Location X:10156823-10156845
Sequence TTCTCTGGACACGAATGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514534_1186514544 16 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1186514540_1186514544 -1 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1186514532_1186514544 21 Left 1186514532 X:10156779-10156801 CCAGCCCCTGAGGGTGGGGCGTC 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1186514535_1186514544 15 Left 1186514535 X:10156785-10156807 CCTGAGGGTGGGGCGTCCTGTCT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1186514531_1186514544 22 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1186514533_1186514544 17 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1186514526_1186514544 30 Left 1186514526 X:10156770-10156792 CCGTGCAGCCCAGCCCCTGAGGG 0: 1
1: 3
2: 10
3: 82
4: 532
Right 1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1186514541_1186514544 -8 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514544 Original CRISPR TTCTCTGGACACGAATGCTC CGG Intergenic
900686904 1:3954483-3954505 TTCTCTGGACCCTATTTCTCTGG + Intergenic
900873893 1:5327443-5327465 AACTCTGGACACTGATGCTCAGG - Intergenic
906292466 1:44628151-44628173 TCCTCTGGACCAGAATGCTCTGG - Intronic
907794996 1:57707521-57707543 TTCTCTGGGGATGAATGCCCAGG + Intronic
909553000 1:76920136-76920158 TTCCCTGGACATGAATGATATGG - Intronic
910516343 1:88065148-88065170 TTCTCTGGTCCCAAATCCTCAGG - Intergenic
911126479 1:94345292-94345314 TTCTCTGGACCTGAGTGCCCAGG - Intergenic
911650584 1:100383480-100383502 TTCTCAGGAAAGGAATACTCTGG - Intronic
918348606 1:183630544-183630566 ATCTCTGGACAAGAATGGTGTGG - Exonic
919870510 1:201817264-201817286 TTCTCTGGACTCAGATCCTCTGG + Exonic
920748779 1:208654365-208654387 TTCTCTGGAAAGGAAGGTTCAGG + Intergenic
921154269 1:212426518-212426540 GTTTCTGGACAAGAATGCACAGG - Intergenic
1063237373 10:4131082-4131104 TGCTCTGGACACGTATGCTGAGG - Intergenic
1063655751 10:7986687-7986709 TTGTCTAGACACAAATGGTCAGG + Intronic
1066048150 10:31612355-31612377 TCCTGTGGACAGGAAGGCTCTGG - Intergenic
1072648059 10:97274945-97274967 TCCTCTGGATACCAATGCTGAGG + Intronic
1073462905 10:103676781-103676803 TTCTCTGCACACAAATGCCCTGG - Intronic
1083707670 11:64527373-64527395 AACTCTGGACACCAAAGCTCGGG + Intergenic
1084439610 11:69165113-69165135 AACTCTGGACACCAAGGCTCCGG + Intergenic
1084503862 11:69553261-69553283 ATCTGTGGACAGGAATGCTGGGG - Intergenic
1088611328 11:111580062-111580084 ATCTCTGGACAGGAAGGCTCAGG + Intergenic
1089129426 11:116200286-116200308 TTCACAGGCCACCAATGCTCAGG - Intergenic
1089492371 11:118892091-118892113 TTCTCTTTACTCTAATGCTCAGG - Intronic
1095271796 12:40227063-40227085 TACTCCGGACAAGTATGCTCAGG - Intronic
1096717094 12:53498213-53498235 GTGTCTGGACAGGAAGGCTCAGG + Intronic
1097751870 12:63364272-63364294 TTCTCTTAACATGATTGCTCTGG + Intergenic
1100871204 12:98912316-98912338 TTCTCTGGTAGCGAGTGCTCAGG - Intronic
1103913167 12:124363049-124363071 TTCTGTGGACCCAAATCCTCTGG + Intronic
1104670883 12:130679325-130679347 TTCTCTAGACACAAATGCATGGG - Intronic
1105283197 13:18981861-18981883 TTCTCTGGACCAGAATAATCAGG - Intergenic
1115052530 14:29080770-29080792 TTCTGTGGACACCAGTGTTCAGG - Intergenic
1117982891 14:61359210-61359232 TTCTGTGGACCACAATGCTCTGG + Intronic
1128246998 15:66139919-66139941 TTCTCTTGACACTGGTGCTCAGG - Intronic
1128292581 15:66489293-66489315 TTCTCTGGAAGCGTATACTCTGG + Intronic
1128888257 15:71307990-71308012 AACTCTGGACACCAAGGCTCTGG - Intronic
1131939574 15:97546073-97546095 TTCTCAGGAAACCAATCCTCAGG - Intergenic
1135718067 16:24790227-24790249 TACTCTGGAGACAAATGTTCAGG + Exonic
1138534078 16:57650584-57650606 TACACTGCACAAGAATGCTCTGG - Intronic
1141149834 16:81556329-81556351 TTCTCTGAACACGGGTGCGCTGG + Intronic
1141857130 16:86691040-86691062 TTCTCTGGAAACTCTTGCTCTGG + Intergenic
1143415853 17:6749433-6749455 AACTCTGGACACTAAAGCTCAGG + Intergenic
1149011723 17:51863886-51863908 AACTCTGGACACCAAAGCTCAGG - Intronic
1150615311 17:66765988-66766010 TTCTCTGGGAAAAAATGCTCTGG + Intronic
1151015821 17:70551553-70551575 TTCTCAGCACATCAATGCTCTGG - Intergenic
1156167157 18:34436146-34436168 TTCTCTGGAAACTAATCATCAGG + Intergenic
1157909478 18:51602046-51602068 TCCTCTGGAAAGAAATGCTCTGG - Intergenic
1165716307 19:38047995-38048017 TTCTCTGTGCACGAGAGCTCAGG - Intronic
1167672408 19:50860961-50860983 AACTCTGGACACTAAGGCTCAGG - Intergenic
930542917 2:52730148-52730170 TTCTCTGGCTACTAATTCTCTGG + Intergenic
930691338 2:54368734-54368756 AACTCTGGACACCAAGGCTCAGG + Intronic
930846099 2:55905901-55905923 TTTACTGGAAACTAATGCTCTGG + Intronic
931895563 2:66725782-66725804 TTCACTGGGCATGAATGCGCCGG - Intergenic
937609335 2:123840987-123841009 ATCTCTGCACAGGAATGCTGTGG - Intergenic
938367325 2:130745051-130745073 TTCTCTGGAGACGGATCCTCAGG - Intergenic
944976674 2:205061219-205061241 TTCTTTGAACTCAAATGCTCAGG + Intronic
948550746 2:238771664-238771686 ATCTCTGGAAGAGAATGCTCAGG + Intergenic
1170844927 20:19954361-19954383 TTGTTTGGACATGAATGGTCAGG + Intronic
1178429736 21:32508769-32508791 TTATCTGGACACGAATGAGCTGG + Intronic
1182310589 22:29402816-29402838 TTCTCAGGACTGGAAAGCTCAGG + Intronic
1182690461 22:32157930-32157952 TTCTCAGGACTGGAAAGCTCAGG - Intronic
1182690693 22:32159508-32159530 TTCTCAGGACTGGAAAGCTCAGG - Intergenic
949931892 3:9085138-9085160 CTCTCTGGCAATGAATGCTCAGG + Intronic
950122451 3:10490701-10490723 TTTTCTGGATAAGAATGCTGTGG - Intronic
951040053 3:17980117-17980139 ATCTCTGGACACACATGCACTGG + Intronic
952423617 3:33152989-33153011 TTCTTTGGACAGGAAGGCCCCGG - Exonic
953400340 3:42608774-42608796 TTCTTTGGATGCGAATGCTAAGG + Intronic
953713102 3:45291772-45291794 ATCCCTGCACACGAAAGCTCAGG + Intergenic
954485905 3:50851139-50851161 TTCTCTGCACATGAATGGTGGGG + Intronic
961420237 3:126797259-126797281 TTCTCTTGCCATGAATGCTAAGG + Intronic
961471011 3:127112654-127112676 TTCTCAGAACATGGATGCTCAGG - Intergenic
965315291 3:167183043-167183065 TTCTCTGGAAAAGAAAGATCTGG + Intergenic
967293732 3:187945945-187945967 TTTTCAGGACATGAATGCTCTGG - Intergenic
968168966 3:196493113-196493135 TATTCTGGACACTAATTCTCTGG - Intronic
970447431 4:16135954-16135976 AACTCTGGACACCAAGGCTCTGG - Intergenic
972542454 4:40051176-40051198 TTCTCTGTACATGAATGGACAGG - Intergenic
978152496 4:105453802-105453824 TTCTGGGGATACAAATGCTCAGG - Intronic
981529302 4:145736354-145736376 TTCTCTGGACAGGATTTCACAGG + Intronic
982140546 4:152313541-152313563 TTCTCTGGGAAAGAATCCTCTGG + Intergenic
986485243 5:8229529-8229551 TTCTCTGGAAACTGATGCTGAGG + Intergenic
988942401 5:36159542-36159564 TTCTCTGGGCAGGAATACTGGGG + Intronic
990591677 5:57271824-57271846 TTTTCTGGACACAAATTTTCAGG - Intergenic
994765438 5:103910155-103910177 TTCTATGTAAACAAATGCTCTGG + Intergenic
996404544 5:123092830-123092852 TTCTCTGGACAAGCAAGCTTAGG + Intronic
999954719 5:156687891-156687913 TCCTCTGGTCACTAATGCTACGG - Intronic
1003433858 6:6067726-6067748 TTCTCTGGAAAAGAAAGATCTGG + Intergenic
1007518060 6:42429245-42429267 TTCTCCAGACACCAGTGCTCAGG - Intronic
1008769398 6:54961091-54961113 TGCTCTGCACACCAATGGTCTGG + Intergenic
1012507067 6:99959311-99959333 TTCTGTGGACATGACTCCTCTGG - Intronic
1024784330 7:52889344-52889366 ATGTCTGGACCCAAATGCTCAGG + Intergenic
1024947557 7:54825604-54825626 TTCTCTAAACACCAATGCCCAGG + Intergenic
1025970661 7:66321290-66321312 AACTCTGGACACAAAAGCTCAGG - Intronic
1026888169 7:73966769-73966791 TTCTCTGGGCAGGAAGGGTCAGG + Intergenic
1026937138 7:74264053-74264075 CTCTTTGGACACGTTTGCTCAGG - Intergenic
1029161054 7:98552210-98552232 AACTCTGGACACCAAGGCTCAGG + Intergenic
1033155600 7:138954546-138954568 TTCTCTGGCCAAAAATGGTCTGG + Intronic
1033472384 7:141661712-141661734 TCATCTGGACACGAATTCTCTGG - Exonic
1034637839 7:152581344-152581366 TTCTCTGTAGATGAGTGCTCAGG + Intergenic
1038120957 8:24614750-24614772 ACCTCTGGAGACGAATGATCTGG + Intergenic
1040661185 8:49577660-49577682 ATCTCTGGAGATGAATGCTGAGG - Intergenic
1043267536 8:78285575-78285597 ATCTCTGAACACGAAGGCTCAGG - Intergenic
1050867757 9:10525012-10525034 TTCTCTGCAGACAAATGCTTCGG + Intronic
1051399511 9:16664391-16664413 TTCTCTGGATAGGAAAGTTCTGG - Intronic
1055117889 9:72625182-72625204 TTCTCTGGAGACACTTGCTCTGG + Intronic
1059852164 9:118354606-118354628 TTCTCTCCACAGGAATTCTCTGG + Intergenic
1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG + Intergenic
1187352270 X:18531180-18531202 CTCCCTGGACACCAAGGCTCTGG + Intronic
1194760346 X:97788690-97788712 AATTCTGGACACCAATGCTCAGG + Intergenic
1196328599 X:114439322-114439344 GACTCTGGACACCAATGCTCAGG - Intergenic