ID: 1186514545

View in Genome Browser
Species Human (GRCh38)
Location X:10156824-10156846
Sequence TCTCTGGACACGAATGCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 101}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514541_1186514545 -7 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514545 X:10156824-10156846 TCTCTGGACACGAATGCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1186514534_1186514545 17 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514545 X:10156824-10156846 TCTCTGGACACGAATGCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1186514535_1186514545 16 Left 1186514535 X:10156785-10156807 CCTGAGGGTGGGGCGTCCTGTCT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1186514545 X:10156824-10156846 TCTCTGGACACGAATGCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1186514533_1186514545 18 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514545 X:10156824-10156846 TCTCTGGACACGAATGCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1186514532_1186514545 22 Left 1186514532 X:10156779-10156801 CCAGCCCCTGAGGGTGGGGCGTC 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1186514545 X:10156824-10156846 TCTCTGGACACGAATGCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1186514540_1186514545 0 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514545 X:10156824-10156846 TCTCTGGACACGAATGCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1186514531_1186514545 23 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514545 X:10156824-10156846 TCTCTGGACACGAATGCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514545 Original CRISPR TCTCTGGACACGAATGCTCC GGG Intergenic
900216765 1:1485930-1485952 TCTCAGGACCCAAAAGCTCCTGG - Intronic
900223848 1:1523659-1523681 TCTCAGGACCCAAAAGCTCCTGG - Intronic
900873892 1:5327442-5327464 ACTCTGGACACTGATGCTCAGGG - Intergenic
901016468 1:6234748-6234770 TCTCTGGAAACGAAGTCTCCTGG - Intronic
902130068 1:14252523-14252545 TTGCTGGACAGGAATGTTCCAGG - Intergenic
904767495 1:32861720-32861742 GCTCTGGACAGGAATGTTCGAGG + Intergenic
906511408 1:46412218-46412240 GCTCTGGACTTGAATGCCCCAGG + Exonic
917374645 1:174336643-174336665 TGTCTGGATACCACTGCTCCTGG + Intronic
919646394 1:200099145-200099167 TCTCTGGGTACAAAGGCTCCTGG - Intronic
920687588 1:208121122-208121144 TCTCTGTAAACCAATGCTGCTGG + Intronic
921154268 1:212426517-212426539 TTTCTGGACAAGAATGCACAGGG - Intergenic
1063166234 10:3465451-3465473 TCTCTGGACAAACATTCTCCTGG + Intergenic
1066612556 10:37265375-37265397 TCTAAGGACAGGAATGCTGCGGG - Intronic
1073462904 10:103676780-103676802 TCTCTGCACACAAATGCCCTGGG - Intronic
1076630949 10:131851927-131851949 CCTCTGGACATGAATGTTTCTGG - Intergenic
1076770185 10:132658696-132658718 TCTCTGGGCACGGATGCTCTAGG + Intronic
1081360717 11:42174566-42174588 TCTCTGAATACAAATGCTCCAGG + Intergenic
1084326611 11:68403967-68403989 ACTGTGGGCACGAAGGCTCCCGG - Intronic
1084439611 11:69165114-69165136 ACTCTGGACACCAAGGCTCCGGG + Intergenic
1086490815 11:87356397-87356419 CCTCTGCACACAAAGGCTCCTGG + Intergenic
1086811144 11:91311774-91311796 TCCCTGGACATAAATGGTCCTGG - Intergenic
1087829546 11:102804174-102804196 TCTCTGGCCACTATTTCTCCAGG + Intergenic
1089496650 11:118911434-118911456 TCTCTGGGGAGGAAGGCTCCTGG + Intronic
1091305147 11:134531827-134531849 TCTCTGGCCCCCATTGCTCCCGG + Intergenic
1096717095 12:53498214-53498236 TGTCTGGACAGGAAGGCTCAGGG + Intronic
1099487532 12:83246990-83247012 TCTGTGGACAGAAATGCTACTGG + Intergenic
1102177896 12:110889489-110889511 TCTCTGGGGAAGAACGCTCCAGG + Intronic
1104548397 12:129732921-129732943 TCTCTGGACACCAAGGCTCCAGG + Intronic
1106047761 13:26160852-26160874 CCTCTGGGCATGCATGCTCCTGG + Intronic
1113294076 13:108938660-108938682 TCTCTGAACAGGCATTCTCCAGG + Intronic
1113652939 13:112049927-112049949 TCTCAGAACACTAATGTTCCTGG + Intergenic
1119477389 14:74939035-74939057 TCTCTGGCTATGAATGTTCCCGG + Intergenic
1126681286 15:51204677-51204699 TCTCTGGGCACCAATGCCTCTGG - Intergenic
1126945062 15:53810120-53810142 TCTCTGGCCACCACTGCTCTTGG - Intergenic
1127912855 15:63432415-63432437 ACTTTGGTCACGACTGCTCCTGG + Intergenic
1128036660 15:64532932-64532954 TCTCTGGACCAGGGTGCTCCAGG - Intronic
1128893973 15:71356254-71356276 TCTCTGCACACGGTTGCTTCTGG + Intronic
1129970301 15:79772466-79772488 TCAGGGGACACCAATGCTCCTGG - Intergenic
1130960525 15:88655876-88655898 TCTCTGGGCATAAATGCACCAGG - Exonic
1131560561 15:93436117-93436139 TCTCTGTGAATGAATGCTCCTGG + Intergenic
1141196198 16:81863250-81863272 TCTCTGGATTGGATTGCTCCAGG + Intronic
1145772048 17:27500260-27500282 ACTCTGGACCCTAATGCTCAAGG - Intronic
1147689896 17:42308615-42308637 TCTGTGGGCTCGAATGATCCCGG - Intronic
1147999345 17:44378695-44378717 CCTCTAGACACGAATCGTCCTGG - Exonic
1153390468 18:4552082-4552104 TCTCTGGACACTAAAACTGCAGG + Intergenic
1156456798 18:37299393-37299415 CCTCTGGGCAGGGATGCTCCTGG + Intronic
1157786044 18:50483461-50483483 TCCCTGGACACGGAAGCTGCTGG + Intergenic
1160097208 18:75885404-75885426 TCACAGGACACAAAAGCTCCAGG + Intergenic
1160925299 19:1541792-1541814 TCCCTGGAAACAAATGTTCCGGG - Intergenic
1162697023 19:12484526-12484548 TCTGTGGACCCGAGTCCTCCTGG - Intronic
1166635441 19:44447512-44447534 TCTCTTGACACTAGAGCTCCAGG - Exonic
1166757490 19:45202415-45202437 TCTGTGGCCACCACTGCTCCAGG + Exonic
1167951402 19:53030636-53030658 TCTCTGGACTTGAAAGATCCAGG + Intergenic
1168327687 19:55546528-55546550 TCCCTGGACACCAGCGCTCCTGG - Intergenic
1168416229 19:56170593-56170615 ACTCTGCACAGAAATGCTCCTGG + Intergenic
930473345 2:51848427-51848449 TCTCTTGACAAGAGTGCTCTCGG - Intergenic
937609334 2:123840986-123841008 TCTCTGCACAGGAATGCTGTGGG - Intergenic
948550747 2:238771665-238771687 TCTCTGGAAGAGAATGCTCAGGG + Intergenic
948837471 2:240632560-240632582 TTTCTGGACATGAACCCTCCTGG - Intergenic
1169803130 20:9532092-9532114 TCTCTGGACACGTCTGTGCCTGG + Intergenic
1177120259 21:17129112-17129134 TCTCTAAACACTAATTCTCCTGG + Intergenic
1178154444 21:29835031-29835053 TTTCTGATCACTAATGCTCCAGG + Intronic
1179251182 21:39673199-39673221 TCTCTGCCCACCGATGCTCCTGG + Intergenic
1180046393 21:45308132-45308154 TGTCTGTACACGTATGTTCCTGG - Intergenic
1181423108 22:22815456-22815478 TGTCAGGACAGGAAGGCTCCTGG - Intronic
1183767511 22:39892817-39892839 GCTCTGGCCAAGAATGCTACGGG + Intronic
949792781 3:7811604-7811626 TCTCTGGACACTAAAGCTCAAGG + Intergenic
952423616 3:33152988-33153010 TCTTTGGACAGGAAGGCCCCGGG - Exonic
953812628 3:46127573-46127595 CCTCTGTACACACATGCTCCAGG - Intergenic
955585190 3:60470476-60470498 TCTCTGACCACCACTGCTCCGGG + Intronic
960618520 3:119618074-119618096 TCAGTGGACAGGAATTCTCCAGG - Exonic
965942378 3:174200891-174200913 TCTGTGGACACTACTGCTCTAGG - Intronic
968541023 4:1168506-1168528 TCTCTGGAGAGGGCTGCTCCAGG - Intronic
968555567 4:1244906-1244928 TCTCAGGACTGGAAGGCTCCGGG - Intronic
973140771 4:46765704-46765726 TCACTGCACACCAAGGCTCCAGG + Intronic
975667675 4:76749114-76749136 TCTCTGCATATGAATGCTGCTGG + Intronic
984220427 4:176967758-176967780 TCTCTGGCCCCTCATGCTCCTGG - Intergenic
986419332 5:7562595-7562617 TGTCTGTGCACGCATGCTCCAGG - Intronic
988851811 5:35187949-35187971 TCTGTGGACACAAATTCTTCTGG + Intronic
990873137 5:60455749-60455771 TCTCTGGACTCTAATGCTGTAGG - Intronic
992532702 5:77667546-77667568 TCTCTAGAGAAGAATCCTCCAGG - Intergenic
994981248 5:106876684-106876706 TCTCTGGGCACAAATGAGCCTGG + Intergenic
998378482 5:141707529-141707551 TCCCTGGAGACCAATGCTCATGG + Intergenic
1000662451 5:163952348-163952370 TCACTAGACATGATTGCTCCAGG + Intergenic
1002096011 5:176831436-176831458 TCTCTGCGCAGGAATGCTCAAGG + Intronic
1004456456 6:15796260-15796282 TGTCTGGGCAGGAATGCTCCAGG + Intergenic
1005385850 6:25283477-25283499 ACTCTGGACACTAATGTTGCTGG - Intronic
1008055954 6:46946247-46946269 TTCCAGGACACCAATGCTCCTGG - Intronic
1008704740 6:54144290-54144312 TCTCTGCCCAGGAATGCTTCTGG + Intronic
1009907113 6:69883766-69883788 TCTCTGGACACAGAGGCTTCTGG - Intronic
1012038077 6:94168486-94168508 TCTCTGTATAATAATGCTCCAGG + Intergenic
1013193812 6:107827727-107827749 TCTCTCCACACGAGTGCTACTGG + Intergenic
1018771007 6:166971443-166971465 TCCCTGGCCTCAAATGCTCCCGG + Intergenic
1019417985 7:935888-935910 TCTGTGGGCCCGAATCCTCCTGG + Intronic
1026016962 7:66679192-66679214 TATCTGGGCAAGAATGTTCCAGG - Intronic
1026937137 7:74264052-74264074 TCTTTGGACACGTTTGCTCAGGG - Intergenic
1034863083 7:154616762-154616784 TCCCTGGAGGCGAATGCTCACGG - Intronic
1039146477 8:34452460-34452482 TCTCTGAACAAAAAGGCTCCTGG + Intergenic
1045363271 8:101452385-101452407 TGTCTGCACATGCATGCTCCTGG - Intergenic
1046720956 8:117618487-117618509 TCTCTGGTGAAGAATGATCCAGG - Intergenic
1049016368 8:139922878-139922900 TCTCTGGCCACTTTTGCTCCTGG + Intronic
1050210833 9:3254216-3254238 TCTGTGGAGATGAAGGCTCCAGG + Intronic
1052556824 9:30029351-30029373 TCTCTGGACACCAGTTTTCCTGG - Intergenic
1053404410 9:37859631-37859653 TCTCTGGACCAGAAAGCACCAGG + Intronic
1062493338 9:136819734-136819756 TCTCTGGACCTGAAGGCTCAAGG + Intronic
1062655620 9:137603346-137603368 TCTCTACACCCGAAAGCTCCAGG + Intergenic
1186514545 X:10156824-10156846 TCTCTGGACACGAATGCTCCGGG + Intergenic
1186748708 X:12598549-12598571 TCTCAGGGCACCAATGCTGCTGG + Intronic
1187099223 X:16175223-16175245 TCTCTGGAAAAGGATGCTCATGG - Intergenic