ID: 1186514546

View in Genome Browser
Species Human (GRCh38)
Location X:10156825-10156847
Sequence CTCTGGACACGAATGCTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 59}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514531_1186514546 24 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 59
1186514534_1186514546 18 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 59
1186514532_1186514546 23 Left 1186514532 X:10156779-10156801 CCAGCCCCTGAGGGTGGGGCGTC 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 59
1186514533_1186514546 19 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 59
1186514540_1186514546 1 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 59
1186514535_1186514546 17 Left 1186514535 X:10156785-10156807 CCTGAGGGTGGGGCGTCCTGTCT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 59
1186514541_1186514546 -6 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514546 Original CRISPR CTCTGGACACGAATGCTCCG GGG Intergenic
900823809 1:4910492-4910514 CTCTGGACACTGAGGCTTCGTGG - Intergenic
900873891 1:5327441-5327463 CTCTGGACACTGATGCTCAGGGG - Intergenic
900939330 1:5787621-5787643 CTCTGGACTGGAATGCCCCCAGG + Intergenic
903953182 1:27008239-27008261 CTCAGGACAGGAATGCTGCCTGG - Intronic
912406593 1:109443812-109443834 CTCTGAACACCAAGGCTCAGAGG + Intergenic
914376560 1:147078131-147078153 CTCTTTCCACGAAGGCTCCGGGG - Intergenic
1073462903 10:103676779-103676801 CTCTGCACACAAATGCCCTGGGG - Intronic
1077311119 11:1889508-1889530 CTCTGGGCACGGAGGCTCTGGGG + Exonic
1083029833 11:59582372-59582394 CTCTGGATACCAAAGCTCAGTGG + Intronic
1084439612 11:69165115-69165137 CTCTGGACACCAAGGCTCCGGGG + Intergenic
1086464197 11:87037247-87037269 CTGTAGACAGGATTGCTCCGTGG + Intergenic
1088505591 11:110523565-110523587 CTCTGGACATGCATGCTGGGAGG + Intergenic
1088608672 11:111556326-111556348 CTCTGGACACGAAAGCTCTGTGG - Intronic
1089165418 11:116472243-116472265 CTCTGGACACCAAAGCTCAGTGG + Intergenic
1091348374 11:134871816-134871838 CTCTGGACACCAAGGCTTAGTGG - Intergenic
1095926862 12:47587092-47587114 CACTGGACACGGATGCTACACGG - Intergenic
1096717096 12:53498215-53498237 GTCTGGACAGGAAGGCTCAGGGG + Intronic
1100380160 12:94054395-94054417 CACTGGACACCAAGGCTCAGTGG + Intergenic
1104235549 12:126932197-126932219 CTTTGGACACAAATGCTCTCAGG - Intergenic
1128283215 15:66414584-66414606 CTCTGGACACTGAAGCTCAGGGG - Intronic
1129341569 15:74889942-74889964 CTCTGGGCACGGGTGCCCCGGGG + Intergenic
1131915254 15:97258087-97258109 CTCTGGACACAAAATCTCTGTGG - Intergenic
1139672814 16:68503285-68503307 CTCTGGAAATGAGTGTTCCGTGG + Intergenic
1140960005 16:79902632-79902654 CTCTGGACAAGAAAACTTCGAGG + Intergenic
1143076020 17:4343958-4343980 CTCTGGAGACTAAAGCTCTGGGG + Intronic
1145772047 17:27500259-27500281 CTCTGGACCCTAATGCTCAAGGG - Intronic
1151428279 17:74045444-74045466 CTCTGGAGGCGAGTGCTCTGGGG - Intergenic
1151498869 17:74476060-74476082 CTCTGGACACCAAAGCTTGGAGG - Intronic
1156456799 18:37299394-37299416 CTCTGGGCAGGGATGCTCCTGGG + Intronic
1167751240 19:51381481-51381503 CTCTGGACACTGAAGCTCAGTGG + Intronic
1168416230 19:56170594-56170616 CTCTGCACAGAAATGCTCCTGGG + Intergenic
925814319 2:7732787-7732809 CGCTGGACACCAAAGCTCAGGGG - Intergenic
926489004 2:13500564-13500586 CCTTGGGCACGTATGCTCCGTGG - Intergenic
936229481 2:110687512-110687534 CTCTGAACACCAAAGCTCAGTGG - Intergenic
937609333 2:123840985-123841007 CTCTGCACAGGAATGCTGTGGGG - Intergenic
944481434 2:200161428-200161450 CTCTGGACACTGAAGCTCAGCGG - Intergenic
944624790 2:201559519-201559541 CTCTGGGCAGGAATACTCCCAGG + Intronic
948550748 2:238771666-238771688 CTCTGGAAGAGAATGCTCAGGGG + Intergenic
1169883854 20:10376164-10376186 CTCTGGACACCGAGGTTCCGTGG - Intergenic
949792782 3:7811605-7811627 CTCTGGACACTAAAGCTCAAGGG + Intergenic
950140693 3:10613125-10613147 CTCTGGACACCAAAGCTCAGTGG + Intronic
956409600 3:68965837-68965859 CTCTGGACAAGTTTGCTCAGTGG - Intergenic
961314099 3:126022746-126022768 CTATAGACACAAAGGCTCCGTGG - Intronic
964915177 3:161832206-161832228 CTCTGGACACTGAAGCTCAGTGG - Intergenic
965408825 3:168304167-168304189 CTCTGGACACTGAGGCTCAGCGG - Intergenic
979010160 4:115356362-115356384 CCCTGGACAGGAATGCCCGGAGG - Intergenic
982689367 4:158530830-158530852 CACTGAAGACGAATGCTCAGTGG - Intronic
984856311 4:184199044-184199066 CTCTGGTCACATATGCTTCGTGG - Intronic
986225009 5:5804224-5804246 CTCTGTACACCATTGCTCCCTGG + Intergenic
986254351 5:6089358-6089380 CTCTGTACACCAATGTTCTGTGG + Intergenic
1001923851 5:175621995-175622017 CTCTGGACACCAAGGCTTGGTGG - Intergenic
1003409577 6:5850832-5850854 AGCTGGTCAGGAATGCTCCGGGG - Intergenic
1008206759 6:48669481-48669503 CTTTGGGCACGCATGCTCTGTGG - Intergenic
1009244093 6:61213668-61213690 CTCTGGAGGGGAATGCTCCCAGG + Intergenic
1017999889 6:159569746-159569768 CTCTGGACACTGAAGCTCAGTGG - Intergenic
1024295721 7:47840505-47840527 CTCTGGACAGGAGAGCTCCTTGG + Exonic
1024858203 7:53806258-53806280 CCCTGGACACTAATGCTCAGTGG - Intergenic
1037501146 8:19486532-19486554 CTCTGGGCAGGAATGCTTCGAGG - Intronic
1039488741 8:37931777-37931799 CTCTGGACACCAAGGCTTAGGGG - Intergenic
1045857285 8:106779064-106779086 CTCTGGAGACGAGTCCTGCGTGG + Intergenic
1052974078 9:34399095-34399117 CTCTGGACACCAATCCTGGGAGG - Exonic
1057533989 9:95880341-95880363 CTCTGGACAGCAATGCTTTGTGG - Intronic
1061452402 9:130675403-130675425 GGCTGGGCCCGAATGCTCCGAGG - Intronic
1186100649 X:6152613-6152635 CTTTGGACACAAATTCTCCTTGG + Intronic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1187935773 X:24334516-24334538 TTCTGGACACCAAGGCTCAGGGG - Intergenic
1197188595 X:123618830-123618852 CCCTGGACAGGAATACTCGGTGG - Intronic