ID: 1186514547

View in Genome Browser
Species Human (GRCh38)
Location X:10156826-10156848
Sequence TCTGGACACGAATGCTCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 37}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514531_1186514547 25 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG 0: 1
1: 0
2: 1
3: 5
4: 37
1186514532_1186514547 24 Left 1186514532 X:10156779-10156801 CCAGCCCCTGAGGGTGGGGCGTC 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG 0: 1
1: 0
2: 1
3: 5
4: 37
1186514541_1186514547 -5 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG 0: 1
1: 0
2: 1
3: 5
4: 37
1186514533_1186514547 20 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG 0: 1
1: 0
2: 1
3: 5
4: 37
1186514535_1186514547 18 Left 1186514535 X:10156785-10156807 CCTGAGGGTGGGGCGTCCTGTCT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG 0: 1
1: 0
2: 1
3: 5
4: 37
1186514540_1186514547 2 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG 0: 1
1: 0
2: 1
3: 5
4: 37
1186514534_1186514547 19 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG 0: 1
1: 0
2: 1
3: 5
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514547 Original CRISPR TCTGGACACGAATGCTCCGG GGG Intergenic
902100774 1:13986792-13986814 TCTAGACACGAGGGCCCCGGTGG - Intergenic
916459850 1:165012166-165012188 TCTGGAAACAAATGCTCTGCTGG + Intergenic
1069056324 10:63848291-63848313 TCTGGAAAAGAAAGATCCGGAGG - Intergenic
1072913863 10:99525203-99525225 TTTGCACATGAATGCTCAGGAGG + Intergenic
1084021327 11:66420020-66420042 TTAGGACAGGAATCCTCCGGCGG - Intergenic
1092291541 12:7162394-7162416 GCTGGACACAAATGCACTGGCGG + Intergenic
1092927697 12:13287126-13287148 CCTGGACACCAAAGCTCGGGTGG + Intergenic
1096717097 12:53498216-53498238 TCTGGACAGGAAGGCTCAGGGGG + Intronic
1097316071 12:58172800-58172822 TCTGGTCATGAATGCTTCTGAGG + Intergenic
1098556660 12:71826014-71826036 TCTGGAGAGGAAGGCTCCTGTGG + Intergenic
1118571573 14:67200029-67200051 TCTGGACACCCAGGCTCTGGGGG + Intronic
1123846862 15:24311987-24312009 TCTGGACTCTAATCATCCGGTGG - Intergenic
1123865864 15:24519045-24519067 TCTGGACTCTAATCATCCGGTGG - Intergenic
1144482520 17:15639597-15639619 TCTGGACAACAGGGCTCCGGAGG - Intronic
1154361135 18:13662057-13662079 TCTGGACTTGAATGGTCTGGGGG - Intergenic
1164803524 19:31097894-31097916 TGTGGACACCAATGCTCCTCTGG - Intergenic
932097444 2:68864088-68864110 TCTGCACAGGAAGGGTCCGGTGG - Intergenic
947396895 2:229695473-229695495 TCTGGGCATTAATGCTCTGGTGG + Intronic
947802190 2:232936591-232936613 TCTGGACACCAAGGCACAGGTGG + Intronic
1172701032 20:36853863-36853885 TCCTGACACGAATGCCCCAGAGG - Intronic
1175980723 20:62737378-62737400 TCTGGACACGCATCCTAGGGTGG - Intronic
1178501777 21:33131585-33131607 TCTGCACACCATTGTTCCGGTGG + Intergenic
1180733779 22:18001088-18001110 CCTGGCCACGCATCCTCCGGCGG + Intronic
1181423106 22:22815454-22815476 TCAGGACAGGAAGGCTCCTGGGG - Intronic
956915085 3:73862429-73862451 TCTGCTCCCCAATGCTCCGGAGG - Intergenic
970359317 4:15292509-15292531 TCTGGAAACAAATGCACAGGGGG - Intergenic
974819476 4:67047245-67047267 TCTTGACACAAATGCTGAGGTGG + Intergenic
981982209 4:150807474-150807496 TCTGGACACTAAGTCTCCAGTGG + Intronic
985117177 4:186603841-186603863 TCTGGAGAAGAATACTCAGGTGG - Exonic
1000134011 5:158326703-158326725 TCTGGACACGAACACTCCATTGG + Intergenic
1003409576 6:5850831-5850853 GCTGGTCAGGAATGCTCCGGGGG - Intergenic
1004482760 6:16036912-16036934 TCTGGGCATGAATGTTCAGGTGG - Intergenic
1029161055 7:98552213-98552235 TCTGGACACCAAGGCTCAGGTGG + Intergenic
1032440400 7:131938450-131938472 TCTGGACACAGATGCTCAGATGG - Intergenic
1032513351 7:132489423-132489445 CCTGGACATGAATGCTCCCCTGG - Exonic
1033472383 7:141661709-141661731 TCTGGACACGAATTCTCTGGAGG - Exonic
1034581152 7:152043687-152043709 TCTGGAAAAGAAAGATCCGGAGG + Intronic
1037501145 8:19486531-19486553 TCTGGGCAGGAATGCTTCGAGGG - Intronic
1039488740 8:37931776-37931798 TCTGGACACCAAGGCTTAGGGGG - Intergenic
1057477534 9:95415563-95415585 TCTGGCCAGGAATGCTGCTGGGG - Intergenic
1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG + Intronic
1203779929 EBV:95722-95744 TCTGGACCAGAAGGCTCCGGCGG + Intergenic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1189081471 X:37977467-37977489 TCTGGAAATGAATGGTCAGGGGG + Intronic