ID: 1186514548

View in Genome Browser
Species Human (GRCh38)
Location X:10156830-10156852
Sequence GACACGAATGCTCCGGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 46}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514540_1186514548 6 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514533_1186514548 24 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514535_1186514548 22 Left 1186514535 X:10156785-10156807 CCTGAGGGTGGGGCGTCCTGTCT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514534_1186514548 23 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514541_1186514548 -1 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514531_1186514548 29 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514543_1186514548 -9 Left 1186514543 X:10156816-10156838 CCGGGTTTTCTCTGGACACGAAT 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514532_1186514548 28 Left 1186514532 X:10156779-10156801 CCAGCCCCTGAGGGTGGGGCGTC 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514548 Original CRISPR GACACGAATGCTCCGGGGGT AGG Intergenic
921673673 1:217953549-217953571 GACACAAATGCTTTGGGGGAAGG - Intergenic
1072995148 10:100236958-100236980 GACAGGAATGACCTGGGGGTTGG + Exonic
1076636185 10:131883765-131883787 GAGGTGAATGCTCCTGGGGTGGG - Intergenic
1078548522 11:12263969-12263991 GTCACCAATGCTCCTGGGCTAGG + Intergenic
1079452607 11:20610259-20610281 GACCCGAAGGCTCCGGGCGCTGG + Intronic
1089454512 11:118618210-118618232 GACAAGAAGGCTATGGGGGTTGG - Intronic
1092291543 12:7162398-7162420 GACACAAATGCACTGGCGGTGGG + Intergenic
1096898482 12:54849918-54849940 GACATGAAGGCTCAGGGTGTAGG - Intronic
1102947257 12:117000501-117000523 GAGTCGGAAGCTCCGGGGGTGGG - Intronic
1108408186 13:50124951-50124973 GACGCGTAGCCTCCGGGGGTCGG + Intronic
1119199994 14:72745073-72745095 GACAGGCATCCTCAGGGGGTGGG + Intronic
1121600753 14:95201287-95201309 GACACGGCTGCTTGGGGGGTTGG - Intronic
1128356104 15:66927848-66927870 GACAAGAAAGCTCCTGGGCTTGG + Intergenic
1132379616 15:101357669-101357691 CACAGGCATGCTCTGGGGGTAGG + Intronic
1132675944 16:1121289-1121311 GACACGAGTGCCCAGGGGGCTGG + Intergenic
1147611305 17:41803258-41803280 GACACGAGTCCTTGGGGGGTGGG - Intronic
1152362088 17:79837479-79837501 AACACCTAGGCTCCGGGGGTGGG + Intronic
1152891415 17:82883695-82883717 GACACAAATGCCCCGGGGCAGGG - Intronic
1152902321 17:82949932-82949954 GACACGCTTGCTCCAGGGATGGG + Intronic
1158634761 18:59146973-59146995 GACACGAAAGCTGCTGGAGTGGG - Intronic
1160402097 18:78618748-78618770 GAAACAAATGCCCAGGGGGTGGG - Intergenic
1164835701 19:31353855-31353877 GTCATGAATGATCCTGGGGTGGG - Intergenic
1164938045 19:32230211-32230233 GACACGCATGCCCAGGGGGCTGG + Intergenic
934569364 2:95359091-95359113 GACATGAATTTTCCAGGGGTGGG - Intronic
1176122408 20:63460120-63460142 GACAGGGAAGCTCCGGGGCTCGG - Intronic
1176869160 21:14072772-14072794 GGCAAGAAAGCTCCGGGGGAAGG - Intergenic
1182351117 22:29700547-29700569 CACACGAAGGCTTCTGGGGTAGG - Intergenic
1183071652 22:35400421-35400443 GACATGACTGCGCCTGGGGTGGG - Exonic
1184257066 22:43293328-43293350 GACACGGAGGCTCCGGGAGCTGG + Intronic
1184549983 22:45199356-45199378 CACAGGAAGGCCCCGGGGGTAGG + Intronic
953419993 3:42747015-42747037 GGCAGGTATGCTGCGGGGGTGGG + Intronic
967840152 3:193998750-193998772 GCCAAGAAGCCTCCGGGGGTGGG + Intergenic
992476622 5:77108909-77108931 GACACATTTGCTCCAGGGGTTGG + Intergenic
1002189579 5:177471775-177471797 CACACGGATGCTGCTGGGGTGGG + Intronic
1015433666 6:133160149-133160171 GTCACTGATGCTCTGGGGGTTGG + Intergenic
1018390459 6:163337269-163337291 GACAGGCATCCTCCGGGGATGGG - Intergenic
1028923836 7:96336279-96336301 GACATGAATGCCATGGGGGTAGG - Intergenic
1032277952 7:130476098-130476120 GAACCTAATGCTCCGGGTGTAGG + Intergenic
1037655473 8:20880100-20880122 GAAACCAATGCTCCGGAGGCTGG - Intergenic
1040611277 8:48984521-48984543 GACACGAATCCTCCTGTGTTGGG + Intergenic
1045336380 8:101206920-101206942 GAAACGAATGTGGCGGGGGTCGG - Intergenic
1047721974 8:127649495-127649517 GCCAAGAATGCACCGGGGATTGG + Intergenic
1057477532 9:95415559-95415581 GCCAGGAATGCTGCTGGGGTGGG - Intergenic
1058824475 9:108762471-108762493 GTCAGGGATGCTCCGGGGTTCGG - Intergenic
1185461487 X:334690-334712 TCCACGAATGCTCCCGGGGGAGG + Intronic
1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG + Intergenic
1191250166 X:58256414-58256436 GTCAAGAATGCCCCGGGGGAAGG + Intergenic