ID: 1186514548

View in Genome Browser
Species Human (GRCh38)
Location X:10156830-10156852
Sequence GACACGAATGCTCCGGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 46}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514532_1186514548 28 Left 1186514532 X:10156779-10156801 CCAGCCCCTGAGGGTGGGGCGTC 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514535_1186514548 22 Left 1186514535 X:10156785-10156807 CCTGAGGGTGGGGCGTCCTGTCT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514541_1186514548 -1 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514533_1186514548 24 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514534_1186514548 23 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514543_1186514548 -9 Left 1186514543 X:10156816-10156838 CCGGGTTTTCTCTGGACACGAAT 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514531_1186514548 29 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514540_1186514548 6 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514548 Original CRISPR GACACGAATGCTCCGGGGGT AGG Intergenic