ID: 1186514549

View in Genome Browser
Species Human (GRCh38)
Location X:10156833-10156855
Sequence ACGAATGCTCCGGGGGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 51}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514543_1186514549 -6 Left 1186514543 X:10156816-10156838 CCGGGTTTTCTCTGGACACGAAT 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1186514549 X:10156833-10156855 ACGAATGCTCCGGGGGTAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1186514535_1186514549 25 Left 1186514535 X:10156785-10156807 CCTGAGGGTGGGGCGTCCTGTCT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1186514549 X:10156833-10156855 ACGAATGCTCCGGGGGTAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1186514533_1186514549 27 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514549 X:10156833-10156855 ACGAATGCTCCGGGGGTAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1186514534_1186514549 26 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514549 X:10156833-10156855 ACGAATGCTCCGGGGGTAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1186514541_1186514549 2 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514549 X:10156833-10156855 ACGAATGCTCCGGGGGTAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1186514540_1186514549 9 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514549 X:10156833-10156855 ACGAATGCTCCGGGGGTAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514549 Original CRISPR ACGAATGCTCCGGGGGTAGG AGG Intergenic
906866054 1:49421365-49421387 ACAAATGCTACGGGGGGCGGGGG + Intronic
1075579471 10:123606124-123606146 CCGAAAGCTCCGGGGGCGGGGGG + Intergenic
1078839489 11:15065134-15065156 ACGAGGTCTCAGGGGGTAGGGGG + Intronic
1100565698 12:95791108-95791130 AGGAATGTTCCGGGAGAAGGTGG - Intronic
1102898191 12:116615409-116615431 ACGGAGGCTCCGGGGGAGGGTGG + Intergenic
1103323558 12:120105402-120105424 AAGAATGACCAGGGGGTAGGAGG + Intronic
1104962358 12:132494256-132494278 AGCACTGCTCCAGGGGTAGGGGG - Intronic
1106618232 13:31350159-31350181 AGGAATTCTCCTGGGGTAGGGGG - Intergenic
1113259362 13:108544734-108544756 AAGAATGCTGGTGGGGTAGGTGG - Intergenic
1116682361 14:47989264-47989286 ACGATTACCCCGGGGGTGGGGGG - Intergenic
1123467614 15:20528336-20528358 ACGAAGGCTCAGGGGACAGGGGG + Intergenic
1123650500 15:22472706-22472728 ACGAAGGCTCAGGGGACAGGGGG - Intergenic
1123740908 15:23281548-23281570 ACGAAGGCTCAGGGGACAGGGGG - Intergenic
1123746090 15:23321010-23321032 ACGAAGGCTCAGGGGACAGGGGG + Intergenic
1124278359 15:28344327-28344349 ACGAAGGCTCAGGGGACAGGGGG + Intergenic
1124304343 15:28567281-28567303 ACGAAGGCTCAGGGGACAGGGGG - Intergenic
1130339301 15:82985880-82985902 ACGAAGACTCCGGGAGCAGGCGG + Intronic
1135633514 16:24054975-24054997 GCGAATGATCCTGGGGGAGGAGG - Intronic
1138198767 16:55073716-55073738 AGGAAGGCTCCAGGGGAAGGAGG + Intergenic
1145307411 17:21682994-21683016 AGGCATGCTCCGGTGGAAGGGGG + Intergenic
1145307634 17:21684159-21684181 AGGCATGCTCCGGTGGAAGGGGG + Intergenic
1152248955 17:79201539-79201561 ATGAATGCCCCAGGGTTAGGAGG - Intronic
1152687625 17:81702435-81702457 ACGTTTGCTCAGGGGGCAGGTGG + Intronic
1152965686 18:111996-112018 ACGCGTTCTCCGGGGGTGGGGGG + Intergenic
1157595511 18:48861433-48861455 ACAGATGCCCCGCGGGTAGGAGG + Exonic
1160064506 18:75562259-75562281 AGGAATGGTCATGGGGTAGGGGG + Intergenic
1162090152 19:8274251-8274273 AGGAATGCTCCAGGGGTGCGGGG - Intronic
1162092386 19:8289114-8289136 AGGAATGCTCCAGGGGTGCGGGG - Intronic
1162380510 19:10329105-10329127 ACGAAGGCTGCGGTGGGAGGAGG + Exonic
926145336 2:10393771-10393793 AAGCATCCTCCTGGGGTAGGAGG - Intronic
932219625 2:69989705-69989727 AGGAAGGCTCCTGGGGTTGGCGG - Intergenic
934635999 2:95991222-95991244 ATGAAGGCTTGGGGGGTAGGGGG - Intronic
935037354 2:99391561-99391583 ATGAAAGGTCAGGGGGTAGGAGG - Intronic
937216171 2:120315034-120315056 ACGAGTGTGCCGGGGGCAGGAGG - Intergenic
1172647540 20:36480398-36480420 AACAATTCTCCGGAGGTAGGGGG + Intronic
1173969211 20:47138337-47138359 AAGAATGCTCCAAGAGTAGGTGG + Intronic
1185014759 22:48336370-48336392 TCGAATGCTCTGGGCTTAGGTGG - Intergenic
964273876 3:154987727-154987749 AGGAATGCTCGGAGGGTTGGAGG - Intergenic
985723031 5:1500808-1500830 ACGGCTGCTCGGGGGGCAGGTGG - Intronic
986445042 5:7814340-7814362 AACAATGCTCCGGGGGGCGGGGG - Intronic
990876679 5:60494248-60494270 AAGAATGCACTGGGGGTAGGGGG + Intronic
992457972 5:76933550-76933572 ACAAATGCTCCGGGGATGGTAGG - Intergenic
1002189580 5:177471778-177471800 ACGGATGCTGCTGGGGTGGGTGG + Intronic
1009930506 6:70172266-70172288 AGGAATGCTGACGGGGTAGGAGG + Intronic
1029376221 7:100178238-100178260 ACGACTGCCCCTGGGGTAAGCGG - Intronic
1040657352 8:49526926-49526948 ATGAATGGTCCAAGGGTAGGTGG - Intergenic
1045336377 8:101206917-101206939 ACGAATGTGGCGGGGGTCGGGGG - Intergenic
1060990281 9:127845053-127845075 AGGAATGTGCCGGGGGAAGGGGG + Intronic
1186514549 X:10156833-10156855 ACGAATGCTCCGGGGGTAGGAGG + Intergenic
1187550818 X:20303568-20303590 AGGAATCCTTTGGGGGTAGGAGG - Intergenic
1188344265 X:29044684-29044706 ACGAATGCTAGGGGGCTAGGTGG + Intronic
1189285712 X:39850905-39850927 AGGGAAGCTCCAGGGGTAGGTGG - Intergenic
1191179046 X:57540060-57540082 ACGACTGCTCCTGGGATATGAGG - Intergenic
1191249410 X:58253349-58253371 AAGAATGTTCCCGGGGTAAGGGG - Intergenic
1196755095 X:119150787-119150809 AGGAATGACCCGGGGGTGGGCGG - Intergenic