ID: 1186514551

View in Genome Browser
Species Human (GRCh38)
Location X:10156846-10156868
Sequence GGGTAGGAGGCGAATGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514543_1186514551 7 Left 1186514543 X:10156816-10156838 CCGGGTTTTCTCTGGACACGAAT 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1186514551 X:10156846-10156868 GGGTAGGAGGCGAATGACACTGG 0: 1
1: 0
2: 2
3: 12
4: 133
1186514540_1186514551 22 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514551 X:10156846-10156868 GGGTAGGAGGCGAATGACACTGG 0: 1
1: 0
2: 2
3: 12
4: 133
1186514541_1186514551 15 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514551 X:10156846-10156868 GGGTAGGAGGCGAATGACACTGG 0: 1
1: 0
2: 2
3: 12
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514551 Original CRISPR GGGTAGGAGGCGAATGACAC TGG Intergenic
900269428 1:1779257-1779279 GGGGAGGAGGCCAAAGCCACAGG + Intronic
902091999 1:13910978-13911000 GGGAAGGAGGTGCATGACATGGG + Intergenic
902544606 1:17182093-17182115 GGGGAGGAGGGGAATGTGACAGG - Intergenic
904004562 1:27356988-27357010 GGGTAGGAGGGGAATGCCACGGG - Exonic
904715674 1:32465634-32465656 GGATCGGAGGAGAAGGACACTGG - Intronic
906102572 1:43272679-43272701 GGGTAGGAGGTCAATGTCAGGGG - Exonic
910664417 1:89709117-89709139 GCGTAGGAGGCTTATGCCACAGG - Intronic
911798135 1:102099734-102099756 GGGTAGGGGGCCAATGAGTCAGG - Intergenic
913075299 1:115336874-115336896 GGGGAGGAGGGGACTGGCACTGG + Intronic
916925048 1:169510331-169510353 GGGTGATAGGAGAATGACACTGG - Intergenic
920385480 1:205568318-205568340 GGGAAGGAGGAGGATGACGCTGG - Intergenic
923054347 1:230414392-230414414 AGGAAGAAGGCAAATGACACTGG - Intronic
924155049 1:241167134-241167156 GGAGAGGACGTGAATGACACAGG + Intronic
1065325403 10:24546160-24546182 GGGGAGGAGGAAAATGACAAAGG - Exonic
1068094489 10:52473218-52473240 GGGTAGGAGAAGAAGGACAAAGG + Intergenic
1072763820 10:98080313-98080335 TGGCAGGAGGAGAATGACAGAGG + Intergenic
1073299058 10:102459730-102459752 GGGAAGGAGGGAAATGAGACAGG + Intergenic
1074107871 10:110401925-110401947 GGGCAGGAAGCGAAGAACACAGG - Intergenic
1075843335 10:125523658-125523680 GGGCAGGAGGAGGATGACAGTGG - Intergenic
1078203189 11:9203367-9203389 GGGTAGGAGGTGATGGTCACAGG - Intronic
1079571365 11:21947425-21947447 GTGTAGCAGGGGAATGACACTGG + Intergenic
1080416344 11:32073101-32073123 GGGTAGGAGGAGAATGAAGCTGG - Intronic
1084972354 11:72778785-72778807 GGGCAGGAGGGGTATGACATAGG + Intronic
1087981389 11:104618323-104618345 GAGTAAGAGGAGAATGCCACTGG + Intergenic
1096022708 12:48335384-48335406 AGGTAGGATGGGAATGATACTGG + Intergenic
1096976639 12:55703119-55703141 GGGCAGCAGGCGAATCGCACTGG - Exonic
1098568194 12:71958651-71958673 GGGTAGGAGGAGAATAGCATGGG - Intronic
1101399975 12:104378625-104378647 GGGTATGATAAGAATGACACAGG - Intergenic
1104551453 12:129761155-129761177 GGGGATGAGGAGGATGACACTGG - Intronic
1106096204 13:26646526-26646548 GGGTGGGAGGGGAGTGACACAGG - Intronic
1107720204 13:43240452-43240474 GGTTTGGAGGCAAATGAAACTGG + Intronic
1107982120 13:45743899-45743921 AGCCAGGAGGCGAATGTCACTGG - Intergenic
1119759589 14:77141293-77141315 GGGAAGGCGGCGAAGGACAGGGG + Intronic
1121428847 14:93872993-93873015 GGGTAGGAGGGGAAATGCACAGG + Intergenic
1122772254 14:104102696-104102718 GGGTGGGAGGCTGATGCCACAGG - Intronic
1124673137 15:31659179-31659201 GGGTAGATGGAGAATGAGACTGG + Intronic
1125746355 15:42000083-42000105 GGGTACAAGGCGGCTGACACTGG - Exonic
1128256557 15:66201397-66201419 GGGTAGGGAGGGATTGACACAGG + Intronic
1135891256 16:26359507-26359529 GGGTATGTGGCCAATGACCCAGG + Intergenic
1136220674 16:28825879-28825901 GAGTAGGAGGAGAATGAAATAGG + Intronic
1141059532 16:80853049-80853071 GGGTAGGAGGAGAATGAATCCGG + Intergenic
1141396525 16:83710069-83710091 GGGTGCGAGGGGAATGCCACTGG + Intronic
1142647498 17:1324265-1324287 GCGGAGGAGGCGGATGACCCCGG - Intergenic
1142889357 17:2932969-2932991 CGGGAGGAGGGGAATGGCACTGG + Intronic
1144430350 17:15185542-15185564 GGGTGGAAGGAGAATGAGACTGG + Intergenic
1148505327 17:48122535-48122557 TGGTAGGAGCCGAGTGCCACAGG + Exonic
1148586784 17:48786668-48786690 GGGTAGGAGGCTAACGCCAGAGG + Intronic
1148945777 17:51260596-51260618 GCGGAGGAGACGAATGAAACTGG + Exonic
1150585548 17:66514685-66514707 GGGTAGGATGCTAATGAAGCAGG - Intronic
1150966368 17:69973698-69973720 GGTTAGGAAGCAAATGACAGTGG + Intergenic
1155225834 18:23728316-23728338 GGGTAGGAGGGCAAGGACAATGG + Intronic
1160122805 18:76145707-76145729 GGGAAGGACGCGGAGGACACGGG - Intergenic
1161818772 19:6516455-6516477 AGGTGGGAGGCGGATGACAGCGG + Intergenic
1162063588 19:8111327-8111349 GGGTGGGAGGCGAGTGACCGAGG + Intronic
1163967811 19:20764548-20764570 GGGTAGGGTGTGAATGAAACTGG + Intronic
1166553730 19:43684303-43684325 GAGCAGGAGGAGAATGACACGGG + Intergenic
1166562122 19:43739903-43739925 GTGTAGAAGGCGAATGAGATGGG + Intronic
925480833 2:4272340-4272362 GGGTAGGAGGAGAGTGAGAATGG - Intergenic
926141548 2:10371223-10371245 GGGTTGGAGGGGAATGCCAGTGG + Intronic
930311502 2:49746255-49746277 GGGTAGGAGGGGAATGAGGGAGG + Intergenic
930688745 2:54337117-54337139 GAGTAGGAGGAGGCTGACACTGG - Intronic
931426578 2:62177253-62177275 GGGAAGAAGGCAAGTGACACTGG - Intergenic
932068864 2:68595797-68595819 GGGTGGGTGGGGAACGACACAGG - Intronic
932207666 2:69897836-69897858 AGGTAGGAGGCAAATCACAGAGG + Intronic
937216145 2:120314862-120314884 GTGTAGGAGGCAAATCACCCAGG + Intergenic
938196823 2:129335840-129335862 GGGCAGGAGACGAATGGCCCTGG + Intergenic
939265737 2:139870463-139870485 GGGTAGGGGGCCAGTGACTCGGG - Intergenic
939940274 2:148341150-148341172 GGGTGGGAGGAGGATGACAGGGG - Intronic
940043012 2:149380049-149380071 GGTAAGGAGGCAAATGCCACAGG + Intronic
941031133 2:160512756-160512778 GGGTAGGAGGAGGATGAAACTGG - Intergenic
944692992 2:202174391-202174413 AGGAAGGAGGAAAATGACACTGG + Intronic
1169080900 20:2797256-2797278 GGGCAGCAGGCGAATGAAGCGGG + Exonic
1172131434 20:32658739-32658761 GGGTAGGTGGGGAATGACACTGG + Intergenic
1172239760 20:33404961-33404983 GGGTAGTAGGGGAGTGAAACAGG + Intergenic
1172901153 20:38335762-38335784 GGGTAGAAGGCGCTTCACACAGG - Intronic
1173869232 20:46331299-46331321 GGGAAGGAGGGGAAGGAGACAGG + Intergenic
1173907925 20:46642261-46642283 GGGCAGGAGCTGGATGACACAGG + Intronic
1174466103 20:50718682-50718704 GGGCAGGAGGAAAAAGACACAGG + Intergenic
1175271146 20:57735016-57735038 GGGGAGGAGGAGAAGCACACTGG - Intergenic
1176908871 21:14538324-14538346 GAGTAGGAGGAGAGAGACACAGG + Intronic
1178528576 21:33355037-33355059 GGGTAGGCGGGGAAGAACACGGG - Intronic
1180726142 22:17948104-17948126 GGGAGGGAGGTGGATGACACAGG - Intronic
1180998845 22:19978540-19978562 GGGTAGGAGGGGAAGGGCAGAGG + Intronic
1183257404 22:36771300-36771322 CAGTAGGATGTGAATGACACTGG - Intronic
1185018668 22:48360379-48360401 AGGAAGAAGGGGAATGACACAGG + Intergenic
950996004 3:17496939-17496961 GGGTGACAGGGGAATGACACAGG - Intronic
953363842 3:42325028-42325050 AGGTAGGGGGAGAATGCCACAGG - Intergenic
953459883 3:43073644-43073666 GGGTACGAGGAGCATGACCCGGG + Intergenic
955399149 3:58578967-58578989 GGGTACCATGTGAATGACACAGG + Intronic
956691031 3:71877706-71877728 GGGAAGGTGACAAATGACACAGG + Intergenic
957022268 3:75139432-75139454 AGGTAGGAGGGGACTGACATGGG - Intergenic
965679572 3:171236139-171236161 GGGTAGGTGCCAAATCACACTGG + Intronic
967189512 3:186973395-186973417 AGGCAGGAGGAGGATGACACAGG + Intronic
970310522 4:14777732-14777754 GGGTGAGAGGCGAATGACAATGG - Intergenic
974893929 4:67915437-67915459 TGGGAGGAGGGGAATCACACAGG - Intronic
976950920 4:90829370-90829392 GGGTAGGAAGTTAATGAGACTGG + Intronic
984206537 4:176793040-176793062 GGGGAGGAGGCGAGGGAAACGGG - Intergenic
985716873 5:1467771-1467793 GGGTTGGAGCGGAAGGACACGGG - Intronic
986001371 5:3633520-3633542 CGGTAGGAGGCCCAGGACACTGG - Intergenic
992993804 5:82313045-82313067 GGGTAGGAGGTGGGGGACACAGG - Intronic
994234328 5:97343398-97343420 GGGTAGGAGTGAAATGCCACTGG + Intergenic
1001299515 5:170523797-170523819 GGGTAGGAGGAGAATGGCTCAGG - Intronic
1007359999 6:41348083-41348105 GGGTTGGAGGCGAATCCCATTGG - Intronic
1008226289 6:48920666-48920688 GGATAGGAGTAGAATGACATGGG + Intergenic
1014250864 6:119114396-119114418 GGTTAGGAGGCTAGTGACAGAGG - Intronic
1015504259 6:133965493-133965515 GGGAAGGTGGCAAATGAAACAGG - Intronic
1018905577 6:168073560-168073582 GGGAAGGAGGAGACTGAGACAGG + Intronic
1019550869 7:1601961-1601983 TGGTAGCAGGCGGGTGACACAGG - Intergenic
1021105062 7:16628685-16628707 GGGTGGTAGGGGAAGGACACAGG + Intronic
1021846430 7:24767453-24767475 GGGAGGGAGGAGAATGAGACTGG - Intergenic
1025871539 7:65439006-65439028 GGGTAGGAGGAGAATGAAGTTGG + Intergenic
1026224181 7:68426295-68426317 TGGTGGCAGGTGAATGACACTGG + Intergenic
1026941562 7:74290305-74290327 GGGTAGGAGGAGATTGAGGCGGG + Intronic
1027890233 7:83964546-83964568 GGGTAGGAGATGATAGACACAGG - Intronic
1028539708 7:91928297-91928319 GGGGAGGAAGCAAAAGACACGGG + Intergenic
1029347570 7:99989653-99989675 GGGCAGGAGGAGAGGGACACAGG + Intergenic
1031117148 7:117680894-117680916 GGGCAGGAGGCAAATGGCTCAGG + Intronic
1031250649 7:119376068-119376090 GGCTAGGAGGCTCAAGACACAGG + Intergenic
1032389713 7:131547981-131548003 GGGTAGGAGGGGAAGGACCTGGG - Intronic
1034255882 7:149724470-149724492 GGGGAGGAGGCGTGTGACTCAGG + Intronic
1034534693 7:151719561-151719583 GGGTAGGAGGCAGAAGACAGGGG - Intronic
1035294889 7:157861440-157861462 GGGCAGGAGGCAGATGCCACAGG - Intronic
1037827354 8:22167371-22167393 GGGTAGGATGCCAAAGACTCAGG + Intronic
1046808731 8:118508770-118508792 GGGTAGGCGGAGTATGACAGAGG + Intronic
1047160683 8:122375366-122375388 GGGTAGGAGGATAATGAAATAGG + Intergenic
1047245824 8:123143644-123143666 GGGTAGGAGGAAAATGAATCTGG - Intronic
1048117228 8:131537892-131537914 GGGTAGGAGGAGATGGAAACAGG + Intergenic
1049005336 8:139851865-139851887 GGGCAGGTGGAGAAGGACACTGG + Intronic
1052503766 9:29326232-29326254 GGGTAGAAGCCTAATGTCACTGG + Intergenic
1053395527 9:37770272-37770294 GGGTAGCAGACCAAGGACACTGG - Intronic
1054805555 9:69393333-69393355 GGAAAGGAGGGGAAAGACACTGG + Intergenic
1056306996 9:85300206-85300228 GGGTAGGAGGGAAGTTACACGGG + Intergenic
1061552927 9:131348552-131348574 GGGTGGGAGGGGAATGGCAGAGG - Intergenic
1186048294 X:5561134-5561156 GGGTAGGAGGGCAATTTCACTGG - Intergenic
1186514551 X:10156846-10156868 GGGTAGGAGGCGAATGACACTGG + Intergenic
1187681043 X:21768278-21768300 GGGTAGGAGGGAAAGGACACTGG - Intergenic
1188703284 X:33292797-33292819 GAGTAGGAGTCAAATGAAACAGG - Intronic
1189506236 X:41614191-41614213 GGGTAGGAGGGGAATGAGCATGG - Intronic
1190649697 X:52556898-52556920 GGGTGGGAGGGGAATGCCACAGG + Intergenic
1190680349 X:52821262-52821284 GGGCGGGAGGGGAATGCCACAGG - Intergenic
1190683880 X:52853105-52853127 GGGTGGGAGGGGAATGCCACAGG + Intergenic
1190700013 X:52980657-52980679 GGGTGGGAGGAGAATGCCAGAGG + Intronic
1190754155 X:53386609-53386631 GGGAAGGAGGGGAAAGACAGGGG + Intronic
1190999759 X:55647482-55647504 GGGTGGGAGGAGAATGCCACAGG + Intergenic
1192082445 X:68061312-68061334 GGGGAAGAGGGGAATGCCACTGG + Intronic
1194931335 X:99891258-99891280 GGCTAGGTGGCGACTGACCCAGG - Intergenic
1197977448 X:132181008-132181030 GTGTGGGAGGCAAATCACACAGG - Intergenic
1201985573 Y:19961118-19961140 GGGTAGGAGAGGAATAACAGTGG - Intergenic