ID: 1186514552

View in Genome Browser
Species Human (GRCh38)
Location X:10156851-10156873
Sequence GGAGGCGAATGACACTGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514543_1186514552 12 Left 1186514543 X:10156816-10156838 CCGGGTTTTCTCTGGACACGAAT 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1186514552 X:10156851-10156873 GGAGGCGAATGACACTGGCACGG 0: 1
1: 0
2: 0
3: 9
4: 120
1186514541_1186514552 20 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514552 X:10156851-10156873 GGAGGCGAATGACACTGGCACGG 0: 1
1: 0
2: 0
3: 9
4: 120
1186514540_1186514552 27 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514552 X:10156851-10156873 GGAGGCGAATGACACTGGCACGG 0: 1
1: 0
2: 0
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514552 Original CRISPR GGAGGCGAATGACACTGGCA CGG Intergenic
900114146 1:1021328-1021350 GGAGGCAGATGACCCAGGCAGGG - Intronic
901197370 1:7447654-7447676 GGAGGCCCGTGGCACTGGCAGGG - Intronic
901932943 1:12608575-12608597 TGAGGGCAATGACACAGGCAGGG - Intronic
903378240 1:22879824-22879846 AGAGGCCAATGCCCCTGGCAGGG + Intronic
904300664 1:29551343-29551365 GGAGGCAAATGTCCCTGGAAGGG - Intergenic
904767183 1:32859219-32859241 GGAGGCCAATCACACAGCCATGG - Intergenic
906711132 1:47930732-47930754 GGAGGTGAAGGCCACTGGGAGGG - Intronic
907769162 1:57442763-57442785 TGTGGCAAATGACACTCGCAGGG - Intronic
909564981 1:77044171-77044193 GGGGGAGAAGGACACTGTCAGGG - Intronic
909976930 1:82056738-82056760 TGAGGAGAAGGACAATGGCAGGG - Intergenic
911409376 1:97483471-97483493 GGAGGCGAACGACACTGACTCGG + Intronic
911574601 1:99560340-99560362 GGAAGCTAATGAGACTGGGAAGG + Intergenic
913681176 1:121187685-121187707 GGGGGCCATTGACACTGGAAAGG + Intronic
914033005 1:143975325-143975347 GGGGGCCATTGACACTGGAAAGG + Intergenic
914156440 1:145092641-145092663 GGGGGCCATTGACACTGGAAAGG - Intronic
914744365 1:150490743-150490765 GGAGGAGAATGATTCTGGGATGG + Intronic
915562215 1:156693946-156693968 GGAAGCGAATGACTCTGCCTTGG - Intergenic
916584411 1:166137976-166137998 GGAGGCAAAAAATACTGGCAGGG + Intronic
918224629 1:182470392-182470414 GGAGGCCAATGTGACTGGAATGG - Intronic
919362569 1:196612731-196612753 GGAGGTGAAAGACACTTACATGG - Intergenic
920468490 1:206206209-206206231 GGGGGCCATTGACACTGGAAAGG + Intronic
921986190 1:221315538-221315560 GGAAGGGAAGGACACTGGGATGG + Intergenic
922335912 1:224617823-224617845 GGAGGCGAGGGAGACTGGGAAGG + Intronic
922482343 1:225947725-225947747 GGGGGCGAAGGGCAGTGGCAAGG - Intergenic
922897435 1:229111358-229111380 GGAGGGGAAAGTCACTGTCATGG + Intergenic
1064320046 10:14296468-14296490 GGAGGCGAGTCACAAAGGCATGG - Intronic
1064461828 10:15542070-15542092 GGTGGCCAATGACACTGTTATGG + Intronic
1064867016 10:19892275-19892297 AGAGGCGAATGTCTGTGGCATGG + Intronic
1067159903 10:43817070-43817092 GGAGGTGAAGGAGACTGGGAAGG + Intergenic
1067962120 10:50865599-50865621 GCATGTGAATGACACTGGAAGGG - Intronic
1070130807 10:73654169-73654191 TGAGGCTCATGGCACTGGCATGG + Exonic
1072574573 10:96688198-96688220 GGTGGGGAATGACATTGGCTGGG - Intronic
1073188287 10:101630702-101630724 GAAGGGGAAAGACACAGGCAGGG + Intronic
1074346602 10:112692377-112692399 GGAGGGGAAAGACACTGACATGG - Intronic
1090459254 11:126875329-126875351 TGTGGGGAATGACACTGTCAGGG + Intronic
1095979995 12:47967044-47967066 GGATGAAAATGACAGTGGCAGGG + Intronic
1101169006 12:102068746-102068768 GGAGGGGAATGACCCAGCCAAGG - Intergenic
1110570158 13:76994220-76994242 GGAGACGGAAGAGACTGGCAGGG - Intronic
1111613826 13:90639659-90639681 GGTGGAGATTCACACTGGCAAGG + Intergenic
1122503450 14:102217049-102217071 GGAGGCCACTGACCCTGGAAGGG - Intronic
1126742956 15:51796802-51796824 TGAGGTGAATGACATAGGCAAGG + Intronic
1128234135 15:66055964-66055986 GGAGGCAAATGGCTCTGGTAGGG + Intronic
1132684000 16:1154666-1154688 GGAGGCAATTGGCACTGCCAAGG + Intronic
1134570541 16:15287099-15287121 GATGGCAAATGACACTGGGAAGG + Intergenic
1134731838 16:16468959-16468981 GATGGCAAATGACACTGGGAAGG - Intergenic
1134935608 16:18243041-18243063 GATGGCAAATGACACTGGGAAGG + Intergenic
1137708227 16:50549315-50549337 GGAGGCGAAGGACCACGGCACGG - Intronic
1139198036 16:64944065-64944087 GGAGTGGAATGACACTGGAGAGG + Exonic
1143859113 17:9874991-9875013 GGTGGCCAATGAAAATGGCAGGG - Intronic
1146697529 17:34920928-34920950 GGAGGCAAAAGACACTTACATGG - Intergenic
1148192979 17:45692762-45692784 GGAGGGGCCTGACACTGCCAGGG - Intergenic
1148747834 17:49928209-49928231 GGAGGATGCTGACACTGGCATGG + Intergenic
1148945778 17:51260601-51260623 GGAGACGAATGAAACTGGACCGG + Exonic
1148991819 17:51672832-51672854 GGAGAAGACTGAGACTGGCAGGG - Intronic
1152690646 17:81716305-81716327 GGAGGCGAACGCCCCAGGCATGG + Intronic
1154035746 18:10800210-10800232 TGAGGTTAATGACACTGACATGG + Intronic
1157183307 18:45517053-45517075 AGAGGTGAATGAGACTGGCAGGG + Intronic
1159886106 18:73908920-73908942 GGAGGCAACTGGCATTGGCAAGG - Intergenic
1160512342 18:79459561-79459583 GGAGGCCTTTGGCACTGGCAAGG - Intronic
1161005847 19:1936031-1936053 GGAGGCCACTGAGGCTGGCAGGG + Intergenic
1161818773 19:6516460-6516482 GGAGGCGGATGACAGCGGAATGG + Intergenic
1162063590 19:8111332-8111354 GGAGGCGAGTGACCGAGGCAGGG + Intronic
1163653657 19:18533024-18533046 GAAGGCCAAGGACACTGGCATGG + Intronic
1165074414 19:33273000-33273022 GGATGCGAATGAGACAGACACGG + Intergenic
1167427811 19:49438450-49438472 GGAGGCGAGGGAGACTGGGACGG + Intronic
931372848 2:61680179-61680201 AGAGGAGAATGACACAGTCAGGG + Intergenic
931585399 2:63821218-63821240 GGAGGTGACTGACTCTGCCAGGG + Intronic
934650064 2:96085576-96085598 GGAGGCCAAAGAAACAGGCAGGG + Intergenic
935813761 2:106826934-106826956 GGAGGCCAGGGACACTGCCAGGG + Intronic
936966633 2:118133771-118133793 TGAGGTGAATTTCACTGGCAGGG + Intergenic
937307471 2:120881350-120881372 GGTGGAGAAGGACAGTGGCAGGG + Intronic
937394074 2:121519358-121519380 GGTGACAAATGGCACTGGCAGGG + Intronic
940022664 2:149171859-149171881 GGAGGGGAATCACAATGCCATGG - Intronic
943797162 2:192010933-192010955 GGATGAGAATGACACTGTTAGGG - Intronic
944485079 2:200197004-200197026 GGAGGCTAGAGACACTGGCAGGG + Intergenic
945652959 2:212587231-212587253 GAAGGCTAATGAACCTGGCACGG - Intergenic
945793478 2:214333555-214333577 GGACACCAATGACACTGGGAAGG - Intronic
945961434 2:216139355-216139377 GGAGGCGAAAGGCACTTACATGG + Intronic
946007211 2:216535600-216535622 GGAGGGAAAGGACACTGGTACGG - Intronic
946027294 2:216679529-216679551 GGAGGCAGATGACACAGTCAGGG + Intronic
946137003 2:217655822-217655844 GGGGAAGGATGACACTGGCATGG - Intronic
1170888927 20:20363572-20363594 GGAGGCGGATGACACAAGGAGGG + Intergenic
1173153117 20:40584681-40584703 GGAGGCTTAAGACACTGGGATGG + Intergenic
1173869234 20:46331304-46331326 GGAGGGGAAGGAGACAGGCAGGG + Intergenic
1174354858 20:49990786-49990808 GGAGGAGAAAGACAAAGGCAGGG + Intergenic
1175208065 20:57327191-57327213 GGAGGTCAATGACACTGTCAAGG - Intergenic
1176388374 21:6151024-6151046 GGAAGCGAAGGACACTGCCCAGG - Intergenic
1177572037 21:22899747-22899769 GGAGGGAAAAGACACTGACATGG + Intergenic
1179735098 21:43387224-43387246 GGAAGCGAAGGACACTGCCCAGG + Intergenic
952255451 3:31691321-31691343 GAAGGCGAAGGACACTTGGAAGG + Intronic
953904077 3:46859508-46859530 GGAGGGCAATGGCACTGTCATGG - Exonic
955959678 3:64327446-64327468 GGAGGGGAATGGAACAGGCAGGG + Intronic
957042070 3:75343409-75343431 GGAGGGGGATGCTACTGGCAGGG + Intergenic
961425923 3:126847778-126847800 GAAGGAGAAAGACACTGGTAGGG - Intronic
968274151 3:197426973-197426995 GGTGGTGAATGACAGTGGGAAGG - Intergenic
968560401 4:1277899-1277921 GGAGGTGACTGCCGCTGGCACGG - Intergenic
968778541 4:2561025-2561047 GGAGGAGAACTACAATGGCATGG - Intronic
970480080 4:16463795-16463817 GGAGTTCAGTGACACTGGCATGG - Intergenic
978172620 4:105692017-105692039 GGAAGCGAATGACCCTCGCCTGG - Exonic
984067368 4:175064601-175064623 GAAAGCCAATGACAATGGCATGG - Intergenic
984818957 4:183862925-183862947 GGAGGTGACAGACACTGGGAGGG + Intronic
986335081 5:6748647-6748669 GGAGGTAAATGACACAGGAAAGG - Intronic
990968824 5:61480441-61480463 GGAGGCTAATGACAGAGGAAAGG - Intronic
997008564 5:129849392-129849414 GGTGGAGATTGACAGTGGCAAGG - Intergenic
997195164 5:131974341-131974363 GTTGGGGAATGAAACTGGCATGG - Intronic
1001949572 5:175806844-175806866 GTAGGAGAATGACTCTGCCAAGG - Intronic
1002418688 5:179134525-179134547 GGAGGCCAATGTCACTGAGAGGG - Intronic
1003108473 6:3233380-3233402 GGTGGCAAATAACACTGGAAAGG - Intronic
1006790605 6:36698688-36698710 GGAGGAGAAGGGCGCTGGCAGGG + Intronic
1009477164 6:64107687-64107709 GGAGGCAAAAGACACTGTGATGG - Intronic
1014537464 6:122632017-122632039 GAAGGGGAATGACTCAGGCAGGG + Intronic
1014669650 6:124285543-124285565 GGAGGCAAATGACACCAGGAGGG - Intronic
1032086280 7:128885428-128885450 GGAGGGGAAAGGCACTGGGAGGG + Intronic
1034196619 7:149253415-149253437 GGAGGAGGATGACACTGGCTAGG - Intronic
1040132550 8:43814189-43814211 GGAGCAGATTGACACTTGCAGGG + Intergenic
1040465749 8:47693549-47693571 GGAGGCGCATAACGCTGGCATGG - Intronic
1042191530 8:66192265-66192287 GGATGTGAATGAAACTTGCATGG - Intergenic
1044811519 8:96068637-96068659 GGAGGTGAATGACTGTGGCAGGG + Intergenic
1046043843 8:108939973-108939995 AGAAGTAAATGACACTGGCAGGG + Intergenic
1049409771 8:142467340-142467362 GGAGGGGACTGCCACTGGCCTGG + Intronic
1054805556 9:69393338-69393360 GGAGGGGAAAGACACTGGTGTGG + Intergenic
1054955419 9:70904170-70904192 GGAGGTCAATGACACAGTCAGGG - Intronic
1057317052 9:93976226-93976248 GGAGGGGAAAGACACTGCCCAGG - Intergenic
1057392045 9:94648280-94648302 GGAGGAGAAGGGGACTGGCAAGG - Intergenic
1059429664 9:114242228-114242250 GGAGGTGAGTGTCACTGGCCTGG + Exonic
1186514552 X:10156851-10156873 GGAGGCGAATGACACTGGCACGG + Intergenic
1186728439 X:12382331-12382353 AGAGGGGTATGATACTGGCAGGG + Intronic
1191740578 X:64432693-64432715 GTAGGGGAATGAGTCTGGCATGG - Intergenic
1198705587 X:139444966-139444988 GGAGGCTAAAGAGGCTGGCATGG - Intergenic
1199191559 X:144977619-144977641 GGAGGCGAAAGGCACTTACATGG - Intergenic