ID: 1186514553

View in Genome Browser
Species Human (GRCh38)
Location X:10156854-10156876
Sequence GGCGAATGACACTGGCACGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514543_1186514553 15 Left 1186514543 X:10156816-10156838 CCGGGTTTTCTCTGGACACGAAT 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG 0: 1
1: 0
2: 0
3: 2
4: 59
1186514541_1186514553 23 Left 1186514541 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG 0: 1
1: 0
2: 0
3: 2
4: 59
1186514540_1186514553 30 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG 0: 1
1: 0
2: 0
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514553 Original CRISPR GGCGAATGACACTGGCACGG CGG Intergenic
905694121 1:39962549-39962571 GGCGGATGACACTGGTGCAGCGG + Intronic
908185403 1:61648067-61648089 GGTGGAAGACCCTGGCACGGAGG + Intergenic
922565797 1:226600912-226600934 GGCGAATGACAGAGGAAAGGAGG - Intronic
923125767 1:231033230-231033252 GGAGAATGACACTGGCAACGGGG + Intronic
1064867017 10:19892278-19892300 GGCGAATGTCTGTGGCATGGTGG + Intronic
1065503143 10:26401396-26401418 GGTGGATGACAGTGGCAAGGAGG - Intergenic
1072574572 10:96688195-96688217 GGGGAATGACATTGGCTGGGAGG - Intronic
1072742573 10:97918331-97918353 AGAGAATGACTCTTGCACGGAGG - Intronic
1073325453 10:102642316-102642338 GGCGAAAGAAACGGGCGCGGTGG - Intergenic
1074211326 10:111338091-111338113 GGTGAATGAACCTGGCACAGAGG + Intergenic
1077892605 11:6430349-6430371 AGCAAATGTCACTGGCAAGGAGG - Intergenic
1080055260 11:27900349-27900371 GGAGAAAGACCCTGGCATGGAGG - Intergenic
1103476699 12:121223940-121223962 TGCGAGTGAAGCTGGCACGGCGG - Intronic
1106293722 13:28390736-28390758 GGCAAGTGACACTGGCAAGTGGG + Intronic
1120967367 14:90179606-90179628 GGCGAATGAGATTGGCTTGGAGG - Intronic
1121353357 14:93192491-93192513 GGCGGCTCACACTGGCATGGCGG + Intronic
1123046822 14:105521430-105521452 GGCGAATGCTACTGGCTCTGGGG + Intergenic
1124233674 15:27968343-27968365 GGGGAATGACAGGGGCAGGGTGG + Intronic
1126467501 15:48974144-48974166 GTAGAATCACACTGGCAAGGTGG + Intergenic
1127482128 15:59387400-59387422 TGCGAATGCCTCTGGCAGGGTGG + Intronic
1128343999 15:66842469-66842491 GGTGGATGACACAGGCCCGGCGG + Intergenic
1136103849 16:28014784-28014806 GACAAATGAGGCTGGCACGGTGG - Intronic
1137708224 16:50549312-50549334 GGCGAAGGACCACGGCACGGGGG - Intronic
1138929980 16:61641547-61641569 GGTGAATTACATTGGCATGGAGG + Intergenic
1142407686 16:89900186-89900208 GGCAAGAGAAACTGGCACGGTGG + Intronic
1152872775 17:82766855-82766877 GGGGAATGACACAGGCCCTGTGG - Intronic
1152895200 17:82906964-82906986 GGGGAATGACACAGGCCCTGTGG - Intronic
1157618291 18:49000953-49000975 GACTAATGAGCCTGGCACGGTGG - Intergenic
1160708837 19:541522-541544 TGAGGATGACTCTGGCACGGAGG + Exonic
1164291991 19:23877513-23877535 GGCAGAGGACACTGGCACTGAGG - Intergenic
1167427814 19:49438453-49438475 GGCGAGGGAGACTGGGACGGGGG + Intronic
930688744 2:54337109-54337131 GGAGGCTGACACTGGCACAGTGG - Intronic
933938327 2:87225121-87225143 GGCCAAGGACACTGGCCCTGGGG - Intergenic
936354808 2:111740654-111740676 GGCCAAGGACACTGGCCCTGGGG + Intergenic
937307472 2:120881353-120881375 GGAGAAGGACAGTGGCAGGGAGG + Intronic
948466552 2:238154702-238154724 GGTGAATGACACGGCCCCGGAGG - Intergenic
949081406 2:242103369-242103391 GGGGAATGAGACTGCCACAGTGG + Intergenic
1172385082 20:34528478-34528500 GGTGAATGACACGGGAACAGAGG - Intronic
1175524817 20:59626368-59626390 GAGGAATGAGACTGGCAGGGAGG + Intronic
1175818909 20:61897977-61897999 GACGGATGACCCTGGCAGGGAGG + Intronic
1176409001 21:6437602-6437624 GGGGGAGGACACTGGCAGGGAGG - Intergenic
1178877160 21:36422293-36422315 GCAGAATGACACCGGCATGGGGG - Intergenic
1179054066 21:37915647-37915669 AGCGACTGAAACTCGCACGGGGG - Intronic
1179684494 21:43045924-43045946 GGGGGAGGACACTGGCAGGGAGG - Intergenic
1180184355 21:46132074-46132096 GGCGGCTGACGCTGGCCCGGAGG + Exonic
1185200341 22:49498782-49498804 GGCCAATCAGACTGGAACGGAGG + Intronic
952255452 3:31691324-31691346 GGCGAAGGACACTTGGAAGGAGG + Intronic
961420319 3:126797899-126797921 GGAGCCAGACACTGGCACGGAGG - Intronic
962270056 3:133971037-133971059 GGCAAATGCCACTGGCATGTGGG + Intronic
969482773 4:7455521-7455543 GGCGCATGACACTAACACGGAGG - Intronic
1001592749 5:172877654-172877676 GGAAAATGACACTGTCACAGGGG - Intronic
1002775951 6:327612-327634 GGCGCATGGCCCTGGCACAGAGG - Intronic
1022514722 7:30968314-30968336 GGAGAATGACACAGGGAAGGAGG + Intronic
1023282522 7:38585686-38585708 GGAAAATTCCACTGGCACGGTGG - Intronic
1026796583 7:73369631-73369653 GGCCAGTGTCACTGGCACAGAGG - Intergenic
1029532660 7:101135764-101135786 GGTGAACGAGAGTGGCACGGTGG + Exonic
1035539317 8:420167-420189 GGGGAATGAGACTGCCACAGTGG + Intronic
1044790104 8:95838461-95838483 GTCAAATGAGACTGGCATGGAGG - Intergenic
1046590557 8:116200874-116200896 AGCGAATGACAATGGCAGAGTGG + Intergenic
1060515269 9:124261724-124261746 ACCGAAGGACACTGGCAGGGGGG - Intronic
1061818710 9:133210774-133210796 GGCGAATGAGACTGGGACACAGG - Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic