ID: 1186515521

View in Genome Browser
Species Human (GRCh38)
Location X:10163906-10163928
Sequence ACAAAAAATGTCTCTAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 688
Summary {0: 1, 1: 7, 2: 43, 3: 96, 4: 541}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186515516_1186515521 -2 Left 1186515516 X:10163885-10163907 CCCCATCTCCCAGTTGTAATAAC 0: 1
1: 0
2: 1
3: 19
4: 232
Right 1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG 0: 1
1: 7
2: 43
3: 96
4: 541
1186515517_1186515521 -3 Left 1186515517 X:10163886-10163908 CCCATCTCCCAGTTGTAATAACA 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG 0: 1
1: 7
2: 43
3: 96
4: 541
1186515518_1186515521 -4 Left 1186515518 X:10163887-10163909 CCATCTCCCAGTTGTAATAACAA 0: 1
1: 0
2: 2
3: 34
4: 278
Right 1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG 0: 1
1: 7
2: 43
3: 96
4: 541
1186515515_1186515521 7 Left 1186515515 X:10163876-10163898 CCAGTGGCACCCCATCTCCCAGT 0: 1
1: 0
2: 3
3: 28
4: 300
Right 1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG 0: 1
1: 7
2: 43
3: 96
4: 541
1186515510_1186515521 29 Left 1186515510 X:10163854-10163876 CCTGGCCACCATCCACTAGATGC 0: 2
1: 5
2: 69
3: 416
4: 1046
Right 1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG 0: 1
1: 7
2: 43
3: 96
4: 541
1186515513_1186515521 21 Left 1186515513 X:10163862-10163884 CCATCCACTAGATGCCAGTGGCA 0: 3
1: 13
2: 62
3: 173
4: 392
Right 1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG 0: 1
1: 7
2: 43
3: 96
4: 541
1186515509_1186515521 30 Left 1186515509 X:10163853-10163875 CCCTGGCCACCATCCACTAGATG 0: 2
1: 8
2: 86
3: 462
4: 1138
Right 1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG 0: 1
1: 7
2: 43
3: 96
4: 541
1186515519_1186515521 -10 Left 1186515519 X:10163893-10163915 CCCAGTTGTAATAACAAAAAATG 0: 1
1: 3
2: 63
3: 373
4: 1158
Right 1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG 0: 1
1: 7
2: 43
3: 96
4: 541
1186515514_1186515521 17 Left 1186515514 X:10163866-10163888 CCACTAGATGCCAGTGGCACCCC 0: 5
1: 58
2: 316
3: 835
4: 1257
Right 1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG 0: 1
1: 7
2: 43
3: 96
4: 541
1186515511_1186515521 24 Left 1186515511 X:10163859-10163881 CCACCATCCACTAGATGCCAGTG 0: 2
1: 13
2: 132
3: 472
4: 1327
Right 1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG 0: 1
1: 7
2: 43
3: 96
4: 541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186515521 Original CRISPR ACAAAAAATGTCTCTAGACA TGG Intronic
900724764 1:4208688-4208710 ACAAAAAATGTCTCCAGGAGAGG + Intergenic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901096129 1:6681763-6681785 ACCAAGAGGGTCTCTAGACAGGG + Intronic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
901954226 1:12772336-12772358 AAAAAAAATCTACCTAGACATGG - Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902728908 1:18355816-18355838 AAAAAAAAAGAGTCTAGACATGG - Intronic
903771047 1:25764566-25764588 ACAAAAAAAGTAGCCAGACATGG - Intronic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
904781639 1:32954062-32954084 ACAAAAAATGTAGCTGGGCATGG - Intronic
905615898 1:39398432-39398454 ATAAAAAATGTCTCTGGGCCAGG - Intronic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907034677 1:51205798-51205820 ACAAAAAATTTATCTGGGCATGG + Intergenic
907402893 1:54235921-54235943 TCAAAAAATGTCACCAGAAAAGG - Intronic
907857166 1:58314743-58314765 ACAAAAAATCTCTGTTGTCATGG - Intronic
908367252 1:63438136-63438158 AAAAAAACTGGTTCTAGACACGG + Exonic
908761685 1:67518553-67518575 AGAACCAATGTCTCAAGACAGGG - Intergenic
909490788 1:76224207-76224229 AAATAAAATCTCTCCAGACAAGG - Intronic
909779303 1:79522501-79522523 ACAAAAAATGTGTCCAGGCTGGG + Intergenic
910854810 1:91684744-91684766 TCAAAAAATGGCTCTAGGTAGGG + Intronic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911231096 1:95362528-95362550 AGAAAAGATCTCTCCAGACAAGG + Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912017875 1:105064666-105064688 ACAAGAAGTATCTATAGACATGG + Intergenic
912299483 1:108499863-108499885 ACAAAAAATTTAGCTAGGCATGG + Intergenic
912346965 1:108972644-108972666 AAAAAAAATGTCTATAGGCCGGG + Intronic
912453434 1:109782338-109782360 TCAAAAAATCCCTCTACACATGG - Intergenic
912540589 1:110412009-110412031 ACAAAAAATTTAGCTACACATGG - Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
914045787 1:144091074-144091096 ACAAAAAAAGTCTATAGGCTGGG + Intergenic
914132323 1:144869613-144869635 ACAAAAAAAGTCTATAGGCTGGG - Intergenic
914224757 1:145711299-145711321 ATAAATATTGACTCTAGACAGGG - Intergenic
915329599 1:155102145-155102167 ACAAAAAAGTTCTCCAGGCATGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
915824031 1:159056615-159056637 AGAAAACATGTATCTAAACAAGG + Intergenic
916696258 1:167239796-167239818 ACAAAAAATGTATGTCGTCAGGG + Intronic
916865001 1:168847014-168847036 GCAAAAAATGTCTCAAGTAATGG + Intergenic
917087213 1:171315836-171315858 ACTAACTAGGTCTCTAGACAGGG + Intronic
918199797 1:182256305-182256327 AAAAAAAATAACTCCAGACATGG - Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918900386 1:190408939-190408961 ACAAAAAATTTCTTTAGACAAGG - Intronic
919601307 1:199625997-199626019 ACAACCAATGTATCTTGACAAGG - Intergenic
919707567 1:200692623-200692645 AAAAAAAAAGTCCCTAGAAAAGG + Intergenic
919749727 1:201029780-201029802 ACAACAAATGTCCATCGACAGGG + Intergenic
919842368 1:201618793-201618815 AGAAACAATGTCTCAATACAAGG + Intergenic
920593528 1:207245715-207245737 ACATAAACTGTCTCTACAGATGG + Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921494357 1:215820231-215820253 GAAAAAAATGTGTGTAGACATGG - Intronic
923034794 1:230278293-230278315 AAAAAAAATGTTTGTAGAGATGG + Intronic
924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG + Intronic
924178294 1:241415529-241415551 AGCAATAATGTATCTAGACATGG + Intergenic
1065287016 10:24195956-24195978 AAAAAAAATTTCTGTAGACATGG - Intronic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1065481404 10:26197717-26197739 ACAAAAAATTTATCTGGGCATGG - Intronic
1065654139 10:27929319-27929341 ACATAAAAAGTCAATAGACATGG - Intronic
1068125587 10:52838642-52838664 ACAAAAAATGTTTATAAGCATGG - Intergenic
1068782773 10:60939532-60939554 CCAAAAAGTGTGTGTAGACAAGG - Intronic
1070670788 10:78375910-78375932 CCAAATAATGTCTCAAGACCAGG - Intergenic
1070950243 10:80425439-80425461 ACAGAAAATGTCACCAAACAGGG + Intronic
1071146609 10:82581910-82581932 AAAAAAAGTGTATCTAAACACGG - Intronic
1071716556 10:88102736-88102758 ACACAATATGACTCTAGAAAAGG - Intergenic
1071880850 10:89897044-89897066 ACAAAAACTGCCTGTAGCCAAGG - Intergenic
1072355567 10:94606520-94606542 AAAAAAAATTTCTTGAGACAGGG + Intronic
1072849796 10:98877045-98877067 ACAAAAAATGTTTTTGAACATGG - Intronic
1072890738 10:99321987-99322009 ACAAAAAATCTCCCTAGCCTAGG + Intergenic
1074117917 10:110471465-110471487 AAAAAAAATGTTTCTAGGCTGGG - Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1074481620 10:113827013-113827035 ACAGAAGATGGCTCTTGACATGG - Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1075170016 10:120104470-120104492 ACCAAAAATGTCTCTATCCCTGG - Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076556497 10:131324910-131324932 TCAAATTATTTCTCTAGACAGGG + Intergenic
1077131137 11:973259-973281 ACCAAAAATGCCCCAAGACACGG - Intronic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078182764 11:9026618-9026640 AAAAAAAATGTATAGAGACAGGG + Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1078872711 11:15363890-15363912 ATAAAAAATGTCTATGGACATGG - Intergenic
1078974967 11:16463234-16463256 ACAAAAAATATATAAAGACAAGG - Intronic
1079196700 11:18334222-18334244 ACAAAAAAATTCTCTGGGCATGG + Intronic
1079813844 11:25029898-25029920 ACAAAATATATCTATTGACATGG - Intronic
1081229738 11:40570736-40570758 AGAAAAAATGTCTTTAGAACAGG - Intronic
1081327185 11:41759169-41759191 AGAAAAAATTTACCTAGACATGG + Intergenic
1081373359 11:42330947-42330969 ATAAAAAATGTCTTTAAATATGG - Intergenic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082694244 11:56340486-56340508 ACTAAAAATTTGTCTAGTCAGGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083284480 11:61649443-61649465 AAAAAAAATTTTTCGAGACAGGG + Intergenic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084198819 11:67541828-67541850 ATAAAAAATGTTTTTAGAGATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084594266 11:70107759-70107781 ACAAAACACGTCACTAGTCAAGG + Intronic
1084747446 11:71182149-71182171 AAAAAAAATCTCTCCAAACATGG + Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085918419 11:80920862-80920884 ATAAAAAATTACTGTAGACAGGG - Intergenic
1086168206 11:83804690-83804712 ACAGAAAATGTCTTTACACTGGG - Intronic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1089897646 11:121947842-121947864 ACAAAAAAAATAACTAGACATGG - Intergenic
1092391674 12:8085474-8085496 ATAAAAAATGCCAGTAGACATGG - Intronic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092812334 12:12283593-12283615 ACCTAAAATGTCTCTGGACTTGG - Intergenic
1093081662 12:14818622-14818644 ACAAAAAATTTAGCTGGACATGG + Intronic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1093766328 12:22967470-22967492 ACAAAAATAGTTTCTAGTCAGGG - Intergenic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1094361185 12:29633018-29633040 ACAAAAAATTTACATAGACAAGG + Intronic
1094464984 12:30743522-30743544 ACAAGAAATGTCTGTAGAGCAGG - Intronic
1095119486 12:38399707-38399729 GCAATAATTGTCTCTAGATAAGG + Intergenic
1095877978 12:47102784-47102806 ACAATAACTGTTTCTAGGCACGG - Intronic
1096061291 12:48702827-48702849 AAAAAAAATGTAGCTAGGCATGG + Intronic
1096091405 12:48904249-48904271 AAGAAAAATGTCCCTAGAAAGGG - Exonic
1096541432 12:52309527-52309549 ACTAAAAATGTCTCTAGATGTGG + Intergenic
1096942431 12:55361737-55361759 TCAAAAAATGTTTTTAGAGACGG + Intergenic
1098508768 12:71286161-71286183 ACAAAACATGTATCTTGAAAGGG - Intronic
1101004040 12:100384445-100384467 ACAAAAAATTTGGCCAGACATGG + Intronic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1101987622 12:109460173-109460195 AAACAAAATGCTTCTAGACATGG - Intronic
1102596502 12:113996821-113996843 ATAAAAAATGTCTCCAGGCCAGG + Intergenic
1103046406 12:117738582-117738604 ACAAAAAATGTGGCTGGGCATGG + Intronic
1103287146 12:119812099-119812121 ACAAAAAAAGTATCCAGGCATGG - Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1105925069 13:25000599-25000621 ACAAAAAAATTAGCTAGACATGG - Intergenic
1107106295 13:36646799-36646821 ATAAAACATGTCTATGGACAGGG + Intergenic
1107138969 13:36977247-36977269 TTAGAAAATGTCTGTAGACATGG + Intronic
1107150924 13:37110327-37110349 ATAAAAACAGTGTCTAGACAAGG + Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108309999 13:49179096-49179118 ACAAAAAAGCTCACTAGAAAAGG - Intronic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108888112 13:55216330-55216352 AGAAGAACTGGCTCTAGACACGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1109009735 13:56925318-56925340 ACAAAAAATGCACCAAGACAGGG + Intergenic
1109204301 13:59464929-59464951 AGAAAAAAAGTCTGTGGACAGGG + Intergenic
1109416659 13:62049707-62049729 ACAAAAAATGTAGCCAGGCATGG + Intergenic
1109847079 13:68007735-68007757 ACAAAAAATGTTTTCAGCCATGG + Intergenic
1110027764 13:70563386-70563408 ACAAAAGATTTTTCTAGAAAAGG - Intergenic
1110374954 13:74782822-74782844 ACAAAAAATATCTCTGGGCATGG - Intergenic
1111291588 13:86178206-86178228 CCAAAATATGTTTCCAGACATGG - Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112888701 13:104206205-104206227 AAAAAAAATTTAGCTAGACATGG + Intergenic
1113195983 13:107806577-107806599 GCAAAAAATGTCTATACATAAGG + Intronic
1113627071 13:111855251-111855273 ACAAAAAAATTATCCAGACATGG - Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1114729031 14:24971284-24971306 CCAAAATATGCATCTAGACATGG - Intronic
1115091641 14:29583776-29583798 TTATAAAATGTCTCTAGCCATGG + Intronic
1115619656 14:35129298-35129320 ACATTAAATGTATCTAGGCACGG - Intronic
1115692597 14:35860283-35860305 ACAAAAAAATTATCCAGACATGG - Intronic
1116140939 14:40993729-40993751 ACAAAAAATTTAGCCAGACATGG + Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1116892470 14:50282133-50282155 ATTAAAAATGTCTCTAGGCTAGG - Intronic
1116990650 14:51272586-51272608 ACAAAACAGGTGGCTAGACATGG + Intergenic
1117625093 14:57628084-57628106 ACCAAAAATGTACGTAGACAAGG - Intronic
1117879705 14:60300992-60301014 ACAAAAAATATATTTAGAAAAGG - Intergenic
1118391504 14:65299577-65299599 ACAAAAAAAGGCTCCTGACAGGG + Intergenic
1118756559 14:68849148-68849170 ACAAAAAAAGTTTGTAGAGATGG - Intergenic
1118974191 14:70663364-70663386 CCAAAAAATGTCTCTGGAAATGG - Intronic
1119047184 14:71329445-71329467 ATAAAAAATTTTTCGAGACAGGG + Intronic
1119465847 14:74857722-74857744 ACAAAAAATATATATAGAGAGGG - Intronic
1119536529 14:75407436-75407458 AAAGAAAATGTATCTATACATGG - Intergenic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120287585 14:82523818-82523840 ACAAAAGATGTTTCCAGAAATGG - Intergenic
1121132738 14:91463607-91463629 ACAAAAAATTTTTGTAGAGATGG + Intronic
1121206776 14:92175911-92175933 ACAAAAAATGTTTATAAACATGG - Intergenic
1121770785 14:96535724-96535746 AAAAACAATGTCTCTCTACATGG + Intronic
1121959004 14:98241160-98241182 AAAAAAAATGTGTTTAGACTTGG + Intergenic
1122596306 14:102895365-102895387 TCAAAAGATGTCTCTTGACTTGG + Intronic
1123077306 14:105674522-105674544 ACAATAAATGTCTTTTAACATGG - Intergenic
1123121760 14:105919979-105920001 GCAAAAAATGTCCATAGACAGGG - Intronic
1123404463 15:20011630-20011652 GCAAAAAATGTCCATAGACAGGG - Intergenic
1123513796 15:21018277-21018299 GCAAAAAATGTCCATAGACAGGG - Intergenic
1123712554 15:22999554-22999576 ATACAAAATGTATCCAGACATGG - Exonic
1124473660 15:30011573-30011595 AAAAAAAGTGCATCTAGACACGG - Intergenic
1124783927 15:32661322-32661344 ACAGAAAATGTCTCCAGGCCAGG + Intronic
1124951963 15:34331434-34331456 TCAAAAAATGCCTCTAGGCTGGG - Intronic
1125659986 15:41386253-41386275 ACAAAAAAAGTAGCCAGACATGG + Intergenic
1125835204 15:42743945-42743967 ACAAAGAATGACTCTATATAAGG + Exonic
1126801467 15:52301536-52301558 AAAAAAAATTTATCTAGGCATGG - Intergenic
1127414687 15:58746602-58746624 AAGAAAAATGTCTTAAGACAAGG + Intronic
1127684872 15:61333549-61333571 ACAAATATTGTATCTAGACATGG - Intergenic
1128588408 15:68872445-68872467 ACAAAAATTGACTATATACACGG - Intronic
1129368544 15:75072067-75072089 TCAAAAAAAGTCTCTGGAGAGGG - Intronic
1129381733 15:75172119-75172141 AAAAAAAATGTTTGTAGAGAGGG + Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130204479 15:81863581-81863603 AGAAAAAATTACTGTAGACAGGG + Intergenic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131143551 15:89997681-89997703 CCGAAATATGTCTCTAGATAGGG + Intergenic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131410492 15:92203320-92203342 ACAAAAAATCTCGCTAAAAATGG - Intergenic
1131530164 15:93184063-93184085 ATAAAAAATGTCTCTCGGCTGGG + Intergenic
1131530206 15:93184362-93184384 AAAAAAAAAGTCTCTAAATATGG + Intergenic
1131846468 15:96494774-96494796 AGAAACAATGTCTATAGGCAGGG - Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133229261 16:4358928-4358950 ACAAAAAATTGCACTAGATAAGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133605362 16:7381923-7381945 CCCAAAGATGTCTCTAGACTTGG + Intronic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135273758 16:21092423-21092445 ACAAAAAAAGAATCTAGACACGG + Intronic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135535442 16:23290461-23290483 ACAGAAAAAGTAGCTAGACATGG - Intronic
1135851059 16:25964183-25964205 AAAAAAAAGGTCCCTAGAAATGG + Intronic
1135866860 16:26111249-26111271 AAAAAAAATGTTTGTAGAGATGG + Intronic
1136236736 16:28918823-28918845 ACAAAAAAAGTTTTTAGAGATGG + Intronic
1136292419 16:29283675-29283697 GCAAACAATGAATCTAGACATGG - Intergenic
1136492589 16:30619207-30619229 ACAAACAATGTCGTCAGACACGG + Intronic
1137392501 16:48093057-48093079 ACCCAATCTGTCTCTAGACATGG - Intronic
1137692514 16:50438902-50438924 CTAAAAAATGAATCTAGACACGG + Intergenic
1138468093 16:57208692-57208714 ACAAAAAATATCTTTGGCCAGGG - Intronic
1138541583 16:57690882-57690904 AAAAAAAATATATCTAGGCATGG + Intergenic
1138621903 16:58218239-58218261 AAAATAAAGGACTCTAGACATGG + Intergenic
1138907591 16:61356170-61356192 ACAAAAAAATTAGCTAGACATGG + Intergenic
1139136498 16:64211153-64211175 ACAAATAATGTCTTTGGAGACGG - Intergenic
1139773505 16:69298092-69298114 ATAAAAAATGTATCTGGGCATGG - Intronic
1139906484 16:70369772-70369794 ACAAAAAATTTAGCTAGGCATGG - Intronic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140611349 16:76602780-76602802 AAAAAAAATTTCACTGGACATGG - Intronic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1141051054 16:80764059-80764081 ACAAAAAAAGTCTTTAAAGATGG + Intronic
1141178823 16:81738677-81738699 TCAAAAACTGTCTCCAGATAGGG + Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141743017 16:85906777-85906799 CCAAAAAAGGTCTCCAAACATGG - Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1141758310 16:86009874-86009896 ACAAATAAGGTGTCCAGACAGGG - Intergenic
1142098313 16:88257694-88257716 GCAAACAATGAATCTAGACATGG - Intergenic
1142488947 17:265377-265399 ACAAAAAATATCTCTTGGCCAGG - Intronic
1144043533 17:11434032-11434054 AGAAAAAATGTTTCCAAACAAGG - Intronic
1144108011 17:12003625-12003647 CCGTAAAATGTCTTTAGACAAGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1144886945 17:18469635-18469657 AAAAAAAATGTGGCCAGACATGG - Intergenic
1145145270 17:20474659-20474681 AAAAAAAATGTGGCCAGACATGG + Intergenic
1145995263 17:29101459-29101481 ACAAAAAAAGTATCTGGGCATGG - Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147485859 17:40813268-40813290 ACAAAAATTGTACCTATACATGG + Intergenic
1147637679 17:41973990-41974012 AAAAAAAATGTCACAAAACAAGG - Exonic
1147695099 17:42346046-42346068 AAAAAAAATTTCTGTAGAGATGG + Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1148519438 17:48256795-48256817 ATAAAAAATATTTCTAGAAATGG + Intronic
1148799011 17:50211306-50211328 ACAGAAAAAGTCTCTACCCATGG + Intergenic
1149316824 17:55446241-55446263 AAAAAAAATTGCTCTTGACATGG + Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151000965 17:70375776-70375798 ACAAAAAAAGTCTGTAGCAAAGG - Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151438080 17:74110688-74110710 AAAAAAAATGTGTATACACAGGG + Intergenic
1151495250 17:74454633-74454655 ACCACAAATGTCTCTGGACACGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1152764761 17:82130188-82130210 AAAAAAAATGTTTTGAGACAGGG - Intronic
1153230457 18:2930542-2930564 ACAAAAGATGACACTAGTCACGG + Intronic
1153277733 18:3384379-3384401 ACATAAAATTTCACAAGACAAGG - Intergenic
1153799459 18:8656726-8656748 ACAAAAAAATTAACTAGACATGG + Intergenic
1153885934 18:9466119-9466141 ACAAAATATGCTTCAAGACAAGG - Intergenic
1154214261 18:12404169-12404191 AAAAAAAATGTTTTTAGAGACGG - Intergenic
1154468113 18:14669500-14669522 ACAAAAACTTTCTGTAGAGATGG - Intergenic
1155751583 18:29429423-29429445 ACAAAGAATGTTACTAAACAAGG + Intergenic
1156111264 18:33730127-33730149 ACAAAAAACATCTCCAAACATGG - Intronic
1156548156 18:37986556-37986578 AAAAATAATGTGTCAAGACAGGG + Intergenic
1156839088 18:41590172-41590194 ACCAAAAATGTATATAGAGATGG + Intergenic
1156883032 18:42103277-42103299 ACAAAAAAGTTATCTAGGCATGG + Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1158122075 18:54059561-54059583 ACTAAAAATGTCCCTGTACAGGG + Intergenic
1158445295 18:57515256-57515278 ACAAAAAATTTTTTGAGACAAGG + Intergenic
1158982977 18:62783381-62783403 ACAAAAAAGTTAGCTAGACATGG - Intronic
1161265787 19:3363752-3363774 ACCACAAATGTCCTTAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161462427 19:4406278-4406300 ACCAAAAATATCTCTATACGTGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1161945547 19:7434163-7434185 ACAAAAAATTTATAGAGACAGGG + Intronic
1162136265 19:8557301-8557323 ACAAAAAAAGTTTTGAGACAGGG + Intronic
1162684692 19:12372301-12372323 ACAAAAAAATTATCCAGACATGG + Intergenic
1162921059 19:13903375-13903397 CCAAAAAAAGTCTCTAGGCCGGG + Intronic
1163160827 19:15463239-15463261 AAAAAAAAAGTATCTAGGCATGG - Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1164285573 19:23813056-23813078 AAAAAAAATGTTTGTAGAGAGGG - Intronic
1164317871 19:24110388-24110410 AAAAAAAATGTTTGTAGAGAGGG - Intronic
1164461975 19:28456629-28456651 ACAAAAAATTTTTGTAGAGATGG - Intergenic
1164515447 19:28931517-28931539 TCAAAAAATTGCTGTAGACAAGG + Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1165573265 19:36793104-36793126 AAAAAAATTGTTTTTAGACAGGG + Intergenic
1166168049 19:41006311-41006333 AAAAAAAATGTAGCTAGACATGG - Intronic
1166646370 19:44534746-44534768 ACAATAAATGCCTCCAGACTTGG + Intergenic
1167023569 19:46897331-46897353 ACAAAAAATGCCTCATGAAATGG - Intergenic
1167451675 19:49574013-49574035 ACAAAAAAAGTATCTAGGCATGG - Intronic
1168144322 19:54411800-54411822 ACAAAAAAATTATCTGGACATGG - Intergenic
1168243873 19:55100303-55100325 ACCAAAAATGTCTCTGGACGTGG - Intronic
1168361204 19:55742271-55742293 ACAATAAATTTCTTGAGACAAGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168678401 19:58295715-58295737 ACAAAATATGTCGCTAAAGAGGG - Exonic
1168698332 19:58419054-58419076 ACAGAAAATACCTCTAGTCAAGG + Intergenic
1202677825 1_KI270711v1_random:23772-23794 AAAAAAAATGTCTCTGACCAGGG - Intergenic
1202685346 1_KI270712v1_random:44485-44507 ACAAAAAAAGTCTATAGGCTGGG + Intergenic
925265273 2:2562610-2562632 ACAAAAAATTTAGCTAGGCATGG - Intergenic
925578387 2:5384428-5384450 ACAAAAATTGACTATAGACTAGG + Intergenic
925960838 2:9013837-9013859 AAAAAGAATATCTCTAGAGAGGG - Intergenic
926177892 2:10612833-10612855 ATAAAAAATGTGTAGAGACAAGG - Intronic
926215911 2:10905257-10905279 CCCAAAAATCTCTCTAGCCACGG + Intergenic
926794803 2:16610380-16610402 ACAGAAAATGGCTTAAGACATGG + Intronic
927262006 2:21101438-21101460 AATCAAAATGTCTCAAGACATGG - Intergenic
927892468 2:26760408-26760430 ACAAAAAATGTAGCTGGGCATGG + Intergenic
928700893 2:33897493-33897515 ACAAAAAAAGTAGCTAGGCATGG - Intergenic
929296715 2:40256692-40256714 AAAAAAAATGTCTTTAGAGAAGG + Intronic
929521751 2:42658900-42658922 AAAAAAATTTTCTGTAGACAAGG - Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930145393 2:47997139-47997161 ACAAAAATTGTGTAGAGACAAGG + Intergenic
930702530 2:54473157-54473179 AGAAATAATGTTTCTATACAAGG - Intronic
931206686 2:60153505-60153527 AAAAAAAATGCATCTAGATAAGG + Intergenic
932523779 2:72442331-72442353 GCAAAAAATGGCACAAGACAAGG + Intronic
933227958 2:79772735-79772757 AAAAAAAATGTGTAGAGACAGGG + Intronic
933449693 2:82431823-82431845 ATAGAAAAAGTCTCTAGAGATGG - Intergenic
934246379 2:90310347-90310369 ACAAAAAAAGTCTATAGGCTGGG - Intergenic
935817718 2:106862802-106862824 AGAAAAAACATTTCTAGACAGGG + Intronic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937822733 2:126329269-126329291 ATAGAAAATGTCTCTATAAATGG + Intergenic
938606650 2:132900403-132900425 AATAAAGATGTCTCTAGACATGG + Intronic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
938967277 2:136399663-136399685 ACAAAAAAGGTAGCTAGGCATGG - Intergenic
939109472 2:137990275-137990297 CAAAAAAATGAATCTAGACAAGG - Intronic
939413132 2:141857505-141857527 AAAAAAAATTTTTGTAGACATGG + Intronic
939854810 2:147345363-147345385 ACAAGAAATGTTTCTGGACTTGG + Intergenic
939862863 2:147440318-147440340 ACACAAAAAGTCTCTAGGGAAGG - Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940215881 2:151303206-151303228 ACATAAAATGTGTCTGGAAAGGG + Intergenic
940495995 2:154429375-154429397 ACTAAAACTGTCTCTATATACGG - Intronic
940559913 2:155281906-155281928 ACAAAAAAATTAGCTAGACAAGG - Intergenic
941052192 2:160747635-160747657 ATAAAAAATGTCTGCAGTCATGG - Intergenic
941581035 2:167294749-167294771 ACAAAAATTGGCTCAATACAGGG + Intergenic
941774882 2:169382224-169382246 ACAAAAAATGTCATTTGATAGGG - Intergenic
941922635 2:170867047-170867069 GCAAAAACTGACTCAAGACATGG - Intergenic
942742022 2:179192097-179192119 AACCAGAATGTCTCTAGACATGG + Intronic
943708540 2:191062208-191062230 ATAAAAAATGTATCCAGGCATGG - Intronic
943785844 2:191877811-191877833 ACAAAAGATGTCTTTAGGCATGG - Intergenic
943895915 2:193359378-193359400 ACAATAATTCTCTCTGGACATGG + Intergenic
944451635 2:199850268-199850290 ACAAAAAATTGCTTTACACAAGG + Intronic
945537863 2:211041437-211041459 AGAAAAAATGTCTGTTTACATGG + Intergenic
946597837 2:221326217-221326239 ACAAAAACAGTCTTTGGACAGGG + Intergenic
946736346 2:222758085-222758107 AAAAAAAATTTTTTTAGACATGG - Intergenic
946864360 2:224029682-224029704 ACAAAAAATGTCTATACAGTAGG - Intronic
946980221 2:225205112-225205134 ACAAAAAATTTAGCCAGACATGG - Intergenic
947332594 2:229045744-229045766 ACAGCAAATGTCTCAAGCCAAGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
948032820 2:234833452-234833474 ACAAAAAAATTAGCTAGACACGG - Intergenic
948337240 2:237219155-237219177 ACAAAGAATGTCCCAAGACTAGG - Intergenic
1169385722 20:5147692-5147714 AAAAAAAATGTGGCCAGACAGGG - Intronic
1169688886 20:8307983-8308005 ACAACAAATAGCTCTAGAAAAGG - Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1170810887 20:19673442-19673464 ATAGAGAATGTCTCTAGACCAGG + Intronic
1171802794 20:29641661-29641683 AGAAGAAATGTATCAAGACATGG - Intergenic
1172148286 20:32772860-32772882 AAAAAAAATGTGTCCAAACAGGG - Intronic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173705209 20:45105162-45105184 ACAAGAAATGTTTCTATAGATGG - Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175661615 20:60817835-60817857 ACAGAAAATGTGTTTAGACCTGG + Intergenic
1176482349 21:7313664-7313686 ACAAAAAGACTCTCTACACATGG - Intergenic
1176729075 21:10472130-10472152 ACAAAAAAAGTATCTGGGCATGG + Intergenic
1176806403 21:13488149-13488171 ACAAAAACTTTCTGTAGAGATGG + Intergenic
1176948966 21:15021093-15021115 ACAAAAAATCTGTCTACAAATGG + Intronic
1177151287 21:17457810-17457832 ACAAAAACTATTTATAGACATGG + Intergenic
1177221699 21:18202098-18202120 ATAAAAAATGTCTGTAGGCCGGG - Intronic
1177802972 21:25846618-25846640 AAAAAAAACTTCACTAGACATGG - Intergenic
1178171226 21:30041768-30041790 ACACAAAATGACTTAAGACATGG - Intergenic
1178418240 21:32421461-32421483 AAAAATAATGTCTCTTGAGATGG + Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179333884 21:40432045-40432067 ACAAAAAAATTCGCTAGGCATGG + Intronic
1180210033 21:46290072-46290094 ACAAAAACTGTCACTAAAGATGG - Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181851414 22:25752661-25752683 AAAAAAAATTTTTTTAGACATGG + Intronic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1182363397 22:29761285-29761307 AAAAAAAATAGCTGTAGACAGGG + Intronic
1183156402 22:36078893-36078915 TCAAAAAAAGTTTCTAGACAAGG - Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183992543 22:41607640-41607662 ACCAAAAATATCTCTGGACATGG + Intronic
1184875453 22:47271774-47271796 AAAAAAAATGTGTCTAGGCCAGG - Intergenic
949944744 3:9180967-9180989 ACAACAGATGTCTGGAGACACGG + Intronic
951072199 3:18343452-18343474 AGAAAAAAAATCTCTAAACAGGG - Intronic
951606175 3:24437546-24437568 AGAAAAAATGTCTGTAGCAATGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952087483 3:29843552-29843574 ACAAAAAATGTATCGAGCCACGG + Intronic
952125529 3:30295725-30295747 AAAAAAATTGTCTCTAGACTAGG + Intergenic
952252552 3:31668892-31668914 AAAAAAAAAATCTCTAGAGATGG - Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953621897 3:44540353-44540375 AAAAAAAAAGTCTATAGACGGGG + Intergenic
954216459 3:49127279-49127301 AAAAAAAATTCCTCTAGACCAGG - Intronic
954546470 3:51440111-51440133 ATAAAAAGTGAATCTAGACATGG - Intronic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955288369 3:57667325-57667347 AAAAAAAATTTCACTAGAGATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956969103 3:74501314-74501336 TCAATAAATAACTCTAGACACGG + Intronic
958710665 3:97713201-97713223 AAACTAAATGTCTTTAGACAGGG - Intronic
959196776 3:103193239-103193261 ATAAAAAGAGTTTCTAGACAAGG + Intergenic
959443907 3:106413296-106413318 ACTAAAAATGTGTCAAGAGAGGG - Intergenic
959926927 3:111932624-111932646 AAAAAAAATGACTCCAGAAATGG - Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
960652474 3:119966709-119966731 ATAAAAAATCTATCTAGATAGGG - Intronic
960839411 3:121941044-121941066 AAAAAAAATGCTTCAAGACAGGG - Exonic
960890147 3:122439358-122439380 AAAAAAAATGTTTTTAGAGATGG + Intronic
961776915 3:129294121-129294143 TCAAAAAATGTCTTTAGGCCGGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962099804 3:132329900-132329922 AAAAAAAAAGTACCTAGACAAGG - Intronic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962787464 3:138781442-138781464 AAAAAAAATTTCTGTAGAGATGG - Intronic
963251660 3:143109467-143109489 ACAAAAAATTTAGCTAGGCATGG - Intergenic
964086019 3:152819444-152819466 CAAAAAAATGAATCTAGACATGG - Intergenic
964097852 3:152953953-152953975 ACAAGAAATTTTTCTAGACTAGG - Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964302354 3:155302820-155302842 ACAAAAAATTTCTCCAAACTTGG + Intergenic
964478496 3:157119343-157119365 ATATAAAATTTCTCTGGACAGGG - Intergenic
964482149 3:157150940-157150962 ACAAAAAAGGTATGTAAACAAGG - Intronic
965208008 3:165746845-165746867 ACAAAGAACGTTTCAAGACATGG + Intergenic
965932215 3:174058859-174058881 ACAGAAATTATCTATAGACAAGG - Intronic
966957965 3:184903618-184903640 AAAAAAAAATTCTCAAGACAGGG + Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967795053 3:193590937-193590959 ACAAAAAATGTCTCGGAACCAGG - Intronic
967826346 3:193880652-193880674 ACAAAAAAAGTAGCCAGACATGG + Intergenic
968465526 4:748188-748210 AAAAAAAAGTTCTCTAGACGTGG - Intronic
968796140 4:2706033-2706055 AAAAAAAATATCTGTAGAGATGG - Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969271069 4:6102709-6102731 AAAAAAAAAGTCTTTAGAGAGGG - Intronic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970333490 4:15006012-15006034 ACAAAAGATGGGTCTAGCCATGG + Intronic
970434999 4:16024660-16024682 ACACAAATTGTCTTTAGAGAAGG - Intronic
971580611 4:28334744-28334766 ACAAAAAAGGTCTCTAAGGAAGG + Intergenic
971796253 4:31232694-31232716 AGTAAAAGGGTCTCTAGACATGG + Intergenic
971840760 4:31849420-31849442 ACAAAAAATGTAGCTGGGCATGG - Intergenic
972364720 4:38363626-38363648 ACAAAATATGTCTCGAAAAAGGG - Intergenic
974444979 4:61968228-61968250 TCAAAAAATGTCACCAGAAAAGG - Intronic
974639774 4:64613107-64613129 ACAAAGAATAAGTCTAGACAAGG + Intergenic
974703795 4:65486059-65486081 ACAAAAAGTCTGTCTGGACATGG - Intronic
975308090 4:72871929-72871951 TCAAAAACTGGCTCAAGACAAGG + Intergenic
976047022 4:80962363-80962385 GCAAAATAGGTCTCTATACAGGG + Intronic
976155174 4:82136294-82136316 ATGAAAAATGCCTTTAGACATGG - Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
977079897 4:92511904-92511926 AAATAAAAAGTCTCTAGAGAGGG - Intronic
978074402 4:104511237-104511259 ACAAAAAAGGTGTGTACACAAGG - Intergenic
978271754 4:106899469-106899491 AAAAAAAATGTGTAGAGACAGGG + Intergenic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
979128973 4:117015467-117015489 ACAAAAAATGTTTCTAAAGGGGG + Intergenic
979763948 4:124442324-124442346 ACAAAAAAGGTTTTTAGAAAAGG - Intergenic
980210310 4:129778983-129779005 ACAAAAATTGTTTGTAGAAATGG + Intergenic
981493352 4:145364929-145364951 ACAAAGAATGTCAGAAGACAGGG + Intergenic
981596024 4:146423514-146423536 GCAAAGACTGTCTCTAGGCAAGG - Intronic
982659742 4:158192524-158192546 ACAAAAAATATTTCTAAACCTGG - Intergenic
983035119 4:162854679-162854701 ACAAAAATTGTATCTATTCAAGG + Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
983754427 4:171317169-171317191 AAAAAAAATGTTTTTAAACAAGG + Intergenic
984041311 4:174737665-174737687 ATACAAAATTTCTCCAGACATGG - Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
984960747 4:185095121-185095143 TCAATAAATGTCTGTAGAAAGGG - Intergenic
985175652 4:187196904-187196926 AAAAAAAAATTCTGTAGACATGG + Intergenic
985245811 4:187978790-187978812 AAAAAAAATGTGGCCAGACACGG + Intergenic
985384344 4:189429561-189429583 AGAAAAAAAGTCTCTACAGAGGG + Intergenic
986162016 5:5238803-5238825 ACAAGCAATGTGTCTACACAAGG - Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987472164 5:18345561-18345583 ACAAAAAAGGACTGTAGACTGGG + Intergenic
987739988 5:21895260-21895282 ACAAATAATACCTCTAAACATGG - Intronic
989279480 5:39624320-39624342 ACAAAAAGTTTCTGTAGAAATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990285084 5:54293285-54293307 ACAAAAACTGCCTTTAGACATGG - Intronic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991023703 5:62007699-62007721 ACACAAAATGTCTCTGGACACGG + Intergenic
991581366 5:68158563-68158585 AAAAAAAATGTTTTTAGAGAAGG - Intergenic
991699201 5:69301455-69301477 AAAAAAAATTTTTGTAGACATGG - Intronic
992217158 5:74537559-74537581 ACAAAAAATTTAGCTGGACATGG - Intergenic
992355266 5:75975417-75975439 ATAAAATATGTCTATAGACATGG - Intergenic
992577266 5:78127535-78127557 ACCAAAAATGTCCTTTGACAAGG - Intronic
992923037 5:81547620-81547642 ACAAAAAAATTAGCTAGACATGG - Intronic
992934939 5:81693047-81693069 ACAAAAAAATTATCCAGACATGG + Intronic
993032082 5:82716185-82716207 AGAAAAAATGTCTAGAGACAGGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993422832 5:87722579-87722601 ACAAAAATTGTCTCTAGTTGAGG + Intergenic
993509202 5:88750376-88750398 AAAAAAAATGTTTGTAGAGATGG + Intronic
993597395 5:89875764-89875786 ACAAACACTGTCTCTTGATAAGG - Intergenic
994040402 5:95252813-95252835 ACAAAAAAAGTATCTAGATAGGG + Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995097745 5:108259251-108259273 ATAAAAAATGTCTATCGATATGG + Intronic
995421019 5:111967006-111967028 AATAAAAATGTCTTTAGACATGG - Intronic
996820177 5:127617816-127617838 ACAAAAATTGTCCCTGGGCAGGG - Intergenic
997054908 5:130430546-130430568 AAAAAAAATGAATCTAGACACGG + Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
998228256 5:140343256-140343278 ACAAAAATTGCTTCTAGAGAAGG + Intronic
1000846157 5:166282851-166282873 TGGAGAAATGTCTCTAGACATGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1002474730 5:179458077-179458099 ACAAAAAAAGTAGCCAGACATGG - Intergenic
1002673316 5:180888068-180888090 ACAAAAAAATTTTCTAGGCATGG + Intergenic
1002809069 6:608381-608403 TTAAAAAATGTTTCTAGAAAAGG + Intronic
1003937756 6:10993591-10993613 GGAATTAATGTCTCTAGACATGG + Intronic
1003981688 6:11396024-11396046 ACAAAAAAATTAGCTAGACATGG - Intergenic
1004493534 6:16141281-16141303 AGAAAAATTGTATCTTGACATGG - Intronic
1004602709 6:17165954-17165976 AGAAAAAATGTCTGTACCCATGG + Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1004781767 6:18916343-18916365 AAAAAAGATGTCTGTGGACAAGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006537719 6:34713464-34713486 ACAAAAAATGTAGCTAGGCATGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1006992698 6:38228901-38228923 ACAAAAACAGTCTCTAGGCTGGG + Intronic
1007130571 6:39469538-39469560 AAAAAAAATGTTACTAGAGATGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1007753895 6:44086389-44086411 AAAAAAAATGTTTTTAGAGATGG - Intergenic
1008059102 6:46978074-46978096 ACAAAAAATTTAGCCAGACATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009417282 6:63429744-63429766 AAAAAAAAAGTCTGAAGACAGGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009641699 6:66345711-66345733 ACCAGAAATGACTCTAGACATGG - Intergenic
1010002670 6:70963354-70963376 AGAAAAACTGTCTTGAGACAGGG - Intergenic
1011455608 6:87545237-87545259 ACAAAAAAATTAGCTAGACATGG - Intronic
1011843628 6:91533367-91533389 AGAAAAAATATCTGTAGTCAGGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013125961 6:107184343-107184365 ACAAAAAATTTCTATATTCAAGG + Intronic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014707850 6:124770021-124770043 ACAGAATCTGTCTCTAGAGAGGG - Intronic
1016382269 6:143497131-143497153 AAAAAAAATTTTTGTAGACAGGG + Intronic
1017578915 6:155838781-155838803 ACAAAAAATGTTAGAAGACAGGG - Intergenic
1017684094 6:156894494-156894516 TTAAAAAAGGTCTTTAGACATGG + Intronic
1017869717 6:158476693-158476715 ACCAAACATGTCTATAGAAAAGG - Intronic
1017957641 6:159192023-159192045 ACAAAAAAATTAGCTAGACATGG - Intronic
1018160053 6:161031308-161031330 ACAAATTATTTCTCTACACATGG - Intronic
1018572229 6:165223822-165223844 AAAAAATATGTCTTTAGACATGG + Intergenic
1019844521 7:3484277-3484299 AAAAAAAATGTGTGTATACATGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020401168 7:7779439-7779461 ACAAAAAAAGTTTCTACAGATGG + Intronic
1020612120 7:10411475-10411497 ACCAAAAATATCACTAGACGGGG + Intergenic
1021518155 7:21508794-21508816 AAAAAAAAAGTGTGTAGACAAGG - Intronic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021769154 7:23981167-23981189 ACAAAAATTGTTTCTGGAGATGG + Intergenic
1021821989 7:24507302-24507324 TTAAAAAATGACTCTGGACAGGG + Intergenic
1021845570 7:24759138-24759160 ACATGAAAAGTCTCTTGACAGGG - Intergenic
1021983127 7:26073989-26074011 TTAAAAATTGTTTCTAGACATGG + Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022356322 7:29618001-29618023 AAAAAAACTGTATCTATACATGG + Intergenic
1023561947 7:41484292-41484314 GGAAAAAAAGACTCTAGACAAGG + Intergenic
1023786655 7:43714850-43714872 ACAAAAAATTTAGCTGGACATGG + Intronic
1025826718 7:65016709-65016731 AAAAAAAATTTCTGGAGACAAGG + Intergenic
1026310430 7:69178965-69178987 ACAAAAAATTTAGCCAGACATGG - Intergenic
1027651277 7:80871997-80872019 AAATTAAAGGTCTCTAGACAGGG - Intronic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1027981897 7:85235152-85235174 ACAGAAAATTTTTCTAGAAAGGG - Intergenic
1028039682 7:86035318-86035340 AAAAAAATTGGCTATAGACAAGG + Intergenic
1029119711 7:98259184-98259206 AAAAAAAATGTATAAAGACAAGG + Intronic
1029371196 7:100151873-100151895 AAAAAAAATGTGTGGAGACAGGG + Intronic
1029460442 7:100691204-100691226 ACCCAGAATGTCTCTAGACTTGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1031327330 7:120418007-120418029 ACAAAAAATGTTTCTTGAATCGG - Intronic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1033080655 7:138294040-138294062 AAAAAAAAGGCGTCTAGACATGG - Intergenic
1033167890 7:139057183-139057205 AAAAAAAATGTTTCTAGAGATGG - Intronic
1033335744 7:140450869-140450891 ACAAAAAAAGTAGCTAGGCATGG + Intergenic
1035482846 7:159201360-159201382 ACAAAAAATGTTTGTAGGCCGGG - Intergenic
1036117219 8:5971521-5971543 AAAAAAAAAGTATCCAGACATGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1036982438 8:13485048-13485070 ACAATAAAAATCCCTAGACAAGG + Intronic
1038323251 8:26548721-26548743 AAAAAAAAAGTCACCAGACATGG + Intronic
1038793597 8:30690892-30690914 AAAAAAAATTTTTGTAGACATGG - Intronic
1039226875 8:35397949-35397971 AAAAAGAATGGTTCTAGACAGGG - Intronic
1039449932 8:37664666-37664688 AAAAAAAATGTCACTACACGAGG - Intergenic
1040938498 8:52807318-52807340 AAAAAAAATTTCTGTAGAGATGG + Intergenic
1041286005 8:56262471-56262493 ACAAAAACTGGCACAAGACAGGG - Intergenic
1041742715 8:61174141-61174163 ACAAAAAATATCACTCAACATGG + Intronic
1042261784 8:66867148-66867170 AAAAAAAATTTTTTTAGACACGG - Intergenic
1042758887 8:72250076-72250098 ACAAAAAATGTCTGTGGTCAAGG + Intergenic
1043531519 8:81156513-81156535 AGAAAAAATATCTCTAGACATGG - Intergenic
1045219241 8:100181168-100181190 GCAATAAAAGTCTCAAGACATGG - Intronic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046279774 8:112011527-112011549 ACTAAAAAAGTTTCCAGACATGG - Intergenic
1047223632 8:122938680-122938702 ACAAAAAAAGTAGCTAGGCATGG + Intronic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1047788099 8:128174075-128174097 ACAATAAATGTCTTAAGGCAGGG - Intergenic
1048094808 8:131280169-131280191 ACAAATAATGGCTCAAGAAATGG - Intergenic
1048807424 8:138253649-138253671 ACCAAACATGTCTCTGGGCATGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1050876758 9:10648905-10648927 ACAAAGGATGGCTCTAGTCATGG - Intergenic
1051865191 9:21672585-21672607 ACTAAAAATGTTTGTAGGCAAGG + Intergenic
1052130665 9:24842655-24842677 AAGAAAAATGAATCTAGACACGG - Intergenic
1052344712 9:27397922-27397944 CCAAAAAGTGTCTCTAGACATGG + Intronic
1052464190 9:28809323-28809345 ACAAATCATGTCTCTTGCCAAGG + Intergenic
1052798030 9:32942010-32942032 ACACAAGATGTCCCTGGACAGGG + Intergenic
1053217025 9:36280069-36280091 AATAAAAATGTCTCTGGGCATGG - Intronic
1053245508 9:36531449-36531471 ACAAAAAATTTAGCTAGGCATGG - Intergenic
1053252461 9:36586185-36586207 ACAAAAAATTTCGCTGGACATGG + Intronic
1054680920 9:67916806-67916828 AAAAAAAAAGTTTGTAGACATGG + Intergenic
1055459693 9:76507419-76507441 ATAAAAAATTTCTGCAGACAAGG - Intergenic
1055506267 9:76952630-76952652 ACCAAAAATGTTTCTAGAGTGGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056418617 9:86401930-86401952 ACAAAAAATTTAGCTGGACATGG + Intergenic
1056827209 9:89884560-89884582 ACACAGATTGTCTCCAGACAGGG - Intergenic
1057454291 9:95193542-95193564 ACTAAAAATGTCTCTAAATGGGG + Intronic
1058221770 9:102312401-102312423 TCAAAAAATGTTTCCAGAAAGGG - Intergenic
1058803929 9:108571750-108571772 ACAAAAAATGTCTGGGGGCAGGG + Intergenic
1058838606 9:108882763-108882785 TAAAAAAATGTTTTTAGACAGGG + Intronic
1059029865 9:110680537-110680559 ACAAAAAATTTAGCTGGACATGG - Intronic
1059325022 9:113498759-113498781 ACAAAAAAATTAACTAGACATGG + Intronic
1059689483 9:116670987-116671009 AAAAAAAATGTATCTGCACAAGG + Intronic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060130792 9:121096904-121096926 ACAAAATGTGACTCTAGATAAGG - Intronic
1060276936 9:122189589-122189611 AAAAAAAATTTTTATAGACAGGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061223434 9:129266032-129266054 ACAAAAAATTTTTTGAGACAGGG + Intergenic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1203585177 Un_KI270746v1:61944-61966 ACAAAAAAAGTATCTGGGCATGG - Intergenic
1185516830 X:706280-706302 AAAAAAAATTTTTGTAGACATGG + Intergenic
1185744696 X:2563361-2563383 ACAAAAAATGTAGCCAGGCATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1185822862 X:3221395-3221417 ATAAAAAATGTAGCCAGACATGG - Intergenic
1185839337 X:3374134-3374156 ACAAAACATGTGTCTGCACATGG + Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186614435 X:11171867-11171889 ACCAGAATTATCTCTAGACATGG + Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187464938 X:19518762-19518784 ACAAAAAATGTCTTAGAACAAGG - Intergenic
1187886971 X:23898060-23898082 AAAAAAAATCTACCTAGACATGG + Intronic
1187911911 X:24119122-24119144 ACAAAAAATGTGTCTAGGCTGGG - Intergenic
1188794905 X:34451088-34451110 AATAAAACTGTCTCTATACATGG + Intergenic
1188877405 X:35447072-35447094 AAAATAATTGTCTCTAGAAATGG + Intergenic
1188993548 X:36853755-36853777 GAAAAAAATGACTCTAGACATGG - Intergenic
1189022738 X:37358425-37358447 AAAAAAAATGAATCTAGATATGG - Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189327920 X:40124261-40124283 AAAAAAAATGTATATAGAGATGG - Intronic
1189363748 X:40372210-40372232 ACAGCAAATGTCACTACACACGG - Intergenic
1189448302 X:41102320-41102342 ATAAAAAATGTTACTAGACTGGG + Intronic
1190363548 X:49671093-49671115 ACCAAAAATGTCTCTACGCTGGG + Intergenic
1190720608 X:53144398-53144420 ACAAAAAATCTGTCTAGGCTGGG + Intergenic
1190782959 X:53616066-53616088 AAAAAAAATTTCTCCAGTCACGG - Intronic
1191048515 X:56165574-56165596 ACAAAAAATCTGTCTGGGCACGG + Intergenic
1191067762 X:56368181-56368203 AAAAAAAATGTCTCTGGACTAGG - Intergenic
1192570418 X:72199237-72199259 AAAAACAATGTCTCTAGGCTGGG + Intronic
1193103705 X:77644093-77644115 ACAAAAAATTTAGCCAGACATGG - Intronic
1193724550 X:85024049-85024071 AGAAAAAAAGTATCTAGGCAGGG - Intronic
1194164231 X:90495104-90495126 AAATAAAAAGTCTGTAGACAAGG - Intergenic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196730915 X:118940805-118940827 ACAAAAAATGTAGCTGGGCATGG - Intergenic
1197359585 X:125483595-125483617 ACAAGAGATGTCTTTAGGCAGGG + Intergenic
1197999437 X:132417280-132417302 ACAAACAATGTAACTAGAAATGG + Intronic
1198536346 X:137590490-137590512 ACAAAAATTGTCTCAAGGCCAGG + Intergenic
1198735284 X:139778025-139778047 AAAAAAAATTTCTGTAGAGATGG + Intronic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199411358 X:147527806-147527828 TGAAGAACTGTCTCTAGACAGGG - Intergenic
1200268538 X:154659957-154659979 ACAGAAAATGTCTCTATTCCTGG + Intergenic
1200373801 X:155757701-155757723 ACAAAAAATCTCTGGAGGCAAGG + Intergenic
1200510492 Y:4072914-4072936 AAATAAAAAGTCTGTAGACAAGG - Intergenic
1201236469 Y:11916706-11916728 ACTAAACATGTGTCTACACATGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1202588283 Y:26455137-26455159 ACAAAAAAAGTCTATAGGCTGGG - Intergenic