ID: 1186515761

View in Genome Browser
Species Human (GRCh38)
Location X:10165208-10165230
Sequence ACGAGGGGGCTGAGTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186515761_1186515768 5 Left 1186515761 X:10165208-10165230 CCCTGAGCACTCAGCCCCCTCGT 0: 1
1: 0
2: 1
3: 9
4: 128
Right 1186515768 X:10165236-10165258 ACAGAGAGCCTGCTGTTGGCTGG 0: 1
1: 0
2: 0
3: 29
4: 309
1186515761_1186515769 6 Left 1186515761 X:10165208-10165230 CCCTGAGCACTCAGCCCCCTCGT 0: 1
1: 0
2: 1
3: 9
4: 128
Right 1186515769 X:10165237-10165259 CAGAGAGCCTGCTGTTGGCTGGG 0: 1
1: 0
2: 2
3: 36
4: 300
1186515761_1186515767 1 Left 1186515761 X:10165208-10165230 CCCTGAGCACTCAGCCCCCTCGT 0: 1
1: 0
2: 1
3: 9
4: 128
Right 1186515767 X:10165232-10165254 TTCAACAGAGAGCCTGCTGTTGG 0: 1
1: 0
2: 0
3: 16
4: 163
1186515761_1186515771 28 Left 1186515761 X:10165208-10165230 CCCTGAGCACTCAGCCCCCTCGT 0: 1
1: 0
2: 1
3: 9
4: 128
Right 1186515771 X:10165259-10165281 GTTGAAAGTAGATGTGAGACCGG 0: 1
1: 0
2: 0
3: 14
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186515761 Original CRISPR ACGAGGGGGCTGAGTGCTCA GGG (reversed) Intronic
900318554 1:2071074-2071096 ATGCGGGGGCCGATTGCTCAGGG + Intronic
901193677 1:7427806-7427828 TCTGAGGGGCTGAGTGCTCAGGG - Intronic
901650283 1:10739245-10739267 ACGAGGGGGGTGTGTGCGCCTGG + Intronic
904380131 1:30105006-30105028 ACAAGTGAGCTGAGTGGTCATGG - Intergenic
904622070 1:31781746-31781768 ACGAAGGTGCGGGGTGCTCAGGG - Intergenic
905866203 1:41378063-41378085 AAAAGGGTGCTGAGTGCACAGGG + Intronic
909425052 1:75514130-75514152 ACAAGGGGACTGGGTGCTCATGG - Intronic
909547878 1:76867966-76867988 AGGAGTGGGCAGATTGCTCAAGG + Intronic
920838605 1:209535041-209535063 GTGTAGGGGCTGAGTGCTCAGGG + Intergenic
921523085 1:216181410-216181432 ACAAGGTGGCTGAGAGCTGAAGG - Intronic
921928494 1:220733240-220733262 ACGAGGGGGCGCTGTGATCAGGG - Intergenic
922821708 1:228489082-228489104 ATGAGGGGACTGTGGGCTCAGGG + Intronic
1066046228 10:31597888-31597910 AAGAGAGGGCTGAGAGCTGAAGG + Intergenic
1069372693 10:67764372-67764394 GCGGCGGGGCTGAGGGCTCAGGG - Intergenic
1069775298 10:70923743-70923765 ACCAGGGGGCTGAGTCCTGATGG - Intergenic
1069904893 10:71726417-71726439 ACGATGGGTCTGATTGCTCAGGG + Intronic
1071301275 10:84257756-84257778 AGGAGGGGGCTGAGTCTGCAGGG - Intronic
1073119487 10:101112919-101112941 ACGTGGGGGCTGAGGGTGCAGGG - Intronic
1076283136 10:129267396-129267418 AAGAGGGGGCTGAGTTTTGAAGG + Intergenic
1076882024 10:133244292-133244314 AGGAAGTGGCAGAGTGCTCAGGG + Intergenic
1077530404 11:3092298-3092320 ACGAGGGGGCTGGGGGATGAGGG + Intronic
1079280234 11:19080653-19080675 ACGTGGTGGCTGAGCGCACAGGG + Intergenic
1081372995 11:42326867-42326889 ACAAGGGGACTGAGAGCTGAGGG - Intergenic
1083316286 11:61816669-61816691 ACGAGGTGGCCCAGCGCTCAGGG - Exonic
1083366495 11:62144767-62144789 GCGAGGTAGCTGAGTGCTCCTGG + Intronic
1084010981 11:66348121-66348143 ACGAGGTGGCCGAGTGGTTAAGG + Intronic
1084308092 11:68299529-68299551 ACGGGGGTGTAGAGTGCTCAGGG + Intergenic
1085783100 11:79427039-79427061 CAGAGGGGGCTGTCTGCTCAGGG + Intronic
1086508354 11:87528897-87528919 CAGAGGGGGCTGAGTTGTCAGGG + Intergenic
1092192727 12:6532767-6532789 AAGAGGGAGCTCAGTGCCCAGGG - Intergenic
1093231390 12:16547581-16547603 AACAGGAGGCTGAATGCTCAGGG + Intronic
1096876734 12:54635261-54635283 AGGAGGAGGTTGAGGGCTCAGGG + Intergenic
1098361047 12:69655063-69655085 AAGAGCTGGCTGAGAGCTCATGG + Exonic
1103008245 12:117438824-117438846 AGGAGGTGGCTGCCTGCTCATGG - Intronic
1104771935 12:131369121-131369143 AGGAGGGGGCTGTCAGCTCATGG - Intergenic
1104865359 12:131950208-131950230 GCGACCGGGCTGAGGGCTCACGG + Intronic
1108138620 13:47393617-47393639 TCATGGGGGCTGAGTTCTCATGG - Intergenic
1113774996 13:112938955-112938977 ACATGTGGGCTGAGTTCTCAGGG + Intronic
1117102668 14:52366433-52366455 ATGTGGTGGCTGAGGGCTCAGGG - Intergenic
1121812034 14:96899998-96900020 AAGTGGATGCTGAGTGCTCAGGG - Intronic
1122717496 14:103704284-103704306 GGGTGGGGGCTGACTGCTCATGG + Intronic
1125429725 15:39582121-39582143 AGTAGGGGGCTGAGTCCTTAGGG - Intronic
1125556932 15:40593883-40593905 ACGAGGTGGCCGAGTGGTTAAGG - Intergenic
1125956125 15:43792382-43792404 AGAAGGGGGCTCGGTGCTCACGG - Exonic
1126163499 15:45634874-45634896 ACCAGGGCGTTGAGCGCTCACGG - Exonic
1132271094 15:100526408-100526430 AGGAGCTGGCAGAGTGCTCATGG - Intronic
1132744558 16:1431308-1431330 ACTTTGGGGCTGACTGCTCACGG - Intergenic
1132936409 16:2483490-2483512 AGGAGGGCGCTGAGGGCTCTAGG + Intronic
1139482107 16:67236469-67236491 CAGAGGAGGCTGAGTGCCCATGG + Intronic
1141146060 16:81530902-81530924 GCGGGTGGGCTGAGTACTCAGGG - Intronic
1142197007 16:88743635-88743657 AAGAGGGGGCTGAGTGTCCAAGG - Intronic
1143639358 17:8186867-8186889 ACGAGGTGGCCGAGTGGTTAAGG + Intergenic
1143757381 17:9076874-9076896 AGGCAGGGGCTGAGTCCTCAGGG - Intronic
1144671130 17:17133221-17133243 AGGAGGGGCCTGAGTGCAGAAGG - Intronic
1145397000 17:22504237-22504259 ATGAGGTGGTTGTGTGCTCAGGG + Intergenic
1148029194 17:44608309-44608331 AGCAGGGGGCTGAGGGCTGAGGG + Intergenic
1152628155 17:81397658-81397680 GCGAGGGGGCTGCGAGCGCAGGG - Intronic
1152677662 17:81650066-81650088 ACGAGCTGGCTGGGTGCTCTGGG + Intergenic
1153489426 18:5631453-5631475 AAGAGTGGCCTGAGTGCCCAGGG - Intergenic
1153513844 18:5886269-5886291 AATAGGGGGCTGAGACCTCAAGG + Exonic
1154310976 18:13265920-13265942 AGGAGGAGGCTGAGTGCTCAGGG - Intronic
1156503878 18:37577007-37577029 ACCAGGGGGCTGTGGGCTGAGGG + Intergenic
1157553195 18:48595270-48595292 ACGAGGGGACTGAGAGCAAAGGG + Intronic
1159870654 18:73756911-73756933 GCGCTGGGGCTGAGTGCTTAGGG + Intergenic
1160837992 19:1133435-1133457 CCGAGGGGGCGGAGTGCACAGGG - Intronic
1161620337 19:5293848-5293870 AGGAGGGGGCGGAGAGCACAGGG + Intronic
1167386342 19:49166248-49166270 ACCAGGGGGCTGCATGCTCGGGG + Intronic
1167556184 19:50197414-50197436 TCCAGGGGGATGGGTGCTCAAGG + Intronic
927133183 2:20078107-20078129 CTGAGGCTGCTGAGTGCTCAAGG - Intergenic
928089109 2:28363384-28363406 ACATGGGGGGTGAGGGCTCAGGG - Intergenic
934503208 2:94874535-94874557 ACGAGGGGACTAAGTGCCCGGGG + Intronic
936037303 2:109123235-109123257 AAGAGGGTGGTGAGAGCTCAGGG - Intergenic
937733447 2:125261442-125261464 AAGTGGGGGCTGAGTACACAGGG - Intergenic
937992947 2:127674435-127674457 ACGAGGGGCCTGAGAGCAGAGGG + Intronic
938896064 2:135751926-135751948 AGAAGGGAGCTGAGTGGTCAGGG - Intronic
938915373 2:135933462-135933484 ATGAGGGAGCTGAGTGGTTAAGG + Intronic
940962988 2:159805954-159805976 ACAAGTTGGCTGAGCGCTCAGGG - Intronic
942161370 2:173191798-173191820 ATGAGGGGGTGGAGTGCTCAAGG + Intronic
946048724 2:216843047-216843069 AAGAGGGGACTGAGGGCTGAGGG + Intergenic
947593315 2:231396704-231396726 ACCTGGGGGCTGAGAGCTCTGGG - Intronic
948430266 2:237914097-237914119 AAGAGCTGGCTGAGGGCTCAGGG - Intergenic
1169248750 20:4044594-4044616 ACCAGGGTGCTGAGGACTCAGGG - Intergenic
1170666936 20:18394578-18394600 ACGAGGGGGCTGGGGCTTCAGGG - Intronic
1171953436 20:31441280-31441302 ACCAGGGGGCTGGGTACACATGG + Intronic
1175375970 20:58524288-58524310 ATGAGGGGTCTGAGTGCCCCTGG + Intergenic
1179120065 21:38536064-38536086 GAGAGGGGGCTAATTGCTCATGG - Intronic
1182801247 22:33033567-33033589 ACTAGGGGGCTGAGTGAGAAGGG - Intronic
1185222887 22:49637712-49637734 ACGAAGTGGTTTAGTGCTCAAGG + Intronic
950379509 3:12599592-12599614 AGGAGAGGACTGAGTGCTCCTGG - Intronic
953758061 3:45664963-45664985 ACAATGGGGCTGTGAGCTCAAGG - Intronic
954334221 3:49906753-49906775 CAGAGGGGACTGAGAGCTCAAGG - Intronic
955050758 3:55408412-55408434 TGGTGGGGACTGAGTGCTCATGG + Intergenic
958954517 3:100452719-100452741 AGGAGTGGGCTAGGTGCTCATGG + Intronic
960452931 3:117832419-117832441 AGGATGGGGCTGAGTGCATAGGG - Intergenic
962379239 3:134883836-134883858 AAGAGGTGGGTGAGTGGTCAGGG + Intronic
962498449 3:135965877-135965899 ACGAGGGAGCTGAAGGCTCCAGG - Intronic
963231973 3:142916951-142916973 ACTAGAGGGCAGAGTGCACATGG - Intergenic
967266414 3:187696064-187696086 ACGTGGGGCCTGAGAGCTGAAGG - Intergenic
967277492 3:187790771-187790793 ACTTGGCGGCTGAGTGCTTAGGG - Intergenic
967949312 3:194828700-194828722 TGGAGGGCGCTGAGTGCTCTGGG + Intergenic
968454577 4:690457-690479 GTGAGGGGGCTGGGTCCTCAGGG - Intergenic
968495922 4:915196-915218 ACGCTGGGGCTGAGTGCACGGGG - Intronic
968891926 4:3374069-3374091 GAGAAGGTGCTGAGTGCTCAAGG - Intronic
984972170 4:185201471-185201493 ATCAGGGTGCTGAGTGCTGAAGG - Intronic
989156045 5:38345995-38346017 TCAAGGGGGCTGAGTGGTCAGGG - Intronic
990457109 5:55998567-55998589 ACGGTGGGGCTGATAGCTCAAGG - Intergenic
992443197 5:76812929-76812951 ACGAGGGGGCTGGCTGGGCAGGG - Intergenic
1001009549 5:168085614-168085636 TCAAAGGGGCTGAGTGCTCAGGG - Intronic
1005566221 6:27097307-27097329 ACGAGGTGGCCGAGTGGTTAAGG + Intergenic
1005588237 6:27297997-27298019 ACGAGGTGGCCGAGTGGTTAAGG + Intronic
1005681508 6:28213038-28213060 ACGAGGTGGCCGAGTGGTTAAGG + Intergenic
1005720540 6:28597398-28597420 ACGAGGTGGCCGAGTGGTTAAGG - Intronic
1007414470 6:41683788-41683810 ACGAGGGGTTTGGGTGCTGAGGG - Intergenic
1011637192 6:89385491-89385513 ATTAGGGAGCTTAGTGCTCAAGG - Intronic
1014680475 6:124423638-124423660 ATGAGGGGGCAGAGCCCTCATGG + Intronic
1015968267 6:138716938-138716960 GGGAGGGGGCTGAGGGCTGAGGG - Intergenic
1017096748 6:150811696-150811718 ATGGGAGGGCTGAGTTCTCAGGG + Intronic
1019173955 6:170150363-170150385 ATGAGGGGCCTGAGGACTCAGGG - Intergenic
1019265765 7:116710-116732 AAGAGGGGGATGGGGGCTCAGGG - Intergenic
1019411352 7:908144-908166 GCGAGGGGGCTGTGGGCTCCAGG + Intronic
1023965272 7:44960853-44960875 CTGAGGGGGCTGAGGGCTGAGGG + Intergenic
1023965553 7:44961674-44961696 CTGAGGGGGCTGAGGGCTGAGGG + Intergenic
1024659113 7:51476237-51476259 AGCAGGGGCCTGAGTGCTAATGG - Intergenic
1025023801 7:55499635-55499657 ACGAGGCAGCAGGGTGCTCAGGG + Intronic
1026889934 7:73975940-73975962 AGGAAGGGGCTGAATTCTCAGGG + Intergenic
1028487249 7:91373506-91373528 AAGAGTGGGCTGACTGGTCAAGG + Intergenic
1029434377 7:100554127-100554149 GGGAGGTGGCTGAGTGCTCCGGG - Exonic
1035306967 7:157939615-157939637 ACGATGGGGTTGAGGCCTCAGGG - Intronic
1043485245 8:80692831-80692853 AAGAGGGGGCTGACAGCTCTGGG + Intronic
1047715469 8:127591085-127591107 ACTTGGGGGATGAGTGCTGAAGG + Intergenic
1051331499 9:16029000-16029022 AAGAGGGGGCTCTATGCTCAAGG - Intronic
1057569989 9:96197227-96197249 AGCAGGAGGCTCAGTGCTCAGGG + Intergenic
1061548358 9:131317840-131317862 TCGAGGGGGCTGTGTGCCCAGGG + Intergenic
1062573125 9:137194596-137194618 CCGCGGGGGCTGGGTGCACATGG + Intronic
1185833388 X:3322241-3322263 TCGAGAAGGGTGAGTGCTCATGG + Exonic
1186515761 X:10165208-10165230 ACGAGGGGGCTGAGTGCTCAGGG - Intronic
1186541800 X:10408847-10408869 ACCAGGGTGCTGAGGGCTGACGG - Intergenic
1198788575 X:140317652-140317674 ACTAGGGGGCAGAGGTCTCAGGG - Intergenic
1201242304 Y:11970790-11970812 TCGAGAAGGGTGAGTGCTCATGG - Intergenic