ID: 1186515845

View in Genome Browser
Species Human (GRCh38)
Location X:10165550-10165572
Sequence GGTCCTGGGTGCTGGGCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186515830_1186515845 15 Left 1186515830 X:10165512-10165534 CCCCAACGCTGTGTTTCCTTATG No data
Right 1186515845 X:10165550-10165572 GGTCCTGGGTGCTGGGCCTGCGG No data
1186515833_1186515845 13 Left 1186515833 X:10165514-10165536 CCAACGCTGTGTTTCCTTATGGG No data
Right 1186515845 X:10165550-10165572 GGTCCTGGGTGCTGGGCCTGCGG No data
1186515838_1186515845 -1 Left 1186515838 X:10165528-10165550 CCTTATGGGGGAGGCTGCTCCTG No data
Right 1186515845 X:10165550-10165572 GGTCCTGGGTGCTGGGCCTGCGG No data
1186515831_1186515845 14 Left 1186515831 X:10165513-10165535 CCCAACGCTGTGTTTCCTTATGG No data
Right 1186515845 X:10165550-10165572 GGTCCTGGGTGCTGGGCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186515845 Original CRISPR GGTCCTGGGTGCTGGGCCTG CGG Intronic