ID: 1186516142

View in Genome Browser
Species Human (GRCh38)
Location X:10167225-10167247
Sequence CAGGAAGGCACTGACAGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 332}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186516142_1186516155 20 Left 1186516142 X:10167225-10167247 CCGTCACTGTCAGTGCCTTCCTG 0: 1
1: 0
2: 2
3: 33
4: 332
Right 1186516155 X:10167268-10167290 GGAGGGTTAGCTAGAAGGGGTGG 0: 1
1: 0
2: 0
3: 21
4: 226
1186516142_1186516146 -1 Left 1186516142 X:10167225-10167247 CCGTCACTGTCAGTGCCTTCCTG 0: 1
1: 0
2: 2
3: 33
4: 332
Right 1186516146 X:10167247-10167269 GTCTTCTCCCCTCTGGTGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 155
1186516142_1186516152 15 Left 1186516142 X:10167225-10167247 CCGTCACTGTCAGTGCCTTCCTG 0: 1
1: 0
2: 2
3: 33
4: 332
Right 1186516152 X:10167263-10167285 TGTTTGGAGGGTTAGCTAGAAGG 0: 1
1: 0
2: 2
3: 10
4: 152
1186516142_1186516148 3 Left 1186516142 X:10167225-10167247 CCGTCACTGTCAGTGCCTTCCTG 0: 1
1: 0
2: 2
3: 33
4: 332
Right 1186516148 X:10167251-10167273 TCTCCCCTCTGGTGTTTGGAGGG 0: 1
1: 0
2: 4
3: 20
4: 176
1186516142_1186516153 16 Left 1186516142 X:10167225-10167247 CCGTCACTGTCAGTGCCTTCCTG 0: 1
1: 0
2: 2
3: 33
4: 332
Right 1186516153 X:10167264-10167286 GTTTGGAGGGTTAGCTAGAAGGG 0: 1
1: 0
2: 1
3: 12
4: 105
1186516142_1186516154 17 Left 1186516142 X:10167225-10167247 CCGTCACTGTCAGTGCCTTCCTG 0: 1
1: 0
2: 2
3: 33
4: 332
Right 1186516154 X:10167265-10167287 TTTGGAGGGTTAGCTAGAAGGGG 0: 1
1: 0
2: 0
3: 7
4: 173
1186516142_1186516147 2 Left 1186516142 X:10167225-10167247 CCGTCACTGTCAGTGCCTTCCTG 0: 1
1: 0
2: 2
3: 33
4: 332
Right 1186516147 X:10167250-10167272 TTCTCCCCTCTGGTGTTTGGAGG 0: 1
1: 0
2: 2
3: 21
4: 218
1186516142_1186516144 -8 Left 1186516142 X:10167225-10167247 CCGTCACTGTCAGTGCCTTCCTG 0: 1
1: 0
2: 2
3: 33
4: 332
Right 1186516144 X:10167240-10167262 CCTTCCTGTCTTCTCCCCTCTGG 0: 1
1: 0
2: 7
3: 51
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186516142 Original CRISPR CAGGAAGGCACTGACAGTGA CGG (reversed) Intronic
900496641 1:2978813-2978835 GCGGAAGCCACTGGCAGTGAGGG + Intergenic
902491764 1:16787622-16787644 CAGGATGGCACTGATGATGATGG - Intronic
903316832 1:22514616-22514638 CAGGAAGGGACTCACAGAGAAGG - Intronic
903815344 1:26060601-26060623 CAGCAAGGAACTGACAGAGGAGG + Intronic
904638888 1:31906702-31906724 CAGGCAGGCACTGATACTGATGG + Exonic
905520695 1:38597323-38597345 CAGGCAGGCCCTGAGAGAGAGGG - Intergenic
906687913 1:47774369-47774391 CAGGGAGGGACTGTCAGTGATGG - Intronic
906688623 1:47778405-47778427 CAGGAAGGCAGGGTCAGTGAGGG + Intronic
908045847 1:60167566-60167588 CACAAAGGAACTGACAGTGGTGG - Intergenic
911124032 1:94323530-94323552 CAGGAAGGCACCGTCACTGGTGG - Intergenic
911195941 1:94995791-94995813 CCTGAATGCACTGACAGTGAAGG - Intronic
911278597 1:95895254-95895276 CAGGAAGGCACAGAAAGGGAAGG + Intergenic
912385750 1:109270430-109270452 CAGGATGGCAATGACTGTGCAGG - Exonic
915625094 1:157109560-157109582 CAGGAAGGCCCTGCCAAAGAGGG + Intergenic
916102486 1:161404867-161404889 TAGTAATGCACTTACAGTGAGGG + Intergenic
916737421 1:167620205-167620227 TAAGAGGGCAGTGACAGTGATGG + Intergenic
917021914 1:170598236-170598258 CATGAAGGCTCTGCCAGGGATGG - Intergenic
917789602 1:178491118-178491140 CAGGCAGGGACTGGCAGTGGTGG - Intergenic
917903226 1:179564474-179564496 CAGGAAGGGAATGACAGTCTGGG + Intronic
918497718 1:185157901-185157923 CAAGTAGGCACTAAGAGTGAAGG - Intronic
919850098 1:201666753-201666775 CAGGAGGGAGCTGAGAGTGAGGG - Intronic
920645955 1:207804551-207804573 CAGGACGCCACTGCCACTGAGGG + Intergenic
920900686 1:210107226-210107248 CCTGAAGGGACTGACATTGAAGG + Intronic
921047805 1:211489987-211490009 AAGGAAGGCTCTGAGAGTGTGGG - Intronic
921837851 1:219795992-219796014 CAGGAAGTGACTGTCAGTCAAGG + Intronic
921906256 1:220498282-220498304 CTGGAAGGCAATACCAGTGAGGG + Intergenic
922860396 1:228811330-228811352 CAAGCAGGCACTGAGAGAGAAGG - Intergenic
922872895 1:228917463-228917485 GAGGAAGTGACTGACAGTGAGGG + Intergenic
922890172 1:229055757-229055779 CAGGCAGGCACTGAAAATGAAGG + Intergenic
923086342 1:230706031-230706053 CAGGCAGGCGCTCTCAGTGAAGG + Exonic
923223502 1:231917593-231917615 CAGGAAGGAACTGTCAGTCCTGG - Intronic
923528681 1:234794917-234794939 CAGGATGGCACTGATGATGATGG + Intergenic
924497704 1:244606340-244606362 CAGGAAGGCCCACACAGGGAGGG - Intronic
1063299673 10:4840378-4840400 AACTAAGGCAGTGACAGTGATGG - Intronic
1065268199 10:23999367-23999389 CAAGTAGGCACTGACAATTAAGG + Intronic
1065694470 10:28367165-28367187 CAGATAGGCTCTGACAGTGGGGG - Intergenic
1066620404 10:37343755-37343777 CATGAAGAGACTGACAGTGAAGG + Intronic
1067507976 10:46872704-46872726 TAGGAAGGCACTGTCATTCATGG - Intergenic
1067654275 10:48179141-48179163 TAGGAAGGCACTGTCATTCATGG + Intronic
1067936897 10:50620646-50620668 GAGGAAGGAACAGACAGTGATGG + Intronic
1068380223 10:56244260-56244282 CAGAAAGCCACTGCCAGTCAGGG - Intergenic
1069102152 10:64335348-64335370 CAAGAAGTCACTTAAAGTGATGG + Intergenic
1069823604 10:71242165-71242187 CAGGAAGGGAGTCACAGGGAGGG - Intronic
1070546851 10:77459121-77459143 AGGGAAGGCACTGACAGTAGGGG + Intronic
1071965421 10:90846927-90846949 CAGGAAGGCATTCTGAGTGAGGG - Intronic
1072061806 10:91820318-91820340 CAGGAAGGAACTCTCAGTGATGG + Intronic
1072829238 10:98639818-98639840 TATCAAGGCACTGAGAGTGAAGG - Intronic
1073432875 10:103497998-103498020 GGGAAAGGCACTGACAGTAAAGG + Intronic
1073484738 10:103809598-103809620 AAGGCAGGCACTGAGTGTGATGG - Intronic
1074323184 10:112422382-112422404 CAGGAAGCCCTGGACAGTGATGG + Exonic
1076449169 10:130544396-130544418 CAGGGAAGCAGTGGCAGTGAGGG + Intergenic
1076788382 10:132763091-132763113 CAGGAAGGCACTGGCAGGAGGGG - Intronic
1077289308 11:1781602-1781624 CAGGAGGGCACTGCCTGTGTGGG - Intergenic
1077502816 11:2916972-2916994 CAGGAAGGCCCAGACAGGGAAGG + Intronic
1077737739 11:4808895-4808917 AAGGGAATCACTGACAGTGACGG - Intronic
1078706155 11:13746181-13746203 CTGGAAGGAGCTGACATTGAAGG + Intergenic
1078850856 11:15162059-15162081 CAGGAAGACTCTCTCAGTGAGGG - Intronic
1079348804 11:19675504-19675526 CAGGAGCTCACAGACAGTGAAGG - Intronic
1079509427 11:21194056-21194078 TATGAAGGAAATGACAGTGATGG + Intronic
1080223454 11:29934058-29934080 CGAGGAGGCACTGAGAGTGAGGG - Intergenic
1080832185 11:35905375-35905397 CAGGCAGGCAGCGACAGTGAGGG + Intergenic
1081362647 11:42199302-42199324 CTTGAAGGAACTGACAGTGAAGG + Intergenic
1083062041 11:59883842-59883864 CAGCAAGAGACTGACAGTCATGG - Intergenic
1083373466 11:62200838-62200860 CAGTGAGGCACATACAGTGATGG + Intergenic
1083381821 11:62275372-62275394 GAGGAAGGCTTTGAGAGTGAGGG + Intergenic
1083680174 11:64348175-64348197 CAGGTAGGCAGTGAAGGTGAGGG + Intronic
1084205143 11:67586746-67586768 CAGGAAGCCACTGACTGTGCTGG - Intergenic
1084475861 11:69388988-69389010 CAGGAAGGCACTTCCACTGTGGG + Intergenic
1084607802 11:70182608-70182630 CTGGAAGTCACTGACGTTGAAGG - Exonic
1084709124 11:70833125-70833147 CAGGAAGGCACTGATGCAGAAGG + Intronic
1084714980 11:70867944-70867966 GAGGGAGGCACAGTCAGTGATGG - Intronic
1084982995 11:72842230-72842252 CAAGGAGGCTCTGACAGTGAGGG + Intronic
1085644498 11:78214303-78214325 CAGAAAGGTACAGACAGTGCAGG - Exonic
1087971119 11:104485450-104485472 CAGGATGGCTCTTACAGAGATGG + Intergenic
1088771749 11:113042592-113042614 CAGGCAGGCACTGGAAGTGTGGG - Intronic
1088772109 11:113045266-113045288 CAGGAAGGCCATGACGGTGGAGG - Intronic
1089730327 11:120515022-120515044 TTGGAAGGCACTGCCACTGACGG - Intronic
1090148332 11:124352914-124352936 CAGGAAGGCTTTGAAGGTGATGG - Intergenic
1090439866 11:126716524-126716546 CAGGAAGGGACTGACTTTTATGG + Intronic
1091393937 12:142220-142242 CAGCAAGGGACTGCCAGAGAGGG + Intronic
1092237902 12:6821528-6821550 AAGGAAGGCGCTGAGAGGGAGGG - Exonic
1092298075 12:7217899-7217921 CAGCCAGGGACTGACTGTGAAGG - Intronic
1092561910 12:9624264-9624286 AAGGAAGGCAGAGAAAGTGAGGG - Intergenic
1092695423 12:11166319-11166341 CAGAAAGGATCTGCCAGTGAAGG - Intronic
1092757616 12:11778264-11778286 CAGGAAGGCGCTGTCATTCACGG - Intronic
1093441637 12:19204281-19204303 CAGCAAGTCACTGACAGAGTGGG - Intronic
1093585647 12:20832539-20832561 CAGAAAGGGAGTGACAATGAAGG - Intronic
1093863553 12:24197609-24197631 CAGGAAGGCCAAGACAGTCAGGG - Intergenic
1095307350 12:40653652-40653674 CAGGGAGGCTTTGCCAGTGAAGG - Intergenic
1095583562 12:43826884-43826906 CTGGAATGCAGTGACTGTGAAGG + Intergenic
1096162174 12:49387763-49387785 CAGGCAGGCACTGGAGGTGAGGG + Intronic
1096867908 12:54576135-54576157 CAGGAAGGCAGTGGTAGGGAGGG + Intronic
1097019752 12:56011970-56011992 CAGGAAGGCATAGACAGTAGAGG + Intronic
1097125380 12:56770402-56770424 CGGGAAGACTCAGACAGTGAAGG - Intronic
1097507146 12:60488194-60488216 CAGGAAGGGTTTGAAAGTGAGGG - Intergenic
1100821647 12:98437203-98437225 CACGAAGACACTGCCAGTGGTGG - Intergenic
1101952608 12:109188322-109188344 CAGGAAGGCAATGGAAGGGAAGG - Intronic
1102220928 12:111193902-111193924 CAGGATGGAGCAGACAGTGAAGG + Intronic
1102937997 12:116913588-116913610 CATGAAGGCAATGAGAATGATGG - Intronic
1103195787 12:119042689-119042711 GAGGAAGGAACTGAGAGTGGTGG + Intronic
1103398699 12:120627178-120627200 CAGGAAGCCACTGAAATTGGGGG + Intergenic
1103840587 12:123860845-123860867 GAAGAAAGCACTAACAGTGAAGG + Intronic
1103851906 12:123938849-123938871 CAGAAAGGCACAGTCAGGGAGGG - Intronic
1105296030 13:19088653-19088675 CAGGAAGCAACTGGCACTGAAGG - Intergenic
1106099512 13:26682294-26682316 CAGGACGGCAGCGCCAGTGAAGG - Intronic
1106436435 13:29727349-29727371 GAGGAAGGCAAAGGCAGTGAGGG + Intergenic
1106775636 13:33006280-33006302 CAGGCAGGCACTGAAGGTGTGGG + Intergenic
1106801065 13:33256276-33256298 CAGGAAGGCCGAGCCAGTGAGGG - Intronic
1107878922 13:44816141-44816163 AAGGTAGGCACTGTCAGTAAAGG + Intergenic
1108304296 13:49115666-49115688 AATGAAGGCACTGAGACTGAAGG - Intronic
1109117703 13:58409755-58409777 CAGGACTTCACTGACACTGAGGG - Intergenic
1109903496 13:68806671-68806693 CAGGAAGACAATGACAAGGATGG + Intergenic
1110067085 13:71122115-71122137 CAAGAAAGGACTGACTGTGAAGG + Intergenic
1110456182 13:75692763-75692785 CAGGAAGACATTGACTGAGAAGG - Intronic
1110837523 13:80101584-80101606 GAGGAAGGGACTGAAAGTCAAGG - Intergenic
1110988525 13:82007024-82007046 CAAGGTGGCAGTGACAGTGACGG + Intergenic
1111055451 13:82943544-82943566 CTGCAAGGCTCTGACAGGGAAGG - Intergenic
1113543107 13:111124094-111124116 CAGGAAGGGACTGACTGAAAGGG - Intronic
1114220035 14:20688253-20688275 CAGGAAAGCACTTCCAGAGAAGG - Intronic
1114635864 14:24186443-24186465 CAGTAAGGCCTTGACAGAGAAGG + Exonic
1115036009 14:28857637-28857659 CAGGAAGACACAGACAGTGGTGG - Intergenic
1115110941 14:29820985-29821007 CTGGAAGTCATTAACAGTGATGG + Intronic
1115873582 14:37835132-37835154 CACATAGGCACTGGCAGTGAGGG + Intronic
1118382153 14:65226225-65226247 CAGGAAAGGCCTGGCAGTGAGGG - Intergenic
1119425709 14:74533559-74533581 GAGGAAGGCACTGAAGGGGAAGG + Intronic
1119732309 14:76958676-76958698 CAGGAAAACCCTGACAGTGGAGG - Intergenic
1121588107 14:95077843-95077865 CAGGAGAGCACGGACAGTTAGGG + Intergenic
1122005876 14:98703241-98703263 CTGGAAGTCACTGACAGCAAGGG - Intergenic
1125782195 15:42279635-42279657 CAGGCAGGATCTGAAAGTGAAGG - Intronic
1128222586 15:65979639-65979661 GAGGCAGGCACTGACAGGCAGGG + Intronic
1129114199 15:73356096-73356118 CAGGAAGGCACTGCCAGCAGCGG + Intronic
1129599357 15:76989282-76989304 CAGGAAGGCTCAGTCAGTGCTGG + Intergenic
1130168485 15:81486832-81486854 CAGGAAGGCACTGGGAGCAATGG + Intergenic
1132558524 16:583244-583266 AAGGCAGGCAGTGCCAGTGATGG - Exonic
1133031548 16:3013607-3013629 CAGGAGGGCAATGACACAGAGGG - Exonic
1135167092 16:20148656-20148678 CAAGAAGGCACTGAGATTGGAGG - Intergenic
1135889270 16:26342638-26342660 CAGGTAGGGACTGACAGTCTAGG - Intergenic
1135892521 16:26370458-26370480 CAAGAGGGCACTTACTGTGATGG - Intergenic
1135915446 16:26601593-26601615 CAGGAAGCCACTGCCTGTCATGG - Intergenic
1135976804 16:27113763-27113785 CAGGAAGGCCCTGTTAGTTAGGG - Intergenic
1139596734 16:67962456-67962478 CAGAAAGGAGCTGACAGAGAGGG - Intronic
1141445360 16:84054584-84054606 CAGGAAGGCAAAGACAGGAATGG + Exonic
1141505866 16:84478019-84478041 CACCAAGGCACAGACACTGACGG + Exonic
1143449884 17:7029781-7029803 CAGGAAGGCAAGGGCAGGGAAGG - Intronic
1144075615 17:11716787-11716809 CAGAAAGGCAATGAGAGGGAAGG + Intronic
1144752976 17:17662828-17662850 GAGGAGGGCACAGAGAGTGATGG - Intergenic
1147424398 17:40339139-40339161 CAGCAAGGCTGTGATAGTGAGGG + Intronic
1147940081 17:44040229-44040251 CAGCAAAGCACGGACAGAGAAGG - Exonic
1149979130 17:61295526-61295548 CAGGAAGGCACTGTCACTCTTGG - Intronic
1151679302 17:75615204-75615226 CAGGCAGGGACTGACAGGGAGGG + Intergenic
1153386038 18:4497968-4497990 CATGAAGGCAAAGAGAGTGATGG - Intergenic
1154489577 18:14909299-14909321 GGGGAAGGCAGTGACAATGAGGG + Intergenic
1155372777 18:25120882-25120904 CAGTAAGACACTGGCAGTGGGGG + Intronic
1155990178 18:32272038-32272060 CAGAAAGGAATTGAAAGTGAAGG - Intronic
1156382866 18:36579731-36579753 GATCAAGGCACTGACTGTGAGGG - Intronic
1157220803 18:45827380-45827402 TTGGTAGGCACTGACAGGGAAGG + Intronic
1157423065 18:47562093-47562115 TAGGAAGACACTCACAGAGAAGG - Intergenic
1157684077 18:49628984-49629006 CAAGAATGCACTGAGAGTGACGG + Intergenic
1158332595 18:56379369-56379391 CAGAAGGGCACTGACAGAGCAGG + Intergenic
1159948446 18:74460945-74460967 GTGGAAGGGACAGACAGTGACGG - Intergenic
1160236211 18:77088254-77088276 CTGGAAGGCACTGTCCCTGAGGG - Intronic
1160339273 18:78073093-78073115 CAGAAATGCATTGAGAGTGAAGG + Intergenic
1160377160 18:78421778-78421800 CAGGAGGACTCTGACAGTGCTGG + Intergenic
1161377817 19:3949267-3949289 CAGGAAGGGACTGAGAGTCCAGG + Intergenic
1164814629 19:31185811-31185833 AAGGCAGGCACTGACTGGGAAGG - Intergenic
1165863593 19:38922369-38922391 CAGCTAGGCACTGACAGAGCAGG - Intronic
1166675576 19:44738796-44738818 AAGGAAGGCACTGACATGGTGGG - Intergenic
1166749023 19:45155992-45156014 CAGGAAGGGGCTGATAGTGGGGG - Intronic
1166772163 19:45290391-45290413 CTGTCAGGCACTGCCAGTGAAGG - Intronic
1167281661 19:48572779-48572801 CAGGAATGCAGGGACAGAGAAGG + Intronic
1167594378 19:50419425-50419447 GATGGAGGCACTGAGAGTGAGGG - Intronic
1167860019 19:52275181-52275203 CTGGAAGACAGTGACACTGATGG + Intronic
1167868452 19:52347205-52347227 CTGGAAGACAGTGACATTGATGG + Intronic
1168271949 19:55254878-55254900 CAGGGATGCAGTGACAGTAATGG + Intronic
1168538805 19:57193238-57193260 CATGAAGTCATTGACTGTGAAGG + Intronic
925898253 2:8489473-8489495 AAGGAGGGCACTAACAGAGAAGG + Intergenic
926692945 2:15749762-15749784 CAGGAAGGAACTGAAAGAGGAGG + Intergenic
927516019 2:23672114-23672136 AAGGAATGCAAAGACAGTGATGG - Intronic
927869941 2:26616972-26616994 CAGGCAAGCACTGCCTGTGAGGG + Intronic
927923390 2:26991380-26991402 CAGGAAGGAAGTGATAGTGGTGG + Intronic
928678907 2:33679289-33679311 CAGGGAGGCACTGAGATTCAGGG - Intergenic
928987272 2:37193884-37193906 CAGGAAGGCACTGTCGCTAAAGG + Intronic
930224891 2:48782069-48782091 CAGCAAGCTACTGACAGAGATGG + Intergenic
930307617 2:49694942-49694964 CAAAAAGACACTCACAGTGAGGG + Intergenic
931011383 2:57918563-57918585 CAGGAAGGTACTGACCATGATGG + Intronic
932161741 2:69466338-69466360 GAGGAAGGGACTGACCTTGAAGG - Intronic
932163374 2:69483212-69483234 GAGGAAGGCACTGACTGTAAAGG - Intronic
936039597 2:109140140-109140162 CAGAAAAGAAGTGACAGTGATGG - Intronic
936276221 2:111100053-111100075 CAGGCAGGCACTGGCAGAGCAGG - Intronic
936858896 2:116992697-116992719 TAGGAATGCACTCACTGTGAAGG + Intergenic
937122915 2:119453074-119453096 CAGGAAGGCCAGGACAGTGCAGG + Intronic
937432557 2:121851652-121851674 CAGGAATGCACTTGCAGAGATGG - Intergenic
937472790 2:122188362-122188384 CAGGGAGGTATTGACGGTGAGGG + Intergenic
941062137 2:160859208-160859230 CAGGAAGTCACTGACAGTGGGGG - Intergenic
943948902 2:194103890-194103912 CAAGATGGCACTGACAGTTTTGG + Intergenic
945068252 2:205965353-205965375 CAGGAAGGCACAAACAGGGAAGG + Intergenic
945908711 2:215622418-215622440 GAGGAAAGCACAGGCAGTGATGG - Intergenic
945930486 2:215850046-215850068 CAGGAAGGAAATGAAAATGAAGG - Intergenic
946188505 2:217995043-217995065 AATGAAGGGACTGAAAGTGATGG + Intronic
947824138 2:233092823-233092845 GTGGGAGCCACTGACAGTGATGG - Intronic
948086635 2:235255991-235256013 ATGGAAGGTACTGACAGTTATGG - Intergenic
1171084901 20:22229266-22229288 CAAGTAGGCTCTGACAGAGAAGG - Intergenic
1171105674 20:22430332-22430354 CAAGTAGCCACCGACAGTGATGG + Intergenic
1171205400 20:23275154-23275176 CAAAAAGGCAAAGACAGTGAAGG + Intergenic
1171462925 20:25308989-25309011 CAGAAAGGGAATGGCAGTGAAGG + Intronic
1172809128 20:37634420-37634442 CAGGATGCCACAGTCAGTGAGGG + Intergenic
1173448266 20:43139341-43139363 CAAGAAGCCACAGAGAGTGAAGG - Intronic
1174046342 20:47736657-47736679 CAGGAAGGGAGTGACAGCCAGGG - Intronic
1174580284 20:51566519-51566541 CAGGAAGGGGTTGACAGTCAAGG - Intergenic
1175293078 20:57891211-57891233 CAGGAGGCCACTGACAATGCTGG - Intergenic
1175392122 20:58634121-58634143 CAGAGAGGGAGTGACAGTGACGG + Intergenic
1177604813 21:23364161-23364183 CAGGAATACTCTCACAGTGATGG - Intergenic
1178834213 21:36082875-36082897 CAGTAAGCCAGTGCCAGTGAAGG + Intergenic
1179317796 21:40260360-40260382 CAGGAAGGCAGAGACAGGGCTGG - Intronic
1179383181 21:40918512-40918534 CAGGATGCCACTGCCATTGAGGG - Intergenic
1180073428 21:45450052-45450074 CAGGCAGGCACAGCCAGTCAAGG - Intronic
1180836262 22:18931046-18931068 CAGGATGGCGCTGACACCGAAGG + Exonic
1183865077 22:40697972-40697994 GAGGAAGGCAGAGACTGTGAGGG + Intergenic
1184258704 22:43302186-43302208 CAGGCTGGCAATGACTGTGAGGG - Intronic
1203286354 22_KI270734v1_random:156345-156367 CAGGATGGCGCTGACACCGAAGG + Intergenic
949508964 3:4752054-4752076 CAAGATGGCTCTGACACTGAAGG + Intronic
950547354 3:13646375-13646397 CAGGAAGGCCCTGGCAGGGGAGG - Intergenic
952522629 3:34176832-34176854 CAGAAAGGCTCTGACAGGCAGGG - Intergenic
952787483 3:37169974-37169996 AAGGAAGGCAGAGACAGAGAAGG + Intronic
953405311 3:42656899-42656921 CAGGGAGGCACTGACAGCTATGG + Intronic
953535688 3:43775052-43775074 CAGGAAAGCACAGTCAGTGGAGG + Intergenic
954292095 3:49655127-49655149 CAGGAAGCCACACACAGTGGTGG + Exonic
954305060 3:49721306-49721328 CAGGATGGCACAGGCTGTGAGGG - Exonic
954327615 3:49872127-49872149 CAGGAAGGCACAGGCAGGGTAGG + Intergenic
954708955 3:52495553-52495575 CAGGGAGGGACTGACATGGAGGG + Intronic
955474164 3:59318588-59318610 CAGGAAGCAGATGACAGTGATGG + Intergenic
956625034 3:71258614-71258636 CAGGAAGGCAAGGACAGGAAGGG + Intronic
958914340 3:100031704-100031726 CAAGAAGGCAAAGACAGGGAGGG + Intronic
961370027 3:126423350-126423372 CAGGAGGACACCGACAGCGATGG + Exonic
962274255 3:134000247-134000269 CAGGGAGGCACTGGGAGTGTGGG + Intronic
964414467 3:156432914-156432936 CTGGAAGGCACTGAAAAGGAGGG - Intronic
966313393 3:178618961-178618983 CAGGAACACACAGCCAGTGATGG + Intronic
967095520 3:186174407-186174429 GAGGAAGGCAATGAAAGGGAGGG + Intronic
967220056 3:187241258-187241280 CAGGAGGGCTCTCAGAGTGATGG + Intronic
968138809 3:196239083-196239105 CAGGAAGGATCTGTCTGTGAAGG - Intronic
968526140 4:1058485-1058507 CAGGGAGGCAGTGACAGCTACGG - Intronic
969513383 4:7632463-7632485 GAGGAAGGTGCTGACAGGGAAGG - Intronic
970034875 4:11722146-11722168 CAGGAAGGCGCAGATACTGACGG - Intergenic
976073043 4:81263694-81263716 CAAGAAGACAGTGACAGAGACGG - Intergenic
978831157 4:113086679-113086701 CAGAAAGGGACAGAGAGTGATGG + Intronic
979455378 4:120921760-120921782 CAGGAAGGGCCTGAAAGTGTTGG - Intronic
980152459 4:129063736-129063758 CAGGGAGGGACTCACAGTCAGGG - Intronic
980536028 4:134124868-134124890 CAGGCAGGTACTGATAGTGAAGG + Intergenic
980899578 4:138891904-138891926 CAGGCTGGCTCTGACAGTGAGGG - Intergenic
981450221 4:144888428-144888450 CACAGAGGTACTGACAGTGATGG + Intergenic
982105965 4:152012411-152012433 CAGGAAGACCCTGTCAGGGAAGG + Intergenic
982483908 4:155944543-155944565 CAGGAAGGCACTGAAAATGTAGG + Intronic
982886231 4:160786278-160786300 CAGGAGGGCAATGACAGCTAGGG - Intergenic
985330192 4:188823523-188823545 CAGGAAAGCACAGACAGAAAAGG + Intergenic
985330205 4:188823624-188823646 CAGGAAAGCACAGACAGAAAAGG + Intergenic
985330217 4:188823733-188823755 CAGGAAAGCACAGACAGAAAAGG + Intergenic
985760096 5:1744486-1744508 CTGGAAGCCGCTGACAGTGGAGG + Intergenic
985892645 5:2727684-2727706 CATGAAGGCACTGACAGCCGGGG - Intergenic
986568298 5:9137649-9137671 CAGGATAGTACTTACAGTGAGGG + Intronic
986758230 5:10857276-10857298 GAGGAAGGCACACACAGGGACGG - Intergenic
988710910 5:33773858-33773880 CAAGAAGCCACTGACTGTCAGGG + Intronic
989088719 5:37705840-37705862 GACTAAGGCACAGACAGTGATGG + Intronic
990492892 5:56319610-56319632 CAGGCAGGCCCTGACAGTCCCGG + Intergenic
996699697 5:126437935-126437957 AAGCCAGGCACTGACAGTGAGGG - Intronic
996803274 5:127427188-127427210 CAGGCAGGCAGTGGCAGTTACGG + Intronic
997187827 5:131900284-131900306 AGGGAAGGCATTGAGAGTGAAGG + Intronic
998370253 5:141656153-141656175 CAGGAAGGCCCTGGAAGTGCGGG + Intronic
999649697 5:153753516-153753538 CAGTAAGGCAATGACAGAGCTGG - Intronic
999786137 5:154892372-154892394 CAGGAAGTCACTTACCGTCAGGG + Exonic
1003577686 6:7312987-7313009 CAGGAAGGAGATGCCAGTGATGG - Intronic
1004062027 6:12206882-12206904 CAGCAAGTCACTTACAATGAAGG + Intergenic
1005855168 6:29855435-29855457 CAGGAAGTCAGTTACTGTGAAGG - Intergenic
1006346999 6:33490757-33490779 CAGGCATGCAGAGACAGTGAGGG - Intergenic
1006441659 6:34057154-34057176 CAGGCAGCCTCTGTCAGTGATGG - Intronic
1007476765 6:42124403-42124425 CTGTAGGGCACTGACAGGGAGGG + Intronic
1007513829 6:42395445-42395467 CAGGAAGGCTTTGGCAATGAAGG + Intronic
1008237303 6:49065724-49065746 CAAGAATGCACTGGCACTGATGG + Intergenic
1013393900 6:109714328-109714350 AGGGAAGGCACTGAGAGTGGTGG - Intronic
1013445559 6:110222606-110222628 CAGGAAGGCTCTCATAGTAAGGG - Intronic
1013456658 6:110335833-110335855 CAGGTAGGAGGTGACAGTGATGG + Intronic
1014955600 6:127611527-127611549 CCGGAAGGCATTGCCAGAGAGGG + Intergenic
1017064686 6:150518177-150518199 CAGGAAGGCACTGATTCTAAGGG + Intergenic
1017993404 6:159509914-159509936 CATGGAGGCACTGAAAGGGAAGG - Intergenic
1019377242 7:699375-699397 CAGGAAGGCACTGACGGTTAGGG + Intronic
1020979951 7:15054514-15054536 GAGGAAGGGGCTGCCAGTGAAGG - Intergenic
1022434485 7:30368414-30368436 TAGGAAGTCACTGATAGAGATGG - Intronic
1022537965 7:31109703-31109725 CAGGGAGGCAGTGTCAGGGAGGG + Exonic
1023006655 7:35877327-35877349 CAGAAAGACAGAGACAGTGAGGG - Intronic
1023152419 7:37214531-37214553 CAGCATGGCACTGACAGCTATGG - Intronic
1023465997 7:40455882-40455904 CAGTAATGCACTTAAAGTGATGG + Intronic
1023688283 7:42759852-42759874 CAGGAACCCACTGACCGTGGAGG - Intergenic
1023873033 7:44272913-44272935 CAGCATGGCAGTGACAGGGAAGG - Intronic
1024067555 7:45753649-45753671 CAGAAAGACAGAGACAGTGAGGG + Intergenic
1028595184 7:92540784-92540806 GAGGAAGGCACTGGGAGTTATGG + Intergenic
1028916171 7:96261807-96261829 GATCAAGGCACTGACATTGAGGG + Intronic
1030505578 7:110417686-110417708 CAGGAAGGCACGAAGAGAGAAGG - Intergenic
1030807792 7:113937712-113937734 AGGGAAGGCACTGAGAGTGCAGG - Intronic
1031380664 7:121082032-121082054 AAGGAAGGAATTTACAGTGATGG + Intronic
1031972566 7:128075039-128075061 CCTGAGGGCACTGACAGAGAAGG - Intronic
1032150761 7:129427530-129427552 AAAGAAGGCAGTGATAGTGATGG - Exonic
1032742211 7:134750167-134750189 CAGGAAGGCACTGCCATTGCTGG + Intronic
1035083371 7:156235926-156235948 GAGGAAGGAAGTGAAAGTGATGG + Intergenic
1038119622 8:24598281-24598303 CAGGAAATCAGTGACAGTGAGGG + Intergenic
1039238144 8:35525478-35525500 CAGCAAAGCACGGACAGAGAAGG - Intronic
1039892675 8:41695535-41695557 CAGGCCTGCAGTGACAGTGAGGG + Intronic
1040107199 8:43547722-43547744 CAGGAAGGCACTGGCATCCAGGG + Intergenic
1040107871 8:43550350-43550372 CAGGAAGGCACTGGCATCCAGGG + Intergenic
1040389488 8:46937613-46937635 CCTGAAGGGACTGAAAGTGAGGG - Intergenic
1042197140 8:66240652-66240674 GATGAAGGCACTGAAAGTTAAGG - Intergenic
1043997354 8:86834752-86834774 CTGGAAGACAGTGACACTGATGG - Intergenic
1044583354 8:93844506-93844528 CGCCAAGGCAGTGACAGTGAGGG + Intergenic
1044782865 8:95761534-95761556 TAGGAAGGAACTGTCACTGAAGG - Intergenic
1044884303 8:96760233-96760255 CAGAAAGGCAGAGAAAGTGAAGG + Intronic
1045584497 8:103517665-103517687 CAGGTAGGCACTGACACTACAGG - Intronic
1045745286 8:105411752-105411774 CAGGAAGTTAGTGACAGAGATGG - Intronic
1045976411 8:108134553-108134575 CAGGAAGGGACTGACAGACAAGG - Intergenic
1046594172 8:116240828-116240850 TTGGAAGGCATTGGCAGTGATGG + Intergenic
1046617707 8:116495846-116495868 CAGGAAGGTACTGATATTCAAGG - Intergenic
1047751411 8:127883459-127883481 CAAGAAGGAAATGACAGTGGGGG + Intergenic
1048557513 8:135494873-135494895 GAGGAAGGCATTGATTGTGAGGG + Intronic
1049437608 8:142594982-142595004 CAGGAAGGGATTGACAGAAATGG - Intergenic
1050550945 9:6747825-6747847 CAGTAAGGCAGTGATAGGGACGG - Intronic
1050728415 9:8678492-8678514 CTGGAATGCCCTGAAAGTGAAGG - Intronic
1051174232 9:14347302-14347324 CCCGAAGGCACTGACTGTGCAGG - Intronic
1051419717 9:16877306-16877328 CAGCAAGCCCCGGACAGTGAGGG - Intergenic
1053451729 9:38199266-38199288 CAGGTAGGCAAAGACAGTCATGG - Intergenic
1053556120 9:39138677-39138699 CAGGAAGACCCAGACAGAGAAGG - Intronic
1053820238 9:41958927-41958949 CAGGAAGACCCAGACAGAGAAGG - Intronic
1054110514 9:61102616-61102638 CAGGAAGACCCAGACAGAGAAGG - Intergenic
1054610343 9:67228509-67228531 CAGGAAGACCCAGACAGAGAAGG + Intergenic
1055016953 9:71629041-71629063 CAGGAAGGGCCACACAGTGACGG - Intergenic
1055110118 9:72551070-72551092 GAGGAAGGGGCTGAGAGTGAAGG + Intronic
1055645280 9:78357062-78357084 CAGGGAGGCACAGGCAGTGACGG + Intergenic
1056464199 9:86837978-86838000 CAGGCAGGCACTGAGAGTTTAGG - Intergenic
1056591336 9:87968221-87968243 CAGGAGGGCCCTGGCAGAGAAGG + Intronic
1056867342 9:90240461-90240483 CAGGAAGGCTCTCACAGCCATGG - Intergenic
1056923066 9:90809089-90809111 CGTGAAGGAACTCACAGTGAGGG + Intronic
1057167806 9:92942190-92942212 CAGTGAGGCCCTGACAGGGAGGG + Intergenic
1057211834 9:93204758-93204780 CAGGGAGGCTCAGAAAGTGAGGG + Intronic
1057345191 9:94244135-94244157 CTGGAACCCACTGACACTGAGGG - Intergenic
1060848443 9:126855990-126856012 CAAGAAAGCACTTACAGTGAGGG + Intergenic
1061037310 9:128120906-128120928 CAGGGAGGCAGGGACAGGGAGGG + Exonic
1061716305 9:132520686-132520708 GGGGAAGGCACTGACTGAGAAGG - Intronic
1062721183 9:138044997-138045019 CAGGAAGGCACTGGCATTCTGGG + Intronic
1186516142 X:10167225-10167247 CAGGAAGGCACTGACAGTGACGG - Intronic
1188020818 X:25155305-25155327 CAGAAAAGCAATGACAGGGAGGG + Intergenic
1188654471 X:32674125-32674147 CAGGAAGGCTCTGAAAGTGCAGG + Intronic
1188809790 X:34639323-34639345 CAGGAATGCAATGAGAATGATGG + Exonic
1189718714 X:43892662-43892684 CAGGCAGGCTCAAACAGTGAGGG + Intergenic
1190378828 X:49818179-49818201 CCAGGAGGCACTGACAGGGAAGG + Intergenic
1190973780 X:55379486-55379508 CAGGCAGGGTCTGCCAGTGAAGG - Intergenic
1193979984 X:88169757-88169779 AAAGAAGGCATTGACAGTGTAGG - Intergenic
1194263734 X:91730820-91730842 CAGAATGGCACTGAAAGAGATGG - Intergenic
1194489639 X:94530539-94530561 CAGGCAGCCACAGACAGTGCTGG - Intergenic
1195036551 X:100975364-100975386 AAGGAGGGCACTGATAGGGAAGG - Intronic
1196143830 X:112295497-112295519 CAGGCAGGCACCTGCAGTGAGGG - Intergenic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic
1197761504 X:130031260-130031282 CAGGAAGGCACTAGCTATGAGGG - Intronic
1198136632 X:133758076-133758098 CAGGAAGGCATTTACACTGTTGG + Intronic
1198150480 X:133903688-133903710 CAGCAAGCCACTGGCAGAGAAGG + Intronic
1198209666 X:134505377-134505399 CAGGAAGACCCAGACAGAGAAGG - Intronic
1198782123 X:140249016-140249038 CATGAAGCCTCTGACAGTGCAGG - Intergenic
1198937729 X:141916487-141916509 CATGCTGCCACTGACAGTGAAGG - Intergenic
1199556504 X:149114406-149114428 CGAGGAGGCGCTGACAGTGAGGG + Intergenic
1201146176 Y:11066733-11066755 AAGGGAGGCACTGAGAGGGAAGG + Intergenic
1201712430 Y:17007424-17007446 CAGTAATGCACTGTGAGTGATGG - Intergenic
1201763935 Y:17562931-17562953 CAGGAAGGCACTGTCATCCATGG + Intergenic
1201837618 Y:18343059-18343081 CAGGAAGGCACTGTCATCCATGG - Intergenic