ID: 1186516759

View in Genome Browser
Species Human (GRCh38)
Location X:10172022-10172044
Sequence GTTCCCACCATTCCCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 2, 2: 3, 3: 19, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186516759_1186516764 13 Left 1186516759 X:10172022-10172044 CCAGCTCTGGGAATGGTGGGAAC 0: 1
1: 2
2: 3
3: 19
4: 202
Right 1186516764 X:10172058-10172080 AAATTCCCAGATGCCAGCCAAGG 0: 4
1: 22
2: 60
3: 156
4: 405
1186516759_1186516765 14 Left 1186516759 X:10172022-10172044 CCAGCTCTGGGAATGGTGGGAAC 0: 1
1: 2
2: 3
3: 19
4: 202
Right 1186516765 X:10172059-10172081 AATTCCCAGATGCCAGCCAAGGG 0: 4
1: 25
2: 67
3: 128
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186516759 Original CRISPR GTTCCCACCATTCCCAGAGC TGG (reversed) Intronic
900926089 1:5707009-5707031 GTGCCCACCGTACCCTGAGCTGG - Intergenic
901101546 1:6722953-6722975 GTTCCTACCACTCCAAGACCTGG - Intergenic
901701374 1:11046444-11046466 TTCCCCACCTTTCCCAGGGCAGG - Intronic
902985198 1:20150447-20150469 GAACCCACCTTCCCCAGAGCTGG - Intergenic
903127460 1:21257655-21257677 GTGCCAGCCATTCCCAGGGCAGG - Intronic
903514531 1:23901774-23901796 GTACTCAGCCTTCCCAGAGCTGG + Intronic
904206019 1:28855676-28855698 GATCCTTCCATTCCCAGAGGGGG - Intronic
904815233 1:33191401-33191423 GTTCCTTCCCTTCCCAAAGCAGG + Intergenic
905284944 1:36873174-36873196 GTTCCCACCACCCCCAGCACAGG + Intronic
906501380 1:46343543-46343565 GTTCCCACCAAAGCCAAAGCCGG + Intronic
907300573 1:53484128-53484150 GTTCCCACCACTGCCAGCCCTGG - Intergenic
907940097 1:59079302-59079324 GTTTCTACCATGCCCAGAGGAGG - Intergenic
908073431 1:60489154-60489176 CTTCCCTGCATTCCCAGAGTTGG - Intergenic
908120721 1:60983690-60983712 GTTCAAACAATCCCCAGAGCCGG + Intronic
909378451 1:74968130-74968152 ATTCCCACCATTCCAGGAGGTGG + Intergenic
910120393 1:83782126-83782148 GTTCCAACCATTCCTAGGACTGG - Intergenic
910321163 1:85946010-85946032 GTTCCCAGCATTTCCAAAACTGG + Intronic
910896480 1:92075332-92075354 GTCTCCTCCAGTCCCAGAGCAGG + Exonic
911134365 1:94423385-94423407 GTTCCCACCATTTACAGAGGGGG - Intronic
911676218 1:100661230-100661252 TTTCCCATCATTCCAAGAGATGG + Intergenic
913139748 1:115928892-115928914 GGTCCCACCTTTCCCAGAGTAGG - Intergenic
915156537 1:153881217-153881239 GTTGACTCCATTCACAGAGCAGG + Intronic
918419872 1:184353248-184353270 TTTCCAACCATTCCCACACCTGG - Intergenic
918476166 1:184927747-184927769 GTTCCCCCCAGGCCCTGAGCAGG + Intronic
919947356 1:202329318-202329340 TTTCCCATCCTTCCCTGAGCTGG + Intergenic
919966242 1:202528658-202528680 GTTTCCCCCATCCCCATAGCTGG + Intronic
922687754 1:227659416-227659438 GTTCACACCATGGCCAGAGATGG + Exonic
924572630 1:245251263-245251285 GTTCCTACCATTCCTAGAACTGG - Intronic
1064100333 10:12458225-12458247 GGTCCAAGCTTTCCCAGAGCTGG + Intronic
1067548873 10:47219230-47219252 GTAACCACCATTCCCTGACCAGG + Intergenic
1069625751 10:69866800-69866822 GCTCCTCCCATTCCCAGAGCCGG - Intronic
1072294101 10:93993611-93993633 GTTCCCGCCCTTCCCGGAGCCGG + Intergenic
1072365510 10:94704709-94704731 GTTATCAACATGCCCAGAGCGGG - Intronic
1073084272 10:100878443-100878465 GCTCCCATCCTTCCCAGAGCTGG + Intergenic
1073138239 10:101231227-101231249 CTTCCCAACATTCACAGAACTGG - Intergenic
1073191117 10:101651199-101651221 CTTCCCACCGCTCACAGAGCTGG - Intronic
1074251548 10:111755753-111755775 GATCCCAACATTCCCAGGACTGG + Intergenic
1075789181 10:125071215-125071237 GCTCCTTCCCTTCCCAGAGCAGG - Intronic
1075887455 10:125913706-125913728 CTTGCCCCCAGTCCCAGAGCTGG - Intronic
1076833832 10:133010074-133010096 GTTCCCAGCACTGCCGGAGCTGG - Intergenic
1077031494 11:470068-470090 GATCCCCCCATTCCAGGAGCTGG + Intronic
1077134997 11:994089-994111 GATGCCCCCATTCCCGGAGCGGG + Exonic
1077201572 11:1309957-1309979 GTTCCCTCCCTTCTCCGAGCGGG - Intergenic
1078057369 11:8019148-8019170 GTCCCCGCCATTGGCAGAGCCGG + Intergenic
1078077437 11:8174595-8174617 GTTCTCCCAACTCCCAGAGCAGG + Intergenic
1078650941 11:13191576-13191598 GGTCCTACCATTCTCAGATCTGG + Intergenic
1080041523 11:27764209-27764231 ATTCCCTCCATGTCCAGAGCAGG + Intergenic
1080201857 11:29680953-29680975 CTACCCACTATTCCCATAGCAGG + Intergenic
1080824062 11:35833114-35833136 GGTCCCATCATCCCAAGAGCAGG - Intergenic
1083228955 11:61303012-61303034 CTCCCCACCACTCCCAGAGCTGG + Intronic
1083625830 11:64071541-64071563 TTTCCCACCCTGCCCAGAGTGGG - Intronic
1083731285 11:64653919-64653941 GCTCCAACCCTCCCCAGAGCTGG + Intronic
1084336965 11:68464107-68464129 AATCCCACCATTTCCAGAGGTGG - Intronic
1088579471 11:111300713-111300735 GCACTCACCATTCCCAGACCTGG + Intronic
1090262054 11:125328197-125328219 GATCCCACAATGGCCAGAGCAGG - Intronic
1091986663 12:4915150-4915172 GTCCCCACCATTCTCTGGGCTGG - Exonic
1093658042 12:21720313-21720335 GTTCCCACCATTAGATGAGCAGG - Intronic
1098949435 12:76624266-76624288 GTTCCCACCATTCCCAGAACTGG - Intergenic
1099969773 12:89488901-89488923 TTGCCAACCATACCCAGAGCTGG + Intronic
1102349105 12:112179141-112179163 GTCCCCACCATACCCAGGCCGGG - Intronic
1103963917 12:124626195-124626217 GTCCCCACCCATCCCAGAGGAGG - Intergenic
1105303512 13:19154389-19154411 GTTCCTACCCTTACCAGACCAGG - Intergenic
1105889870 13:24674906-24674928 GCTCCCACGCTTTCCAGAGCTGG - Intergenic
1107025011 13:35792319-35792341 GATGCCACCAATCCCAGATCTGG - Intronic
1107816688 13:44250793-44250815 AATCCCGCCATTCCCAAAGCTGG - Intergenic
1111726600 13:92017529-92017551 GTCCCCACCTTTCTGAGAGCTGG + Intronic
1112698717 13:101979538-101979560 GTCCCCATCATTCCCAAACCTGG + Intronic
1113031076 13:105994380-105994402 GTTCTCACCATTCAGAGACCAGG - Intergenic
1113985249 13:114309776-114309798 GTGCCTGCCATTCCCAGAACAGG + Intergenic
1115745743 14:36435613-36435635 TTTCCCAGCATTCCTAGAGTGGG + Intergenic
1118701647 14:68439336-68439358 GCTACCACCATCCCCAGGGCTGG - Intronic
1119149481 14:72345165-72345187 CTTCCCACCTTTCACAGAGAAGG + Intronic
1120216311 14:81683880-81683902 GTTACCACTATTCCCAGAACTGG - Intergenic
1121238620 14:92412015-92412037 GATCCCGCCATGCCCACAGCGGG - Intronic
1122264863 14:100541797-100541819 GCTCCCAGCTGTCCCAGAGCTGG - Intronic
1122765989 14:104070535-104070557 GTTCCCACCATTCTCTGACATGG - Intergenic
1122993587 14:105250347-105250369 GTACTCAGCCTTCCCAGAGCTGG - Exonic
1202870678 14_GL000225v1_random:160378-160400 CTTGCCCCCAGTCCCAGAGCTGG + Intergenic
1124005792 15:25794517-25794539 GTCCCCTCTATTCCCAGGGCTGG - Intronic
1125531778 15:40418331-40418353 TTTCCCACCCTGCCCACAGCAGG + Exonic
1128075122 15:64821077-64821099 GCCCCCACCAGTCCAAGAGCTGG - Exonic
1128733125 15:70034262-70034284 CTCTGCACCATTCCCAGAGCAGG - Intergenic
1128915012 15:71551901-71551923 GTTCCCATCATTCCCAGAACTGG - Intronic
1129684602 15:77677891-77677913 GCACCCACCATGCCCAGAGGAGG + Intronic
1132685455 16:1160183-1160205 GTCCCCGCCCTTCCCACAGCGGG - Intronic
1138109597 16:54312917-54312939 GCACCCACTATTCTCAGAGCTGG - Intergenic
1138724249 16:59118680-59118702 GTTCCCAAAATACCCAGAGATGG + Intergenic
1139073463 16:63413973-63413995 TGTCCCACCATTCACAGAACAGG - Intergenic
1141244391 16:82292704-82292726 GTTCCCTCCATTCTCAGAACTGG - Intergenic
1143378388 17:6480532-6480554 CTTCCCACCCTTCCCAGCTCCGG + Intronic
1146268992 17:31472291-31472313 GCTCCCCCCATACCCAGCGCAGG + Intronic
1147461690 17:40576200-40576222 GTTGCCACCACCCCTAGAGCTGG - Intergenic
1148322724 17:46767211-46767233 GTTCCCAAGCTTCCCAGAGGTGG - Intronic
1149371719 17:56001127-56001149 CTTCTCACCATTCCCAAAACTGG + Intergenic
1149434311 17:56620075-56620097 GTCCCCACCCTGCCCAGATCTGG - Intergenic
1150194771 17:63285901-63285923 GTTCTTACCATTCCCAGAACTGG - Intronic
1152322733 17:79617258-79617280 GACCCCCCCATCCCCAGAGCAGG - Intergenic
1152724189 17:81937152-81937174 GTTCCCACCCCGCCCAGAACTGG + Intronic
1155107604 18:22683208-22683230 TTTCCCTCCCTTCCCAGGGCAGG + Intergenic
1158948982 18:62474616-62474638 GTTCCCCTCTGTCCCAGAGCAGG + Intergenic
1160159755 18:76462019-76462041 GCTCCCACCCTTCCCACATCCGG + Intronic
1161012866 19:1968630-1968652 GGTCCCACCATCCCGGGAGCAGG + Intronic
1161152457 19:2716878-2716900 GTTCCCACCAGGACCAGAGGAGG - Exonic
1161203321 19:3028142-3028164 TGTCTCCCCATTCCCAGAGCTGG + Intronic
1161898085 19:7097641-7097663 GTACCCAACATTCCCCTAGCAGG - Intergenic
1163592997 19:18204747-18204769 CTCCCCACCATTCCCAGAAAAGG + Intergenic
1165211126 19:34236648-34236670 GTTCCCGCCATTCCCAGAACTGG - Intergenic
1166863627 19:45823452-45823474 AGTCCCACCCTCCCCAGAGCTGG - Exonic
1168441857 19:56375119-56375141 GTTTCTACCATTCCCGGAACTGG - Intergenic
1168638249 19:58012932-58012954 TTCCCCACCATTCCCAGATGGGG - Intergenic
1202647980 1_KI270706v1_random:158517-158539 CTTCCCATCAGTCCCTGAGCTGG + Intergenic
928281594 2:29951019-29951041 GTACTCAACATTCACAGAGCAGG + Intergenic
933510349 2:83233331-83233353 TTTCCCACCATGCTCAGAACTGG + Intergenic
935312733 2:101801619-101801641 GTTTCCACCGCTCCCAGAACTGG - Intronic
936485904 2:112925548-112925570 GTTCTCACCATTGACACAGCTGG - Intergenic
936786376 2:116098478-116098500 GTCCCCACACTTCCCAGAGCTGG - Intergenic
939630286 2:144520548-144520570 GTGCACACCATTCACAGAACTGG + Intronic
942577304 2:177377718-177377740 ATCCCCACCATTCCCAGATGGGG - Intronic
943744018 2:191442163-191442185 GTTCCCACAATTCAGTGAGCTGG + Intergenic
945580010 2:211581640-211581662 CTTCCCATCATTCCCACAGTTGG + Intronic
947446398 2:230166842-230166864 GTTCCCCCTAATCCCAGGGCAGG - Intergenic
947994487 2:234515577-234515599 CTTCCCACCACTCCCCAAGCTGG + Intergenic
948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG + Intronic
948908651 2:240992049-240992071 GTTCCCAGCATTTCCAGGCCGGG - Intronic
1168781632 20:496562-496584 GTTCCTACAGTTCCCAGGGCTGG + Intronic
1170190628 20:13641376-13641398 GTTCCCACCTCTCCCAAACCCGG + Intergenic
1170929162 20:20753364-20753386 GTTCCCACTATTACAGGAGCTGG + Intergenic
1171185202 20:23120002-23120024 GTTCCCACATCTCCTAGAGCTGG + Intergenic
1173683136 20:44901298-44901320 CTTCCCAACAGTCCCAGAGTAGG - Intronic
1173987884 20:47276574-47276596 GATCCCACCAACCCCAGCGCCGG - Exonic
1175506001 20:59484511-59484533 TGTCCCACCAATCCCAGACCAGG - Intergenic
1175820845 20:61908023-61908045 CTTCCTACCAGACCCAGAGCTGG + Intronic
1176222792 20:63978073-63978095 GTACCCACCATTCACATGGCCGG - Intronic
1176603866 21:8814212-8814234 CTTCCCATCAGTCCCTGAGCTGG - Intergenic
1177821199 21:26032574-26032596 GTTCACACCATCCCCTGAGGTGG - Intronic
1178884882 21:36477229-36477251 GTTCCCAGCATGTCCATAGCAGG - Intronic
1180346151 22:11705789-11705811 CTTCCCATCAGTCCCTGAGCTGG - Intergenic
1181858247 22:25798164-25798186 GTTCCCACCGCTCCGAGAGAAGG - Intronic
1182636569 22:31732348-31732370 GTTTCCACCATTCCCTAAACAGG + Intronic
1183032628 22:35117148-35117170 GTTCCCACCCTTACCAGGGATGG + Intergenic
1184226654 22:43132677-43132699 GTTCTCAGCACTCACAGAGCAGG + Exonic
1185148853 22:49153076-49153098 CTCCCCACCACTCCCTGAGCGGG + Intergenic
1185420085 22:50730371-50730393 GATCCCGCCATGCCCAGAGCCGG + Intergenic
949424970 3:3906918-3906940 GTGCCCAGCATACCCAGTGCAGG - Intronic
949534594 3:4986272-4986294 CTTCTCACAAGTCCCAGAGCAGG + Intergenic
949879330 3:8649304-8649326 TTTCTCCTCATTCCCAGAGCAGG + Intronic
951050012 3:18083754-18083776 GTTCCCAAAATTGCCAAAGCAGG - Intronic
956659393 3:71583326-71583348 GCCCCCACCCATCCCAGAGCTGG + Intronic
958925288 3:100150524-100150546 GTTCCCTCCTTTGCCATAGCTGG + Intronic
961913691 3:130347736-130347758 GTGCCCTCCACTCTCAGAGCTGG - Intronic
961998490 3:131270848-131270870 TTTCCCATCTTTTCCAGAGCTGG - Intronic
962542020 3:136391860-136391882 GTTCCCCTGATTCCCAGAGTTGG - Intronic
969273249 4:6117130-6117152 CTTCCCAGCATGCTCAGAGCAGG - Intronic
969856829 4:10006735-10006757 GTTGCCACCGTTCCCAGATCTGG + Intronic
973233253 4:47866724-47866746 GTTCCCACCATTCCCAGAACTGG + Intronic
973306729 4:48660388-48660410 GGACCCACCACTCCCAGAACTGG + Intronic
973374250 4:49276703-49276725 CTTCCCATCAGTCCCTGAGCTGG + Intergenic
973383162 4:49333536-49333558 CTTCCCATCAGTCCCTGAGCTGG - Intergenic
973386771 4:49518551-49518573 CTTCCCATCAGTCCCTGAGCTGG - Intergenic
975588987 4:75981364-75981386 GGTCCTACCATTCGCAGATCTGG + Exonic
981186620 4:141811168-141811190 GCTCCTACCATCCCCAGAACTGG + Intergenic
982136805 4:152280087-152280109 GTCATCACCATGCCCAGAGCAGG + Intergenic
991019228 5:61962618-61962640 GTAGCCACTATTCCTAGAGCTGG - Intergenic
991720804 5:69493029-69493051 GTTCCCACGAGTCCCAGCTCGGG - Intronic
992855181 5:80852934-80852956 GTTACCAGCATTCACAAAGCTGG + Intronic
994713005 5:103288585-103288607 CTTCCCAGAATTCCCAGAGTAGG + Intergenic
996927066 5:128840260-128840282 TTCCACAGCATTCCCAGAGCTGG - Intronic
997694319 5:135849582-135849604 TTTCCTTCCATCCCCAGAGCTGG - Intronic
998778866 5:145633907-145633929 GTTCCCTGCATTCCCATAGCAGG + Intronic
1002044078 5:176532358-176532380 CTTCCTACCTTCCCCAGAGCTGG + Exonic
1005975841 6:30798060-30798082 GTTCACAACATTCCCTGAGAAGG - Intergenic
1006797474 6:36741050-36741072 TTCCCCACCTTTCCCACAGCAGG + Exonic
1007108036 6:39296750-39296772 GGTCCCACCATGCCAGGAGCAGG - Intergenic
1007966512 6:46008375-46008397 GGTCCCACCCTACCCAAAGCTGG + Intronic
1013318503 6:108963984-108964006 ATACCCACCACTCCCAGAGTTGG - Intronic
1017853541 6:158328058-158328080 GTTGCCAGCATTCTCAGAGCTGG + Intronic
1018743092 6:166744878-166744900 GTAGACTCCATTCCCAGAGCCGG - Intronic
1018791997 6:167155753-167155775 GTCACCACCATGCCCAGAGGAGG - Intronic
1019497296 7:1346524-1346546 GTTCCAGCCATTCCCACGGCAGG + Intergenic
1019611174 7:1937425-1937447 GTTCCCACGAAACCCAGGGCCGG + Intronic
1020450431 7:8315360-8315382 CCTCCCACCACTACCAGAGCTGG - Intergenic
1021898173 7:25257122-25257144 GTGGCCAGCGTTCCCAGAGCTGG - Intergenic
1025190390 7:56891622-56891644 GTTCTCCCCATCCCCAGAGTGGG + Intergenic
1025681549 7:63685298-63685320 GTTCTCCCCATCCCCAGAGTGGG - Intergenic
1026994326 7:74606022-74606044 GTCCCATCCATGCCCAGAGCTGG + Intergenic
1028725355 7:94080847-94080869 GTTCCTTCCATTCCCAGAACTGG - Intergenic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1030114716 7:106054539-106054561 GTTCCCAGAGTTCCCAAAGCTGG + Intergenic
1031600109 7:123697777-123697799 GTTCCCACTATTCCCTGACAAGG + Intronic
1032128540 7:129211617-129211639 CTTCCTTCCATTCCCACAGCGGG + Exonic
1033647572 7:143317055-143317077 TATCCCACCAATCCCACAGCGGG - Intronic
1033995218 7:147337382-147337404 GTTCCCATTGTTCCCAGAACAGG - Intronic
1034188837 7:149198377-149198399 GTTCCCACCCTTTCCAGATAGGG + Exonic
1036676339 8:10837085-10837107 GTTCCCACCATTCGCAGAACTGG + Intronic
1038490281 8:27965698-27965720 GTTCCCACCTTTCTCAGTGGAGG - Intronic
1038679806 8:29656247-29656269 GTCCCCTCCTTGCCCAGAGCAGG - Intergenic
1042958321 8:74275825-74275847 TTTCTCCCCATTCTCAGAGCAGG - Intronic
1045390299 8:101708506-101708528 ATTGCCACAATTTCCAGAGCTGG - Intronic
1047318155 8:123753568-123753590 GTCCCCACCACTCCCTGATCTGG + Intergenic
1047588647 8:126302714-126302736 CTTCCCACCAACCCCAGAACAGG - Intergenic
1049573153 8:143378862-143378884 GTTCCCACGGTTCCCGCAGCTGG - Intronic
1051659178 9:19409608-19409630 CTTCCCAGCACTCCGAGAGCAGG - Intronic
1056271836 9:84954745-84954767 GTCCCCACCAGCACCAGAGCTGG - Intronic
1056426649 9:86484199-86484221 GTTATCACCATCCCCTGAGCTGG + Intergenic
1056592047 9:87971715-87971737 AATCCCACCTTTCCCAGTGCTGG + Intronic
1057905301 9:98978027-98978049 GGTACCACGAGTCCCAGAGCTGG - Intronic
1059071508 9:111142191-111142213 GTTCCCACCATTTGCAGAACTGG - Intergenic
1060958787 9:127664334-127664356 GTTCCCATCACTCCAAGACCAGG - Intronic
1061541281 9:131278877-131278899 CTTCCAGCCAGTCCCAGAGCCGG + Intergenic
1061859977 9:133463053-133463075 CTTGCCACCATTCACAGGGCCGG - Intronic
1062065144 9:134522639-134522661 GTACACAGCACTCCCAGAGCTGG + Intergenic
1062180268 9:135187649-135187671 GTTCACACAACTGCCAGAGCGGG + Intergenic
1062428396 9:136516464-136516486 GTTTCCATCTGTCCCAGAGCTGG - Intronic
1062577435 9:137215232-137215254 GGTCCCAGCTTTCCCAGGGCCGG - Intronic
1203697923 Un_GL000214v1:114614-114636 GTTCCCATCAGTCCCTGAGCTGG + Intergenic
1203733779 Un_GL000216v2:116213-116235 CTTGCCCCCAGTCCCAGAGCTGG - Intergenic
1203551283 Un_KI270743v1:166372-166394 CTTCCCATCAGTCCCTGAGCTGG - Intergenic
1186076732 X:5887708-5887730 GTTCCCAACCTTCCCAGACTAGG + Intronic
1186516759 X:10172022-10172044 GTTCCCACCATTCCCAGAGCTGG - Intronic
1189766617 X:44378635-44378657 GTTCCCACCATTTCTAGAATTGG - Intergenic
1190069432 X:47267233-47267255 CCTCCCACATTTCCCAGAGCAGG + Intergenic
1190077398 X:47327835-47327857 CCTCCCACATTTCCCAGAGCAGG - Intergenic
1195924801 X:110014815-110014837 GTGCCAACTATTACCAGAGCTGG + Intronic
1199594690 X:149497247-149497269 GTTCTCACTATTCCCAGAATTGG - Intronic
1202301861 Y:23424447-23424469 GTTTCCCCCATCCCCATAGCTGG + Intergenic
1202568950 Y:26246151-26246173 GTTTCCCCCATCCCCATAGCTGG - Intergenic
1202627234 Y:56872208-56872230 CTTGCCCCCAGTCCCAGAGCTGG + Intergenic