ID: 1186517879

View in Genome Browser
Species Human (GRCh38)
Location X:10180319-10180341
Sequence GCAGTCACAAAATCCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186517879_1186517885 24 Left 1186517879 X:10180319-10180341 CCTGGGTGGGATTTTGTGACTGC No data
Right 1186517885 X:10180366-10180388 GGGACGGTATCTGACTTCTGAGG No data
1186517879_1186517883 4 Left 1186517879 X:10180319-10180341 CCTGGGTGGGATTTTGTGACTGC No data
Right 1186517883 X:10180346-10180368 ATGAACAGCAAGTGGCAAAAGGG No data
1186517879_1186517884 8 Left 1186517879 X:10180319-10180341 CCTGGGTGGGATTTTGTGACTGC No data
Right 1186517884 X:10180350-10180372 ACAGCAAGTGGCAAAAGGGACGG No data
1186517879_1186517882 3 Left 1186517879 X:10180319-10180341 CCTGGGTGGGATTTTGTGACTGC No data
Right 1186517882 X:10180345-10180367 AATGAACAGCAAGTGGCAAAAGG No data
1186517879_1186517880 -4 Left 1186517879 X:10180319-10180341 CCTGGGTGGGATTTTGTGACTGC No data
Right 1186517880 X:10180338-10180360 CTGCCTCAATGAACAGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186517879 Original CRISPR GCAGTCACAAAATCCCACCC AGG (reversed) Intronic