ID: 1186517881

View in Genome Browser
Species Human (GRCh38)
Location X:10180341-10180363
Sequence TTGCCACTTGCTGTTCATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186517881_1186517886 17 Left 1186517881 X:10180341-10180363 CCTCAATGAACAGCAAGTGGCAA No data
Right 1186517886 X:10180381-10180403 TTCTGAGGCTGAGCCACGCAAGG No data
1186517881_1186517885 2 Left 1186517881 X:10180341-10180363 CCTCAATGAACAGCAAGTGGCAA No data
Right 1186517885 X:10180366-10180388 GGGACGGTATCTGACTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186517881 Original CRISPR TTGCCACTTGCTGTTCATTG AGG (reversed) Intronic