ID: 1186517885

View in Genome Browser
Species Human (GRCh38)
Location X:10180366-10180388
Sequence GGGACGGTATCTGACTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186517879_1186517885 24 Left 1186517879 X:10180319-10180341 CCTGGGTGGGATTTTGTGACTGC No data
Right 1186517885 X:10180366-10180388 GGGACGGTATCTGACTTCTGAGG No data
1186517881_1186517885 2 Left 1186517881 X:10180341-10180363 CCTCAATGAACAGCAAGTGGCAA No data
Right 1186517885 X:10180366-10180388 GGGACGGTATCTGACTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186517885 Original CRISPR GGGACGGTATCTGACTTCTG AGG Intronic