ID: 1186520662

View in Genome Browser
Species Human (GRCh38)
Location X:10203917-10203939
Sequence TCCCATTATGTATTACATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 2, 3: 13, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186520662 Original CRISPR TCCCATTATGTATTACATAA TGG Intronic
904095045 1:27970388-27970410 TCCCATTACATATAACATTACGG + Exonic
905486877 1:38305412-38305434 TCCCATTCTGTTTTCCAAAATGG - Intergenic
906935010 1:50207077-50207099 TCCTATTATGTAGGAAATAAAGG + Intergenic
908012620 1:59796014-59796036 TTCCATACTGTTTTACATAATGG - Intergenic
909085718 1:71168070-71168092 TGCCATTATGAATTAAATACAGG + Intergenic
909259755 1:73472086-73472108 TCACATTCTGTATTACCTATTGG - Intergenic
910471864 1:87562139-87562161 TCCCATTATGTTCAACAGAAAGG - Intergenic
911333355 1:96551376-96551398 TCCCATTGTATTTTACAAAAAGG - Intergenic
912194140 1:107377912-107377934 TTGCATTATATATTGCATAAAGG + Intronic
914953753 1:152143795-152143817 TTCCATACTGTTTTACATAATGG + Intergenic
916509450 1:165458824-165458846 TTCCATAATGTTTTTCATAATGG - Intergenic
916927442 1:169537896-169537918 TCCCATACTGTTTTCCATAATGG - Intronic
918725818 1:187921897-187921919 TCACATTATTTTTTACATATTGG + Intergenic
918827413 1:189342389-189342411 TAGCATTATCTATTACATTAGGG + Intergenic
919089821 1:192964786-192964808 TTCCATTTTGTTTTACATAATGG - Intergenic
919288141 1:195592372-195592394 TACCATAATGTGTTCCATAATGG - Intergenic
921734928 1:218616286-218616308 TCCAGTGATTTATTACATAAAGG + Intergenic
923022545 1:230175882-230175904 TCCCACTCTGACTTACATAAAGG + Intronic
1068150967 10:53130779-53130801 ACCCATTATGTTTTCCTTAAGGG - Intergenic
1068835273 10:61545957-61545979 TCTCATAAAGTATTTCATAAGGG - Intergenic
1072298661 10:94037945-94037967 TCCCATTATGTAGGACATCTAGG - Intronic
1074599966 10:114903853-114903875 TCACATTATATAATAAATAAGGG + Intergenic
1074633495 10:115286977-115286999 TGCCATTTTATATTACATAAGGG + Intronic
1074712366 10:116188065-116188087 TCCCAGTATGTATTATATATAGG - Intronic
1078945419 11:16062360-16062382 TCTGATTAACTATTACATAAGGG + Intronic
1085864553 11:80274160-80274182 ACCCTTTAATTATTACATAATGG - Intergenic
1088294665 11:108278810-108278832 TCCCATTAGGCATAACCTAATGG + Intronic
1088520364 11:110691574-110691596 TCCTATTATGTGATTCATAAAGG + Intronic
1097344731 12:58478150-58478172 TCCCATTATGTTTTAGGTAAGGG - Intergenic
1098435580 12:70465106-70465128 TCTCATTATCTATTGCAGAAAGG - Intergenic
1098556153 12:71821438-71821460 ACCCATAATGTTTTCCATAATGG + Intergenic
1098649718 12:72949977-72949999 TCATATGATTTATTACATAATGG - Intergenic
1099819671 12:87693949-87693971 TCCCATTATGTCTTGAATTATGG - Intergenic
1099853284 12:88132426-88132448 TCTCATTATGGACTAGATAATGG + Intronic
1100915707 12:99419301-99419323 TCACATTATGTATTACATATTGG + Intronic
1101363406 12:104049048-104049070 TTCCATTATGTAATATAGAAAGG + Intronic
1101870131 12:108559303-108559325 TCCCACTATGAATAACTTAAAGG + Intronic
1104143594 12:126010863-126010885 TCACATTATGTTTTATGTAAAGG + Intergenic
1104545803 12:129711811-129711833 TTACATTATATATTATATAAAGG + Intronic
1105614524 13:22000129-22000151 TCCCATTATGTGTTATTTAAAGG - Intergenic
1108280862 13:48860213-48860235 TCAAAATATGTGTTACATAAAGG + Intergenic
1108670557 13:52683781-52683803 TCCAATTATCTATTTCATATGGG + Intronic
1109101981 13:58197035-58197057 TACAATTATGCATTGCATAAGGG - Intergenic
1109400784 13:61825598-61825620 TTCCATTCTGTTTTTCATAATGG + Intergenic
1109444815 13:62421200-62421222 ACAGATTATGTCTTACATAATGG + Intergenic
1109660279 13:65449576-65449598 TAATATTATGTATTATATAATGG + Intergenic
1110404562 13:75135309-75135331 GCACATTCTTTATTACATAATGG - Intergenic
1110533219 13:76620987-76621009 TCCTATTTTGACTTACATAAAGG + Intergenic
1110796907 13:79649315-79649337 TCACATAATTTGTTACATAATGG - Intergenic
1111402053 13:87751122-87751144 TCTCATTAGGAATTACAAAATGG + Intergenic
1112092282 13:96094054-96094076 TGCCCTTATGGATCACATAATGG + Intronic
1113062973 13:106343806-106343828 TCCCATTATCTATTCCCTCAGGG + Intergenic
1113859192 13:113470373-113470395 ACCCATCATGTGTCACATAATGG - Intronic
1114822078 14:26032753-26032775 TACCAATATGTACTACAGAATGG - Intergenic
1115274280 14:31590038-31590060 TCCCTTTATGTGTAACATACAGG + Intronic
1116104869 14:40489323-40489345 TCCCATTATTTATCACATCGTGG - Intergenic
1116318909 14:43434466-43434488 TCACATTATGTAATGAATAATGG + Intergenic
1118237008 14:64015387-64015409 TCCCATTATGTATTTAATATTGG + Intronic
1119240327 14:73054092-73054114 TGCCATTATATACTATATAATGG + Intergenic
1119240328 14:73054094-73054116 TGCCATTATATAGTATATAATGG - Intergenic
1119497997 14:75097365-75097387 TCCCACTATGTACTAAACAAGGG + Intronic
1120202915 14:81557271-81557293 TCCCATTATGTGTCAAATGATGG + Intergenic
1125298908 15:38233529-38233551 TTTCATTATTTATTATATAAAGG + Intergenic
1125323278 15:38511079-38511101 AAACATTATGTATTACAAAATGG + Intronic
1126288369 15:47042804-47042826 CCCCATTCTGTTTTTCATAATGG + Intergenic
1135376962 16:21955590-21955612 TCCCATTAAATATTAGATAATGG - Intronic
1137747022 16:50829909-50829931 TCACATTATGGACTACATTATGG + Intergenic
1138663455 16:58541331-58541353 TCCAATTAAGTATGACATACAGG - Intronic
1148196036 17:45713619-45713641 TTCCATACTGTTTTACATAATGG - Intergenic
1150579828 17:66462264-66462286 TCCTATTTTGTAGTACACAAAGG + Intronic
1155049363 18:22133120-22133142 TTCCCTTATTTTTTACATAAAGG - Intergenic
1155422007 18:25665872-25665894 TCACATTAGGTATTCAATAATGG + Intergenic
1155776818 18:29774746-29774768 TCCTATTGTGTATTAAATACAGG + Intergenic
1157153048 18:45238547-45238569 CCCCATTAAATGTTACATAATGG - Intronic
1157940015 18:51918220-51918242 TCCCATTATTTATTCCAAAATGG - Intergenic
1159489286 18:69109440-69109462 TCCAAATTTGTATTCCATAAAGG - Intergenic
1159906132 18:74094015-74094037 ACCCTTTATGGATTACAGAATGG + Intronic
1163864654 19:19762642-19762664 TCTAATTATGTATTCCAGAACGG - Intergenic
1164280606 19:23765211-23765233 TCCCACCATGTCTTCCATAATGG - Intronic
926779288 2:16452744-16452766 TCCCAGTATGTAATACAGACCGG - Intergenic
927906309 2:26860801-26860823 TTACATAATGTATTACAGAAAGG - Intronic
929334763 2:40728284-40728306 TCCTATTATATAATACATTATGG + Intergenic
930253276 2:49060318-49060340 TCCCATTAGGTATTAGCAAAAGG + Intronic
930416908 2:51100474-51100496 TGCCATTAAGTATTACTGAATGG - Intergenic
930429582 2:51257114-51257136 TTTCATAATGTTTTACATAACGG - Intergenic
935895114 2:107727850-107727872 TCACATTATCTACTTCATAATGG - Intergenic
937692934 2:124776986-124777008 TCCCCTTACCAATTACATAAGGG + Intronic
939557163 2:143689788-143689810 TCCCTTTATGTTTTACATATGGG + Intronic
941125055 2:161575331-161575353 TCAAATTATGTATTTCATATTGG + Intronic
941729005 2:168895258-168895280 TCCCACTATGTAATACATGTAGG + Intronic
941729008 2:168895260-168895282 TCCCTACATGTATTACATAGTGG - Intronic
942665768 2:178315463-178315485 TATCATTATCTATTATATAATGG + Intronic
942673221 2:178399405-178399427 TACAATTATGTATTAAACAAAGG - Intronic
943263172 2:185692446-185692468 TCACAATATTTATTACATGAAGG - Intergenic
946877538 2:224144988-224145010 TTACATTATTTATTAGATAATGG - Intergenic
1173673283 20:44812453-44812475 TCACACAAGGTATTACATAAGGG + Intergenic
1174352441 20:49978437-49978459 GCCCTTTATGTATTACAAATAGG - Intergenic
1177525898 21:22289209-22289231 TCACATTATGAAGTACTTAAAGG + Intergenic
1179576847 21:42313268-42313290 TGCTTTTATGTTTTACATAAAGG + Intronic
1181994535 22:26865453-26865475 TCCCATACTGTTTTCCATAATGG + Intergenic
951955436 3:28248151-28248173 TCCAATTATTTGTTACATATAGG - Intronic
952807711 3:37372646-37372668 TCCCATTCTGTTTTAATTAATGG + Intergenic
953573184 3:44089087-44089109 TCCGATTATCTATTTCATATTGG + Intergenic
955800784 3:62684189-62684211 TCCAATTATTTATTACAGTATGG + Intronic
957606810 3:82410438-82410460 TCAGATTATGTATCAGATAAGGG - Intergenic
959273896 3:104252007-104252029 TCTAATTATTTATTACATATGGG - Intergenic
960576723 3:119237453-119237475 TTCCTTTATGTATTTGATAAAGG - Intronic
962663055 3:137624634-137624656 TCCCATAATGTAATGCAAAAGGG - Intergenic
964158435 3:153615998-153616020 TCTCATTAGGTTTTACATAAAGG + Intergenic
964334241 3:155638092-155638114 TCCCCTTATTTATTTCACAATGG + Intronic
964675611 3:159276576-159276598 TCCTACTTTGTATTACATGATGG + Intronic
969156669 4:5217161-5217183 TCAAATTATGTATTGTATAAGGG - Intronic
974161636 4:58149049-58149071 GCCAATTATGTATTTGATAAGGG + Intergenic
974874401 4:67685627-67685649 TCCCATTAGGTCCTACGTAACGG - Intronic
974958526 4:68672699-68672721 TCGCAGTATGAATTAGATAACGG + Intergenic
976078610 4:81328526-81328548 TCAAATTATGTATTTGATAAGGG + Intergenic
976721713 4:88175365-88175387 ACCCATTAAGTATTTCATTAGGG + Intronic
977439869 4:97051364-97051386 TCTCATTGTGTATTCCTTAAGGG - Intergenic
979019055 4:115471824-115471846 TCAAACTATTTATTACATAATGG + Intergenic
979337395 4:119479209-119479231 TTCCATTATCTCTTACATGAGGG - Intergenic
980061532 4:128135341-128135363 TGCCATCCTGTATTCCATAAGGG - Intronic
980176760 4:129355262-129355284 TCTCATTATGTACTAAATGAAGG - Intergenic
981703732 4:147637016-147637038 TTCCATTCTGTTTTCCATAATGG - Intronic
981875916 4:149545608-149545630 TTCCATAATATTTTACATAATGG - Intergenic
981919626 4:150073369-150073391 CTCCATTACTTATTACATAAAGG - Intergenic
982660095 4:158196406-158196428 ACCCATCTTGTGTTACATAATGG + Intergenic
982680907 4:158428321-158428343 TCTCATTATGTTTTATTTAAGGG - Intronic
982873948 4:160621038-160621060 TTAAATTAGGTATTACATAAAGG - Intergenic
983767602 4:171505134-171505156 AGCCATTATGTAAAACATAATGG + Intergenic
983767603 4:171505136-171505158 CTCCATTATGTTTTACATAATGG - Intergenic
983809153 4:172036788-172036810 TCCATTTATTTATTACACAAAGG + Intronic
984609743 4:181824576-181824598 TCCCATTTTATATGACATGAAGG + Intergenic
986163944 5:5257191-5257213 TTTCTTTATGTATTACTTAAGGG - Intronic
989309810 5:40001833-40001855 TCTCATTACCTGTTACATAATGG + Intergenic
989707585 5:44355985-44356007 TCCCATCATTTATTTCCTAAGGG - Intronic
989772704 5:45163680-45163702 TCAAATTATTTATTACCTAATGG + Intergenic
991207893 5:64070910-64070932 TCCCATTATGGTTTAAAAAAAGG + Intergenic
993195226 5:84733632-84733654 TCCCATTTTGTATTCCATCCTGG + Intergenic
993647828 5:90481115-90481137 TTCCATTATGAATTGCAAAATGG - Intronic
993746666 5:91607610-91607632 TTCCATAGTGTATTTCATAAAGG + Intergenic
994326494 5:98452750-98452772 TTCCATATTGTATTTCATAATGG - Intergenic
995601811 5:113805603-113805625 ACTCATTATGTATTTCAGAAGGG + Intergenic
996091939 5:119359834-119359856 TTACATTATGTATGACATCAAGG - Intronic
996218761 5:120902620-120902642 TACATTGATGTATTACATAATGG + Intergenic
996500118 5:124207338-124207360 TCCCAGTGTTTATTACATAATGG - Intergenic
996941090 5:129006023-129006045 TCTTATTATGTATTCCATATAGG + Intronic
998580409 5:143368462-143368484 TCAAATTATATATTTCATAAGGG + Intronic
998881926 5:146653763-146653785 TTCCATGATGTACTACTTAATGG + Intronic
998881928 5:146653765-146653787 CCCCATTAAGTAGTACATCATGG - Intronic
1000908189 5:166988966-166988988 TCTTATTATATAATACATAAGGG - Intergenic
1001189866 5:169619928-169619950 TCCTATAATGTATTACTTTAGGG + Intergenic
1001739304 5:174037402-174037424 TAGCATTATGTTTTACTTAATGG - Intergenic
1003029707 6:2591746-2591768 TTACATTATATATTATATAATGG + Intergenic
1003476010 6:6483596-6483618 CTCCATTATGTTTTCCATAATGG - Intergenic
1006627656 6:35408849-35408871 TCACATTAAATCTTACATAAAGG + Intronic
1007118050 6:39357747-39357769 TCCCCTTAAGAATTACATCAAGG - Intronic
1007204980 6:40142046-40142068 TCACAATATATATTACATAGAGG + Intergenic
1008226847 6:48929969-48929991 TTCCATTCTGTTTTCCATAATGG + Intergenic
1008359073 6:50593327-50593349 TCCCCCTATATATTACAAAAGGG - Intergenic
1012039686 6:94188007-94188029 TAACATTATTTATTAAATAATGG - Intergenic
1012162347 6:95901743-95901765 TTCCATAATGTTTTTCATAATGG + Intergenic
1012536152 6:100299644-100299666 TCTCATTATGAATTACATTTTGG - Intergenic
1012816148 6:104025122-104025144 TCCCACTCTGTATTATAAAAAGG + Intergenic
1016707845 6:147134036-147134058 TCCCATACTGTTTTCCATAATGG - Intergenic
1020787038 7:12586500-12586522 TTCCATAATGTTTTTCATAATGG - Intronic
1022870188 7:34470043-34470065 TACTTTTATGTATTTCATAATGG + Intergenic
1023062412 7:36341413-36341435 TCCCATGATGTATTACAATCAGG - Intronic
1023314789 7:38924573-38924595 TTCCATTCTGTTTTCCATAATGG - Intronic
1023877604 7:44295849-44295871 TCCGCTTATGTACTACATACAGG - Intronic
1025614391 7:63105692-63105714 TCCCCTTATGTTTTAGATAGGGG - Intergenic
1026646838 7:72178150-72178172 GCCCAATGTGTATTGCATAAAGG + Intronic
1027876481 7:83776733-83776755 TCCCATTATTTTTTCCAAAACGG + Intergenic
1028000292 7:85487663-85487685 CCCCATTCTGTATTACATAATGG + Intergenic
1028000294 7:85487665-85487687 AGCCATTATGTAATACAGAATGG - Intergenic
1028283619 7:88966542-88966564 TGCAATTATCTAATACATAAAGG - Intronic
1028812183 7:95100569-95100591 TCCCTCTTTGTATTGCATAAGGG + Intronic
1028992731 7:97066869-97066891 TTCTATTATGTTTTAAATAAAGG + Intergenic
1029840712 7:103360173-103360195 TTCCCTTATGTATGACATTATGG - Intronic
1030844848 7:114396558-114396580 TTCCATAATGTTTTCCATAATGG + Intronic
1031227802 7:119063168-119063190 TACCATTATGTTTTTCATAGAGG - Intergenic
1031529682 7:122861173-122861195 TCCCATTCTGTTTTCCATAATGG + Intronic
1031697752 7:124879616-124879638 TCCAAGTATGTCTTAAATAACGG - Intronic
1032621711 7:133540781-133540803 TCCCATTATATAGTAGAGAAAGG + Intronic
1035872907 8:3155136-3155158 TGTCACTTTGTATTACATAATGG - Intronic
1038079953 8:24122994-24123016 TCCCATTATGGGTTAAATATTGG - Intergenic
1038342935 8:26703285-26703307 TCCATTTATGTATACCATAAGGG - Intergenic
1038867268 8:31453261-31453283 TCCCATTATGTATTTTAAATGGG + Intergenic
1039665853 8:39526948-39526970 TTCCATAATGTTTTCCATAATGG - Intergenic
1040983566 8:53269626-53269648 ACCCATAATGCATTTCATAAGGG + Intergenic
1041559432 8:59198191-59198213 TCACATTCTGTATTTCATACTGG - Intergenic
1045907498 8:107365071-107365093 TCACCTTATGTAGTACACAAGGG + Intronic
1046344957 8:112911863-112911885 TCTCATAATGTTATACATAATGG - Intronic
1046423974 8:114022143-114022165 TGCCATAATGCATAACATAATGG + Intergenic
1046870423 8:119199537-119199559 TCACATTCTATCTTACATAATGG - Intronic
1047876441 8:129143125-129143147 TCCCATTATAGCTTAAATAAAGG - Intergenic
1047887903 8:129273036-129273058 TCCTAATATGTATTCCCTAATGG + Intergenic
1050162921 9:2736502-2736524 GCACAATATCTATTACATAATGG + Intronic
1051183231 9:14433074-14433096 CCCCACTATGTTTTAAATAAGGG - Intergenic
1053182901 9:35989465-35989487 TCTCCTTATGAATTTCATAATGG + Intergenic
1054911486 9:70459192-70459214 TCCGATTATGAATTTAATAAAGG - Intergenic
1054985354 9:71255757-71255779 TCCTATTATGTGTAAAATAATGG + Intronic
1055263239 9:74464567-74464589 TCCCAGTAACTATTTCATAAGGG - Intergenic
1056278329 9:85015170-85015192 CTTCATTATGTATAACATAAGGG - Intronic
1057406373 9:94774770-94774792 TCCCATAATGTTTTCCAGAAAGG + Intronic
1057511461 9:95683160-95683182 TCCCTTAATGTTTTTCATAATGG - Intergenic
1058302700 9:103396343-103396365 GCCCTTTATGGATTATATAATGG + Intergenic
1058302702 9:103396345-103396367 TGCCATTATATAATCCATAAAGG - Intergenic
1186520662 X:10203917-10203939 TCCCATTATGTATTACATAATGG + Intronic
1186520665 X:10203919-10203941 TCCCATTATGTAATACATAATGG - Intronic
1187794223 X:22984063-22984085 ACCCATACTGTATTCCATAATGG - Intergenic
1187909581 X:24098670-24098692 TCAAATTATGTATTTCATATTGG + Intergenic
1188248904 X:27867550-27867572 TCCCATTTTGTATCACATGGGGG + Intergenic
1189777045 X:44479855-44479877 TCCCCCTAGGTATCACATAAAGG - Intergenic
1189833421 X:44997656-44997678 TCCCATTCTGTATCATTTAAAGG + Intronic
1191605628 X:63059300-63059322 TCACATTATGTATCACAGACAGG - Intergenic
1191624284 X:63252901-63252923 CTCCATAATGTTTTACATAATGG - Intergenic
1192036957 X:67574044-67574066 TTCCATTATGTTTTACAAATGGG - Intronic
1193238316 X:79135906-79135928 TCCCATCACGTATTAAACAAAGG - Intergenic
1195593569 X:106661286-106661308 TCCCTTTTTGTTTTCCATAAAGG + Intronic
1195759633 X:108232275-108232297 TCCCATTAAATATCACAAAAGGG - Intronic
1196799304 X:119528413-119528435 TCCCATACTGTGTTCCATAATGG + Intergenic
1196801631 X:119548636-119548658 TCCCATACTGTGTTCCATAATGG - Intronic
1197584409 X:128327572-128327594 TCCCATCATCGATTAGATAAAGG - Intergenic
1199055819 X:143293405-143293427 TCCCATTAAGTATTTGACAATGG + Intergenic
1199623228 X:149717132-149717154 TCCCAAAATGTTTTACAAAATGG - Exonic
1200922328 Y:8624281-8624303 TACCATTATGTTTTAATTAATGG + Intergenic
1202012270 Y:20356280-20356302 TGCCATTATGTCTTCCAAAATGG - Intergenic