ID: 1186520665

View in Genome Browser
Species Human (GRCh38)
Location X:10203919-10203941
Sequence TCCCATTATGTAATACATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186520665_1186520668 20 Left 1186520665 X:10203919-10203941 CCATTATGTATTACATAATGGGA 0: 1
1: 1
2: 0
3: 16
4: 183
Right 1186520668 X:10203962-10203984 ATTTCATTGACTGATTCACTTGG 0: 1
1: 0
2: 7
3: 14
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186520665 Original CRISPR TCCCATTATGTAATACATAA TGG (reversed) Intronic
905882201 1:41471553-41471575 TCCCATTATTTAATTGATGAAGG + Intergenic
906935010 1:50207077-50207099 TCCTATTATGTAGGAAATAAAGG + Intergenic
910471864 1:87562139-87562161 TCCCATTATGTTCAACAGAAAGG - Intergenic
917521408 1:175751020-175751042 TCCCCTTATGTTACAGATAAGGG + Intergenic
919089820 1:192964784-192964806 AGCCATTATGTAAAACAAAATGG + Intergenic
919089821 1:192964786-192964808 TTCCATTTTGTTTTACATAATGG - Intergenic
919514662 1:198508364-198508386 TATCATTATATAATATATAATGG - Intergenic
922437134 1:225617448-225617470 ACACATTATCTGATACATAAAGG + Intronic
1064869292 10:19920199-19920221 TCCCTTTAAATGATACATAACGG + Intronic
1070324237 10:75377468-75377490 TCCCATTCTGAAATAAATCATGG + Intergenic
1070498146 10:77044028-77044050 TGCTCTTATGTTATACATAAGGG - Intronic
1072298661 10:94037945-94037967 TCCCATTATGTAGGACATCTAGG - Intronic
1074599966 10:114903853-114903875 TCACATTATATAATAAATAAGGG + Intergenic
1074633495 10:115286977-115286999 TGCCATTTTATATTACATAAGGG + Intronic
1074633497 10:115286979-115287001 ACCCCTTATGTAATATAAAATGG - Intronic
1074712366 10:116188065-116188087 TCCCAGTATGTATTATATATAGG - Intronic
1077748737 11:4939156-4939178 TCCCCTTATATAATAGTTAAGGG - Intronic
1077761837 11:5109447-5109469 TGCCATTATGAAAAACAAAATGG + Intergenic
1085863472 11:80260655-80260677 ATCTATTATGTAATACCTAAAGG + Intergenic
1085864551 11:80274158-80274180 AGCCATTATGTAATAATTAAAGG + Intergenic
1085865918 11:80292022-80292044 TCCCATTCAGTAACCCATAAGGG - Intergenic
1086159370 11:83704322-83704344 TCTGTTTATGAAATACATAAGGG - Intronic
1086831755 11:91574933-91574955 TCTTACTCTGTAATACATAAGGG + Intergenic
1086909118 11:92451518-92451540 TCACATTTTGTAAAACATTAAGG + Intronic
1087356338 11:97098477-97098499 TCTCATTGTGGAATACATAGTGG - Intergenic
1088520364 11:110691574-110691596 TCCTATTATGTGATTCATAAAGG + Intronic
1088710377 11:112502921-112502943 TCCTATTATCCAATACATCATGG - Intergenic
1097344731 12:58478150-58478172 TCCCATTATGTTTTAGGTAAGGG - Intergenic
1099573849 12:84357746-84357768 TCCCATTCTGGAATACATTCTGG + Intergenic
1099853284 12:88132426-88132448 TCTCATTATGGACTAGATAATGG + Intronic
1100915707 12:99419301-99419323 TCACATTATGTATTACATATTGG + Intronic
1101363406 12:104049048-104049070 TTCCATTATGTAATATAGAAAGG + Intronic
1103374231 12:120442743-120442765 TGCCATTTTGTAATAATTAACGG + Intronic
1104505973 12:129332668-129332690 TTCCATTATGCAAAAGATAATGG + Intronic
1105614521 13:22000127-22000149 TCCCTTTAAATAACACATAATGG + Intergenic
1105614524 13:22000129-22000151 TCCCATTATGTGTTATTTAAAGG - Intergenic
1107188689 13:37553182-37553204 TCTCTTTATTTAATAAATAAAGG - Intergenic
1108059632 13:46519580-46519602 TCCCATGATGTAATATATGTGGG + Intergenic
1109849832 13:68047744-68047766 TCTCATTATATAATACCCAAAGG - Intergenic
1110046011 13:70831546-70831568 TGTCAGTATGTAATACTTAAAGG + Intergenic
1112092283 13:96094056-96094078 ATCCATTATGTGATCCATAAGGG - Intronic
1113859190 13:113470371-113470393 TGCCATTATGTGACACATGATGG + Intronic
1114822078 14:26032753-26032775 TACCAATATGTACTACAGAATGG - Intergenic
1116318909 14:43434466-43434488 TCACATTATGTAATGAATAATGG + Intergenic
1117593853 14:57306245-57306267 TCTCATTATCCAAAACATAAGGG - Intergenic
1118237008 14:64015387-64015409 TCCCATTATGTATTTAATATTGG + Intronic
1119240327 14:73054092-73054114 TGCCATTATATACTATATAATGG + Intergenic
1119240328 14:73054094-73054116 TGCCATTATATAGTATATAATGG - Intergenic
1119497997 14:75097365-75097387 TCCCACTATGTACTAAACAAGGG + Intronic
1121524798 14:94612453-94612475 TCCCAGGATGTAAAACATCATGG - Intronic
1123805275 15:23865136-23865158 TTCCATTTTGTAATTAATAAAGG + Intergenic
1124717863 15:32083317-32083339 TCCCATGATGGAAGACAGAAGGG - Intronic
1131938115 15:97529896-97529918 TCAAATTATGTAACCCATAAAGG - Intergenic
1132439357 15:101843171-101843193 TCACATTAGGGCATACATAAGGG + Intergenic
1132471758 16:108038-108060 TCCCATTCTGCAACACAGAAGGG + Intronic
1135376962 16:21955590-21955612 TCCCATTAAATATTAGATAATGG - Intronic
1137747022 16:50829909-50829931 TCACATTATGGACTACATTATGG + Intergenic
1140617263 16:76680688-76680710 TTCCAGTCTGTAATTCATAAGGG - Intergenic
1144470332 17:15534475-15534497 TCACATGAGATAATACATAAAGG + Intronic
1144926010 17:18809205-18809227 TCACATGAGATAATACATAAAGG - Intergenic
1146429872 17:32782527-32782549 TCTGATTATGTTATGCATAAGGG + Intronic
1150579828 17:66462264-66462286 TCCTATTTTGTAGTACACAAAGG + Intronic
1154384830 18:13883782-13883804 TCCCATGTGGGAATACATAAAGG - Exonic
1155049361 18:22133118-22133140 GCCCTTTATGTAAAAAATAAGGG + Intergenic
1155520939 18:26668501-26668523 GGCCACTATGTAATACATTAGGG + Intergenic
1155617167 18:27735755-27735777 ACCCATAATGAAATAAATAATGG + Intergenic
1155782966 18:29862100-29862122 TCCCAATATGTGATCCATGATGG - Intergenic
1157940015 18:51918220-51918242 TCCCATTATTTATTCCAAAATGG - Intergenic
1158929551 18:62310198-62310220 TTTCATTATTTAATACATGATGG - Intergenic
1159673532 18:71252609-71252631 TCCCACTATGTAAGACATGCTGG + Intergenic
1159906134 18:74094017-74094039 ATCCATTCTGTAATCCATAAAGG - Intronic
1164409118 19:27983235-27983257 CCCTATTATGTAATAAATATGGG - Intergenic
1165885266 19:39073630-39073652 TCCTCTTCTGTAATACAAAATGG + Intergenic
926522461 2:13932290-13932312 TCACATTATGGAAAACACAAAGG + Intergenic
926779288 2:16452744-16452766 TCCCAGTATGTAATACAGACCGG - Intergenic
926898050 2:17717033-17717055 TCCCATTTTGTAATAAAGTAAGG - Intronic
928056034 2:28055667-28055689 ACCCATTATGGAAAACACAATGG + Intronic
928218350 2:29381245-29381267 TTGCATGATGTAACACATAAAGG + Intronic
929334763 2:40728284-40728306 TCCTATTATATAATACATTATGG + Intergenic
930416907 2:51100472-51100494 TACCATTCAGTAATACTTAATGG + Intergenic
931084302 2:58812150-58812172 TCTTATTGTGTGATACATAAAGG + Intergenic
933516385 2:83309040-83309062 TGCCATTATTTAATACATCTGGG - Intergenic
934482748 2:94667448-94667470 TCAGATGAGGTAATACATAACGG - Intergenic
935539569 2:104333770-104333792 TCTCATTATGTGAGCCATAAGGG + Intergenic
935895114 2:107727850-107727872 TCACATTATCTACTTCATAATGG - Intergenic
936498027 2:113039518-113039540 TCCATTAATTTAATACATAATGG - Intronic
936615701 2:114045496-114045518 TTCCATTATTTAATACATTTCGG - Intergenic
937649639 2:124305725-124305747 TCCCATAATGTAAAGCAGAAAGG - Intronic
937824668 2:126355183-126355205 TCCCAATATGTAATAACCAAAGG - Intergenic
939380361 2:141427278-141427300 TACAATAATTTAATACATAAGGG + Intronic
939557163 2:143689788-143689810 TCCCTTTATGTTTTACATATGGG + Intronic
941729005 2:168895258-168895280 TCCCACTATGTAATACATGTAGG + Intronic
942091776 2:172499098-172499120 TCCAAAAATATAATACATAAGGG + Intronic
943142021 2:183994142-183994164 TAACATATTGTAATACATAATGG - Intergenic
943223421 2:185139289-185139311 TTCCAGGATATAATACATAAAGG - Intergenic
944359236 2:198832444-198832466 TCCAATTCTTTAATACATACAGG - Intergenic
944833142 2:203553010-203553032 TCCCTTTAAATAATACTTAAAGG - Intergenic
947981741 2:234416232-234416254 TCCCCTTATACAATTCATAAAGG - Intergenic
1170326345 20:15158066-15158088 TCCCATTATGAAATAAATGGAGG + Intronic
1174352439 20:49978435-49978457 TTCCTATTTGTAATACATAAAGG + Intergenic
1177262025 21:18742087-18742109 TCCCCTTAGGTCATAAATAAAGG - Intergenic
1177525898 21:22289209-22289231 TCACATTATGAAGTACTTAAAGG + Intergenic
1178744822 21:35238901-35238923 TGTCATTTTGTAATACAAAAAGG + Intronic
1179144309 21:38753718-38753740 TCCAATTACATAATAAATAATGG - Intergenic
955559897 3:60177564-60177586 TTCCATTTTGTAATACACCATGG + Intronic
957671515 3:83309754-83309776 TGTCATTATGTAATCAATAAAGG - Intergenic
957918051 3:86711479-86711501 TCCTATAATCTAACACATAAAGG + Intergenic
962585923 3:136842788-136842810 TGCCATTATGGAATTCACAAAGG + Intronic
962663055 3:137624634-137624656 TCCCATAATGTAATGCAAAAGGG - Intergenic
964158435 3:153615998-153616020 TCTCATTAGGTTTTACATAAAGG + Intergenic
966139422 3:176738125-176738147 TCCTATTATAGAATACAAAAGGG - Intergenic
966804128 3:183792864-183792886 TCACATTAAGTAATACAAACAGG - Intronic
971654824 4:29330907-29330929 ACCCATTTGGAAATACATAATGG + Intergenic
971712400 4:30131861-30131883 CCAGATAATGTAATACATAAAGG + Intergenic
971966925 4:33570956-33570978 TCTCAAGCTGTAATACATAAAGG + Intergenic
974874401 4:67685627-67685649 TCCCATTAGGTCCTACGTAACGG - Intronic
976576874 4:86682531-86682553 TCTCATTACGTAAAACACAAAGG + Intronic
977770545 4:100852524-100852546 TCACACTATGTAAGACATAGAGG + Intronic
979234231 4:118381546-118381568 TTTCATTATATAATACAAAATGG + Intergenic
980176760 4:129355262-129355284 TCTCATTATGTACTAAATGAAGG - Intergenic
981099771 4:140817141-140817163 GCCCATTCTGTAATCCAGAATGG - Intergenic
981820056 4:148876129-148876151 TCACATAATTTTATACATAAAGG - Intergenic
981875914 4:149545606-149545628 ACCCATTATGTAAAATATTATGG + Intergenic
982546733 4:156742681-156742703 TCCCATTAAGAAATCCATTAAGG - Intergenic
982953562 4:161732233-161732255 TTCAATTATTTAATACATATGGG + Intronic
983767602 4:171505134-171505156 AGCCATTATGTAAAACATAATGG + Intergenic
983767603 4:171505136-171505158 CTCCATTATGTTTTACATAATGG - Intergenic
987852274 5:23371692-23371714 TCCAATCAAGTAATGCATAAAGG + Intergenic
987901548 5:24018469-24018491 TCCCATTATGAGATGCATTATGG - Intronic
989534082 5:42543397-42543419 TCTCATTAAATAATACCTAAAGG - Intronic
989695592 5:44196816-44196838 TAACATTATTTAATACAGAATGG - Intergenic
992600387 5:78392769-78392791 TCACATTATATAATAAACAAAGG - Intronic
993184933 5:84605539-84605561 TTCCATCTTGTAATACAGAAAGG + Intergenic
993195229 5:84733634-84733656 TCCCAGGATGGAATACAAAATGG - Intergenic
993418501 5:87668376-87668398 TTCCATTATGTTATACAAATCGG - Intergenic
994304678 5:98188812-98188834 TTCCCATCTGTAATACATAAAGG + Intergenic
996500116 5:124207336-124207358 TGCCATTATGTAATAAACACTGG + Intergenic
996500118 5:124207338-124207360 TCCCAGTGTTTATTACATAATGG - Intergenic
998596135 5:143532340-143532362 TCCCATTCTGTAAGATCTAAAGG - Intergenic
998642214 5:144023710-144023732 ACCCATTATCTAATGCATTAAGG - Intergenic
998881926 5:146653763-146653785 TTCCATGATGTACTACTTAATGG + Intronic
998881928 5:146653765-146653787 CCCCATTAAGTAGTACATCATGG - Intronic
1000908189 5:166988966-166988988 TCTTATTATATAATACATAAGGG - Intergenic
1001726457 5:173906280-173906302 TACCATTAGGAAATAGATAAAGG - Intronic
1002927481 6:1613378-1613400 TCCTTCTATGTAATACATGAAGG - Exonic
1003476009 6:6483594-6483616 AGCCATTATGGAAAACATAATGG + Intergenic
1005798773 6:29396863-29396885 TCCCAGGAAGAAATACATAAGGG - Exonic
1008719904 6:54336250-54336272 TGTTATTATGTAATATATAAAGG + Intronic
1009413330 6:63391802-63391824 TCACATGATGTAAAGCATAAGGG + Intergenic
1010930008 6:81790300-81790322 CCCCATTATTTAAAACACAATGG - Intergenic
1013144968 6:107380384-107380406 TCCCTTTATGTTAGACAGAAAGG + Intronic
1013223589 6:108102422-108102444 TCTCTTTATGGAATAAATAAAGG + Intronic
1014261456 6:119222906-119222928 TCCCATTTTGTTATTCAAAAGGG + Intronic
1015367343 6:132411292-132411314 TTCCATTAGGTAATGCAGAATGG - Intergenic
1017364680 6:153621479-153621501 TCCAATTACCTTATACATAAAGG + Intergenic
1020915071 7:14183431-14183453 TACAAGTATGTAAAACATAAAGG + Intronic
1022124845 7:27346345-27346367 TTCCATCATGTAAGACAAAATGG - Intergenic
1022224020 7:28344915-28344937 TGACATTATTTAATGCATAAAGG + Intronic
1022820734 7:33958143-33958165 TCCTATTATGAAATGCATTAAGG + Intronic
1023877604 7:44295849-44295871 TCCGCTTATGTACTACATACAGG - Intronic
1025614388 7:63105690-63105712 TCCCCCTATCTAAAACATAAGGG + Intergenic
1028000292 7:85487663-85487685 CCCCATTCTGTATTACATAATGG + Intergenic
1028000294 7:85487665-85487687 AGCCATTATGTAATACAGAATGG - Intergenic
1028283619 7:88966542-88966564 TGCAATTATCTAATACATAAAGG - Intronic
1028809790 7:95071726-95071748 TTACATTATGAAATACATTAAGG + Intronic
1029840711 7:103360171-103360193 AGCCATAATGTCATACATAAGGG + Intronic
1030758123 7:113315150-113315172 TGCCATTATATAACAAATAAAGG + Intergenic
1031219353 7:118945535-118945557 TCCCTTTAAGTGATACAGAAGGG + Intergenic
1031529682 7:122861173-122861195 TCCCATTCTGTTTTCCATAATGG + Intronic
1032621711 7:133540781-133540803 TCCCATTATATAGTAGAGAAAGG + Intronic
1036602712 8:10276861-10276883 TCCCTTTAAGTAATAAAGAAAGG + Intronic
1037329292 8:17728095-17728117 TCCTATTCTGTAAAACAAAATGG + Intronic
1038079950 8:24122992-24123014 TCCCAATATTTAACCCATAATGG + Intergenic
1038137677 8:24806080-24806102 TCCAACTATGAAATACATGAAGG + Intergenic
1040983569 8:53269628-53269650 TCCCCTTATGAAATGCATTATGG - Intergenic
1042341861 8:67687928-67687950 TCCTAGTATGAAATAGATAATGG + Intronic
1044132757 8:88546346-88546368 GCCTATTATGTAATACTGAATGG - Intergenic
1045556574 8:103220121-103220143 TCCCATTATCTGAAACTTAATGG + Intronic
1045907498 8:107365071-107365093 TCACCTTATGTAGTACACAAGGG + Intronic
1046344957 8:112911863-112911885 TCTCATAATGTTATACATAATGG - Intronic
1047477809 8:125251663-125251685 TTCCATTGTCTAAGACATAACGG - Intronic
1049202859 8:141350361-141350383 TCCCATTATGTAAAACACCGAGG + Intergenic
1049933423 9:477740-477762 TGCCAATATGTAACACAGAAAGG + Intronic
1050857706 9:10381782-10381804 TAATATTATGTCATACATAATGG + Intronic
1054925113 9:70581075-70581097 TCTCATAATCTAATACACAAAGG - Intronic
1055214673 9:73844643-73844665 TGCTATTATGTAATAAATGAAGG - Intergenic
1056753530 9:89368300-89368322 TCCCATCATGGAAGACATGATGG - Intronic
1058133823 9:101285122-101285144 GCCCAGTATTTAATAGATAACGG + Intronic
1058302702 9:103396345-103396367 TGCCATTATATAATCCATAAAGG - Intergenic
1060188081 9:121575935-121575957 TCCCATGATGTAACAGAGAATGG - Intronic
1060360622 9:122952971-122952993 TTCCTTTCTGTGATACATAAAGG + Intronic
1186229773 X:7440605-7440627 TGCCATTATGGAAAACAGAATGG + Intergenic
1186520662 X:10203917-10203939 TCCCATTATGTATTACATAATGG + Intronic
1186520665 X:10203919-10203941 TCCCATTATGTAATACATAATGG - Intronic
1186967817 X:14807105-14807127 TTCTATTATGTAAGATATAATGG - Intergenic
1191624283 X:63252899-63252921 AGCCATTATGTAAAACATTATGG + Intergenic
1192036955 X:67574042-67574064 TCCCCATTTGTAAAACATAATGG + Intronic
1192074290 X:67975550-67975572 TCCCATTATGGAAAGCAGAAAGG - Intergenic
1194496110 X:94619392-94619414 TGCCATTAAATAATACATCAAGG - Intergenic
1199467569 X:148156488-148156510 TCCCATTTTGTCATTCAGAATGG + Intergenic
1200922330 Y:8624283-8624305 GCCCATTAATTAAAACATAATGG - Intergenic