ID: 1186522655

View in Genome Browser
Species Human (GRCh38)
Location X:10220077-10220099
Sequence AGGGGGGATGCAGCTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186522642_1186522655 20 Left 1186522642 X:10220034-10220056 CCACAAAATGGCCCATTTTTAAG 0: 1
1: 0
2: 3
3: 19
4: 261
Right 1186522655 X:10220077-10220099 AGGGGGGATGCAGCTTTTCTGGG 0: 1
1: 0
2: 1
3: 13
4: 212
1186522644_1186522655 9 Left 1186522644 X:10220045-10220067 CCCATTTTTAAGACAGGAGATCC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1186522655 X:10220077-10220099 AGGGGGGATGCAGCTTTTCTGGG 0: 1
1: 0
2: 1
3: 13
4: 212
1186522645_1186522655 8 Left 1186522645 X:10220046-10220068 CCATTTTTAAGACAGGAGATCCG 0: 1
1: 0
2: 1
3: 12
4: 79
Right 1186522655 X:10220077-10220099 AGGGGGGATGCAGCTTTTCTGGG 0: 1
1: 0
2: 1
3: 13
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186522655 Original CRISPR AGGGGGGATGCAGCTTTTCT GGG Intronic
900276599 1:1833695-1833717 AGGGAGGATGCTGCTTTGCATGG + Intronic
901032696 1:6317140-6317162 AGGCTGGGTGCAGCTGTTCTTGG - Intronic
901672309 1:10863026-10863048 AGGGGGTTTGCAGCCTGTCTCGG + Intergenic
907280444 1:53343842-53343864 AGAGGGGAAGCAGCTTTCCCGGG - Intergenic
909029631 1:70524106-70524128 AGGAAGGATGCAGTTTATCTAGG - Intergenic
911585672 1:99687856-99687878 AGGGGTGTTGCAGTTTTTCTTGG + Intronic
912700535 1:111875115-111875137 AGGAGGGTTGAAGCTGTTCTAGG + Intronic
912956442 1:114156913-114156935 AGGAGGGAGGCAGCCTTTCCTGG + Intergenic
915132929 1:153708474-153708496 AGGGTGGATCCAGGTTTTGTGGG + Intergenic
916011951 1:160714205-160714227 AGGGGTGTTACAGCTTTGCTTGG + Intergenic
916168260 1:161982271-161982293 AGGCCGGCTGCAGCTTGTCTGGG - Intergenic
917393596 1:174566906-174566928 AAGGCTGATGAAGCTTTTCTGGG - Intronic
918100620 1:181370154-181370176 AGTTGGAATGCAGCTTTTCAGGG - Intergenic
918354326 1:183692447-183692469 AGGGTGAATGAAGCTTCTCTGGG + Intronic
918925347 1:190778473-190778495 AGTGGGAATGGAGGTTTTCTGGG + Intergenic
919342954 1:196337160-196337182 AGGGGGAATGCAGGTTTTGCGGG - Intronic
922216692 1:223525919-223525941 AGTTGGGATGCAGCCTCTCTCGG + Intergenic
922786713 1:228286556-228286578 AGTGGGGATGCAGCCTGGCTCGG - Intronic
924812916 1:247418895-247418917 GAGGGGGATGCAGCCCTTCTGGG - Exonic
1064157854 10:12918538-12918560 AGGGGAAATGCAACTTTTATAGG - Intronic
1070514273 10:77189156-77189178 AATGGGGATGCTGCTTATCTGGG + Intronic
1072199789 10:93148234-93148256 ATGGGCCCTGCAGCTTTTCTGGG + Intergenic
1072769336 10:98124632-98124654 TGAGGGTCTGCAGCTTTTCTAGG + Intergenic
1075048902 10:119167114-119167136 AGAGCGGATGCAGATTTACTAGG - Intergenic
1075713485 10:124542954-124542976 AGTGGGGATGCAGCAGCTCTGGG + Intronic
1076141875 10:128086007-128086029 AGAGTGGATGCTGCTTGTCTAGG - Intergenic
1076899240 10:133328960-133328982 AGCTGGGCTGCAGCTTCTCTGGG - Exonic
1078349910 11:10584090-10584112 AGGTGGGCTGCAGGATTTCTAGG - Intronic
1081855340 11:46299888-46299910 AGAGGGAATTCAGCTTTGCTTGG - Intronic
1082067909 11:47915712-47915734 AGGAGGGATGCAGCTCATCCAGG - Intergenic
1082765363 11:57163444-57163466 AGGAAGGCTGCAGCTATTCTAGG + Intergenic
1084521919 11:69668491-69668513 AGGGAGGAAACAGCTTTGCTGGG + Intronic
1085183601 11:74556952-74556974 AGGGTGGATTCAGGTTTTGTGGG + Intronic
1085267151 11:75243640-75243662 AAGGGAGATCCAGATTTTCTGGG - Exonic
1085635250 11:78153994-78154016 CTGGGGGACTCAGCTTTTCTGGG + Intergenic
1088750367 11:112837493-112837515 ACCGAGGATGCAGCTTTCCTAGG - Intergenic
1090847391 11:130542325-130542347 AGAGGGGATGGAGATTTTCATGG - Intergenic
1091214703 11:133893645-133893667 GGGAGGGAGGCAGCCTTTCTTGG - Intergenic
1091250812 11:134142245-134142267 GGGGAGGATGCAGCTGTACTTGG + Intronic
1092206655 12:6618682-6618704 AGAGGGGATGGGGCTTCTCTGGG - Intergenic
1093289320 12:17301781-17301803 GGGGTGGATGCAGCTTTTCAAGG - Intergenic
1097486768 12:60212976-60212998 TGGGTGCTTGCAGCTTTTCTAGG - Intergenic
1097793464 12:63839502-63839524 AGGGGAGAGGCAGGTTTTCCCGG + Intergenic
1100055244 12:90501220-90501242 AAGGGGGAACCAGCTTTTCCAGG + Intergenic
1103363520 12:120367789-120367811 AGGGGGGATGTAGCATCTCATGG + Intronic
1103909605 12:124344997-124345019 AAGGGGGATGCAGCTGGTCTGGG - Intronic
1104207350 12:126652209-126652231 AGATGGGATGCAGTTTTTATGGG - Intergenic
1104458390 12:128934114-128934136 TGGAGGGCTGGAGCTTTTCTAGG + Intronic
1105070129 12:133229391-133229413 AGGGGGGATGGAGTTCTTTTGGG - Intronic
1106975074 13:35201803-35201825 AATGGAGATGCACCTTTTCTGGG - Intronic
1107722868 13:43267341-43267363 TGCGAAGATGCAGCTTTTCTAGG - Intronic
1110120743 13:71877536-71877558 CAGGTGGATGCAGCATTTCTAGG + Intergenic
1111594159 13:90389708-90389730 AGTGTGTCTGCAGCTTTTCTAGG - Intergenic
1114271559 14:21103440-21103462 AGGGAGAAAGCAGCTTTTCAGGG - Exonic
1116862137 14:50003353-50003375 GGGGTGGATGCAGCTTTGCGGGG + Intronic
1118511648 14:66481131-66481153 TGAGGAGATGCAGCTTTTCCAGG + Intergenic
1118770395 14:68939010-68939032 AGGGGGCCTGCAGCTTTTTCTGG + Intronic
1119162360 14:72463386-72463408 AGGTGGGATGTGGCTGTTCTTGG - Intronic
1119912911 14:78367326-78367348 AGGGACAATGCAGGTTTTCTTGG - Intronic
1120066897 14:80052810-80052832 AGTGGGGAGGCAACTTCTCTTGG - Intergenic
1121316504 14:92964173-92964195 TGGGGGGTTGCAGTTTCTCTGGG + Intronic
1122004083 14:98687881-98687903 AGGTGGGATGCAGCGTTTGGTGG - Intergenic
1122197321 14:100098390-100098412 GAGGGCGATGCAGCATTTCTGGG + Intronic
1122871856 14:104642384-104642406 CGGGGGGAGGAAGCTGTTCTCGG + Intergenic
1122937893 14:104968298-104968320 CTCGGGGAGGCAGCTTTTCTGGG - Intronic
1123131131 14:105986518-105986540 AGGGAGGAGGCAGCTGTGCTGGG - Intergenic
1123581368 15:21717744-21717766 AGGGAGGAGGCAGCTGTGCTGGG - Intergenic
1123618017 15:22160367-22160389 AGGGAGGAGGCAGCTGTGCTGGG - Intergenic
1126112989 15:45186640-45186662 AGGGAGGCTGGAGCTTTTCCTGG - Intronic
1126829555 15:52587024-52587046 AGTGGGGCTGCAGCTTTGTTTGG - Intronic
1128301260 15:66567628-66567650 TGGGGGGAGGCTGCTTTACTGGG + Intergenic
1128562399 15:68677494-68677516 AGCTGGGAGGCAGCTTTTCTGGG + Intronic
1128942721 15:71801743-71801765 CAGGGGGATGCTGCTTCTCTGGG + Intronic
1129263666 15:74382665-74382687 AGGTGGGAGGCAGGGTTTCTGGG + Intergenic
1129552358 15:76466767-76466789 GGGGGGGATACAACTTCTCTAGG + Intronic
1130296991 15:82654419-82654441 CGAGAGTATGCAGCTTTTCTTGG + Intergenic
1131084816 15:89567204-89567226 AGGGTGTATGCAGCTTCCCTGGG + Intergenic
1136227311 16:28867557-28867579 CCTGGGGCTGCAGCTTTTCTGGG + Intronic
1138567060 16:57841330-57841352 AGGAGGGTGGCAGCTCTTCTGGG - Intronic
1139812722 16:69636307-69636329 TGAGTGGCTGCAGCTTTTCTAGG + Intronic
1140410822 16:74739381-74739403 AGGGGAGAAGCAGCTTTGCCTGG - Intronic
1140457137 16:75112096-75112118 AGAGAGGAAGCAGCTTTGCTGGG + Exonic
1142307933 16:89295829-89295851 AGGGGGGATGCGACCTTCCTTGG + Intronic
1143384317 17:6518323-6518345 TGGCTGGATGCAGGTTTTCTGGG + Intronic
1143988425 17:10935692-10935714 AGGGGAGATGCATCTGCTCTAGG - Intergenic
1144325569 17:14176318-14176340 AGGGGAGCTGCACCTTCTCTGGG - Intronic
1144474445 17:15573206-15573228 AGGGGAGCTGCACCTTCTCTGGG - Exonic
1146103271 17:30006779-30006801 AGGGGGGATGCCACTTTGCCTGG + Intronic
1147167196 17:38599832-38599854 ATGGGGGAAACAGCTCTTCTAGG + Intronic
1147762833 17:42811755-42811777 TGGGGGGTTGCGGTTTTTCTGGG - Exonic
1148344627 17:46895042-46895064 AGGTGGGATCCAGCCTGTCTGGG - Intergenic
1149403256 17:56320722-56320744 AGGACGGATGAAGCTGTTCTTGG + Intronic
1150001694 17:61444364-61444386 TGGGGGGATGCAGCTGTCCAAGG - Intergenic
1151740487 17:75978910-75978932 AGGGAGTCTCCAGCTTTTCTCGG + Intronic
1152000349 17:77641382-77641404 AGGGGAGATGTAGCTTTGCCTGG + Intergenic
1152198265 17:78930119-78930141 CGGGAGGATGCTGCTCTTCTCGG + Intergenic
1152299195 17:79485433-79485455 AGTGGGGTTGGAGCTTCTCTTGG - Intronic
1156448392 18:37253376-37253398 CGGGCGGCTGCAGCTCTTCTGGG + Intronic
1156466552 18:37351356-37351378 AGGGGAGAGGCATCGTTTCTTGG - Intronic
1159551322 18:69898503-69898525 AGAGGGGATGCAGCTGTCTTTGG + Intronic
1160016230 18:75142834-75142856 AGGGGGGCTGCTGCCTTTTTCGG - Intergenic
1160786597 19:903033-903055 GGGTGGGCGGCAGCTTTTCTTGG - Intronic
1160927871 19:1555755-1555777 AGGGGGCTTGCGGCTGTTCTCGG + Exonic
1162302473 19:9851693-9851715 GGGGGGGATACAGATGTTCTAGG + Intergenic
926623584 2:15070620-15070642 AGGGGGCATGGAGTTTTTCATGG - Intergenic
927233087 2:20844506-20844528 AGGAGCTATGCTGCTTTTCTTGG + Intergenic
927717148 2:25360203-25360225 ATGGGGGAGCCACCTTTTCTAGG - Intergenic
932072397 2:68634445-68634467 AGGGGCGATGCAGCTGTACGCGG + Intergenic
932093337 2:68825812-68825834 TGTGGGGATTCAGGTTTTCTGGG + Intronic
934074530 2:88416490-88416512 AAGGAGGATGCAGATTTACTGGG + Intergenic
934088306 2:88528986-88529008 AGAGATGATGTAGCTTTTCTTGG - Intronic
935332067 2:101984703-101984725 AGGTGGGATGCAGGCTTCCTGGG + Intergenic
937223509 2:120355381-120355403 AGGGGAGGGGCAGCTGTTCTGGG + Intergenic
937463112 2:122106365-122106387 AGCGGGGAGGTATCTTTTCTTGG - Intergenic
937994670 2:127684080-127684102 AGTGGGGTTGCAGCTTCTCTTGG - Intergenic
938188909 2:129256696-129256718 GAGAGGGATGCAGCTTCTCTAGG + Intergenic
940603754 2:155893973-155893995 AGGTGGGATGCAGCTTCACATGG - Intergenic
940635412 2:156292780-156292802 AGGGCTGATGCAGCTTGTATAGG + Intergenic
942535196 2:176955966-176955988 AGGGGGGGTGCTGCTTTCCAGGG - Intergenic
945212442 2:207397696-207397718 AGGCAGGATGAAGATTTTCTGGG + Intergenic
948205456 2:236160657-236160679 AGGGGGCGTTCAGCTTTGCTGGG + Intergenic
1168984649 20:2037852-2037874 AGGAGGGATGCAGGCTATCTGGG - Intergenic
1170258522 20:14375573-14375595 ATGGGGGTTGGGGCTTTTCTAGG + Intronic
1171295716 20:24015078-24015100 AGCGGGGATGCTGCCTTTCATGG - Intergenic
1172613395 20:36267611-36267633 CGGGGGCAGGCAGCTTTTCAGGG + Intronic
1172637978 20:36422773-36422795 AGGGAGGCAGCAGCTTTGCTGGG + Intronic
1173590035 20:44217489-44217511 AGGGGAGGGGCAGCTTTTCCTGG + Intergenic
1175815620 20:61881802-61881824 GGTGTGGATGTAGCTTTTCTGGG - Intronic
1177768009 21:25480562-25480584 AGTGGTGGTGCAGCTTTGCTGGG - Intergenic
1177944001 21:27444602-27444624 AGGGAGGATGCAGATTTTGCAGG + Intergenic
1178381681 21:32114919-32114941 AGGAGGGCAGCAGCTGTTCTGGG - Intergenic
1181306681 22:21921132-21921154 AGCGGGGAGCCAGCTTTGCTGGG - Exonic
1182354904 22:29718543-29718565 AGTGGGGTGGGAGCTTTTCTGGG + Intergenic
1183705788 22:39474234-39474256 TGGGCAGATGCAGCTTTCCTGGG + Intronic
1183738493 22:39657075-39657097 AGGGGGGAAGCAACTTTCCCAGG + Intronic
1184614618 22:45629682-45629704 AGGGGCCATGCAGATATTCTGGG + Intergenic
950950203 3:16990994-16991016 AGAGGGGATGCAGCGTTTGCTGG + Intronic
952734755 3:36677934-36677956 TGGGGGGATGCAACTTTTCTGGG - Intergenic
953128479 3:40114011-40114033 AGCGTGGAGGCAGCCTTTCTAGG + Intronic
954290127 3:49645294-49645316 AGAGGGCCTGCAGCTATTCTAGG + Intronic
955399019 3:58577953-58577975 AGAGGGGATGCACCGTGTCTGGG + Intronic
956019574 3:64919820-64919842 AAGGGGGAAGAAGCTTTTATAGG - Intergenic
958610122 3:96414532-96414554 AGGTGGTATGCATATTTTCTGGG - Intergenic
959283815 3:104381417-104381439 AGAGGAGAAGAAGCTTTTCTTGG - Intergenic
959375133 3:105580501-105580523 AGGGGCGGGGCAGCTTTTGTTGG + Intergenic
959682279 3:109109164-109109186 AAGGGGTATACAGCTTTTCATGG - Intronic
961006537 3:123409459-123409481 AGGTGGGATGCAGCTTTCACAGG + Intronic
964441022 3:156710208-156710230 AGTGGGAATGCAGATTTTGTGGG + Intergenic
964897245 3:161613094-161613116 TGAGGGTCTGCAGCTTTTCTAGG - Intergenic
968649864 4:1756258-1756280 GGTGGGGGTGCAGCTTTGCTGGG - Intergenic
969664434 4:8549001-8549023 AGAGGGGAAGCAGTTTCTCTTGG - Intergenic
969928777 4:10610465-10610487 AGGGGGGAAAAAGCTTTTATGGG - Intronic
970003992 4:11393534-11393556 AGGGGGGATTCCTGTTTTCTTGG + Exonic
971335223 4:25717253-25717275 AGGGAGGATGAACCTTTTCCTGG + Intergenic
972991163 4:44823713-44823735 AGGGGGGAAACAGCGTTCCTTGG - Intergenic
973865291 4:55107013-55107035 AGGAGGGAAGCAGCTATTCTGGG + Intronic
973894808 4:55401061-55401083 AGGGGGGAAGCATCTCTCCTTGG + Intronic
975683176 4:76896568-76896590 AGAGGGGCTGCAGGTTGTCTTGG - Exonic
976512761 4:85930192-85930214 TGGGGGGAGGCAGCTTTGCAGGG - Intronic
976663807 4:87568482-87568504 AGGGTGGATCCAGGTTTTGTGGG + Intergenic
981260103 4:142708891-142708913 TGAGTGGCTGCAGCTTTTCTAGG - Intronic
982117501 4:152109696-152109718 CAGCAGGATGCAGCTTTTCTTGG + Intergenic
983064937 4:163197757-163197779 GGTGGGGAGGCATCTTTTCTAGG - Intergenic
983374020 4:166900453-166900475 AGAGGGTATGCTCCTTTTCTGGG - Intronic
983542958 4:168931759-168931781 AGTGGTGGTGCAGCTTTGCTGGG - Intronic
985965309 5:3335241-3335263 ATGGAGGATGCAGGTTTGCTGGG - Intergenic
986395092 5:7321508-7321530 AGGGGAGATTCTCCTTTTCTGGG - Intergenic
993739849 5:91524980-91525002 ATTGGTGATGCAGCCTTTCTAGG + Intergenic
995942951 5:117607347-117607369 AGCAGGAATGCAGCATTTCTGGG + Intergenic
996874648 5:128227375-128227397 AGGGAAGATACTGCTTTTCTGGG + Intergenic
997623984 5:135319332-135319354 ATGGGGCATGCAGGCTTTCTAGG - Intronic
1000168449 5:158678091-158678113 AGGGTGGAGGCACATTTTCTGGG - Intergenic
1000269789 5:159672999-159673021 TGAGAGGCTGCAGCTTTTCTAGG - Intergenic
1000381128 5:160630366-160630388 ACCAGGGATGCAGTTTTTCTGGG + Intronic
1001829248 5:174771704-174771726 AGGGGAAATGCAGCTTTTCATGG + Intergenic
1002353766 5:178606501-178606523 AGGGGGCATGCAGCTATGATGGG - Intronic
1004756690 6:18618097-18618119 CGAGTGTATGCAGCTTTTCTAGG + Intergenic
1005636937 6:27761810-27761832 AGAGGAGAAGCAGCTTTCCTTGG + Intergenic
1006517897 6:34554853-34554875 TGGGGAGATGCAGCTTTATTGGG + Intronic
1006527375 6:34618545-34618567 AGGAGGGAAGCATCTTTTGTAGG - Intronic
1007916607 6:45567191-45567213 AGAGGGGAGCCAGCGTTTCTTGG + Intronic
1011366946 6:86593063-86593085 GGGTAGGCTGCAGCTTTTCTTGG - Intergenic
1012448058 6:99326917-99326939 AAGGGAGAGGCAGCTGTTCTGGG + Intronic
1013149098 6:107426581-107426603 TGAGTGGCTGCAGCTTTTCTGGG - Intronic
1013251834 6:108342111-108342133 TGGAGGGATGCAGCTCTACTGGG + Intronic
1013768318 6:113598456-113598478 ATGGGAGACTCAGCTTTTCTGGG + Intergenic
1016880894 6:148911084-148911106 AGGGGGGATGCAGGGCCTCTGGG - Intronic
1016959581 6:149659516-149659538 AGGGGGAATACAGATTTTGTGGG + Exonic
1017120838 6:151022630-151022652 AGGGGGAAGACAGCTTTTCCAGG - Intronic
1017959272 6:159207561-159207583 AGAGGGGAAGCAGCTTTTGTGGG + Intronic
1018115448 6:160579363-160579385 AGGCAGGATGCTGCTTCTCTAGG + Intronic
1019617426 7:1971772-1971794 GCGTGGGATTCAGCTTTTCTGGG - Intronic
1022459708 7:30594073-30594095 AGGGGGAACCCAGCTTTTCTAGG + Intergenic
1023548892 7:41347651-41347673 AAGGGGTATGCAGATTTCCTTGG - Intergenic
1024002014 7:45196183-45196205 TGGGAGAATGCAGCGTTTCTGGG + Intergenic
1024058461 7:45681491-45681513 AGTGGGGGTCCAGCTTTCCTGGG + Intronic
1026901539 7:74040123-74040145 GGGGGGCAGGCAGCTTCTCTGGG - Intronic
1029131283 7:98333116-98333138 GGGTGGGATGCAGCTGTTTTAGG - Intronic
1031864612 7:127024856-127024878 GGGAGGGATGAGGCTTTTCTAGG - Intronic
1032487164 7:132296707-132296729 TGAGGGGAAGCAGCTTTCCTTGG - Intronic
1032792623 7:135253534-135253556 AGGGGGGTTGCTGCTTTTCATGG + Intronic
1034015049 7:147573781-147573803 AGGGGGGATGAAGACATTCTTGG - Intronic
1035351778 7:158252400-158252422 AGCGGGAATGGAGCCTTTCTAGG + Intronic
1038445095 8:27598168-27598190 TGGGGGGCTGCAGCTCATCTTGG + Exonic
1040287634 8:46108549-46108571 TGGGGCTTTGCAGCTTTTCTGGG + Intergenic
1042506793 8:69569458-69569480 AGGGGAGCTGCAGCTGCTCTCGG + Intronic
1044948595 8:97414359-97414381 GTGGGGGATGCTGCTCTTCTGGG - Intergenic
1046355759 8:113082306-113082328 AGACTGGATGCAGCTTTGCTGGG - Intronic
1046839266 8:118839309-118839331 AGGGTGGCTGGAACTTTTCTAGG + Intergenic
1048194111 8:132318000-132318022 TGGGTGGATGCTGCTTTACTGGG - Intronic
1051854116 9:21543014-21543036 TGGCAGGATGAAGCTTTTCTAGG + Intergenic
1051868484 9:21709274-21709296 AGGGGGCATGCAGTTATTCAGGG - Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056836898 9:89962754-89962776 AGGGTGGCTGCAGCTTCTATCGG + Intergenic
1056944701 9:90984329-90984351 AGGAGGGAGGTAGTTTTTCTTGG - Intergenic
1058905216 9:109477317-109477339 AGGGGGCAAGAAGGTTTTCTGGG - Intronic
1059744794 9:117189433-117189455 ATGGGGGATGCAGCGTTTGTGGG - Intronic
1060417175 9:123439139-123439161 TGGGGGGAGGCAGCTCTTCAGGG + Intronic
1060949953 9:127595175-127595197 AGGGAGGATCCAGGTTTTCTGGG - Intergenic
1062347346 9:136121104-136121126 GGGGCGGATGCAGGTTTTGTGGG + Intergenic
1186235410 X:7503213-7503235 AGGGAGGATGGAGCCTTACTTGG + Intergenic
1186522655 X:10220077-10220099 AGGGGGGATGCAGCTTTTCTGGG + Intronic
1187384612 X:18836763-18836785 AGAGGGGGTGCAGTGTTTCTGGG - Intergenic
1188293927 X:28422085-28422107 AGGGAGGATGCATCTTACCTTGG + Intergenic
1195903842 X:109825115-109825137 AGAGGGGATGGGGCCTTTCTGGG - Intergenic
1197805475 X:130394540-130394562 AGGGTGGATGCAGGTTTTCAAGG - Intergenic
1198930851 X:141858205-141858227 AGGATGCATGCAGCTTTTTTTGG + Intronic