ID: 1186522699

View in Genome Browser
Species Human (GRCh38)
Location X:10220346-10220368
Sequence CGGGCACCCCAAACAGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186522699_1186522705 11 Left 1186522699 X:10220346-10220368 CCCTGGGCTGTTTGGGGTGCCCG No data
Right 1186522705 X:10220380-10220402 GAAGCAGTGAATGTCCCCAAAGG No data
1186522699_1186522706 12 Left 1186522699 X:10220346-10220368 CCCTGGGCTGTTTGGGGTGCCCG No data
Right 1186522706 X:10220381-10220403 AAGCAGTGAATGTCCCCAAAGGG No data
1186522699_1186522708 21 Left 1186522699 X:10220346-10220368 CCCTGGGCTGTTTGGGGTGCCCG No data
Right 1186522708 X:10220390-10220412 ATGTCCCCAAAGGGGCCATCTGG No data
1186522699_1186522707 13 Left 1186522699 X:10220346-10220368 CCCTGGGCTGTTTGGGGTGCCCG No data
Right 1186522707 X:10220382-10220404 AGCAGTGAATGTCCCCAAAGGGG No data
1186522699_1186522709 22 Left 1186522699 X:10220346-10220368 CCCTGGGCTGTTTGGGGTGCCCG No data
Right 1186522709 X:10220391-10220413 TGTCCCCAAAGGGGCCATCTGGG No data
1186522699_1186522713 27 Left 1186522699 X:10220346-10220368 CCCTGGGCTGTTTGGGGTGCCCG No data
Right 1186522713 X:10220396-10220418 CCAAAGGGGCCATCTGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186522699 Original CRISPR CGGGCACCCCAAACAGCCCA GGG (reversed) Intronic