ID: 1186522703

View in Genome Browser
Species Human (GRCh38)
Location X:10220365-10220387
Sequence ACTGCTTCACCGCAGACTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186522703_1186522707 -6 Left 1186522703 X:10220365-10220387 CCCGGAGTCTGCGGTGAAGCAGT No data
Right 1186522707 X:10220382-10220404 AGCAGTGAATGTCCCCAAAGGGG No data
1186522703_1186522706 -7 Left 1186522703 X:10220365-10220387 CCCGGAGTCTGCGGTGAAGCAGT No data
Right 1186522706 X:10220381-10220403 AAGCAGTGAATGTCCCCAAAGGG No data
1186522703_1186522709 3 Left 1186522703 X:10220365-10220387 CCCGGAGTCTGCGGTGAAGCAGT No data
Right 1186522709 X:10220391-10220413 TGTCCCCAAAGGGGCCATCTGGG No data
1186522703_1186522715 28 Left 1186522703 X:10220365-10220387 CCCGGAGTCTGCGGTGAAGCAGT No data
Right 1186522715 X:10220416-10220438 AGGCCCATCTTGCCAGACTTTGG No data
1186522703_1186522705 -8 Left 1186522703 X:10220365-10220387 CCCGGAGTCTGCGGTGAAGCAGT No data
Right 1186522705 X:10220380-10220402 GAAGCAGTGAATGTCCCCAAAGG No data
1186522703_1186522713 8 Left 1186522703 X:10220365-10220387 CCCGGAGTCTGCGGTGAAGCAGT No data
Right 1186522713 X:10220396-10220418 CCAAAGGGGCCATCTGGGTCAGG No data
1186522703_1186522708 2 Left 1186522703 X:10220365-10220387 CCCGGAGTCTGCGGTGAAGCAGT No data
Right 1186522708 X:10220390-10220412 ATGTCCCCAAAGGGGCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186522703 Original CRISPR ACTGCTTCACCGCAGACTCC GGG (reversed) Intronic