ID: 1186522709

View in Genome Browser
Species Human (GRCh38)
Location X:10220391-10220413
Sequence TGTCCCCAAAGGGGCCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186522703_1186522709 3 Left 1186522703 X:10220365-10220387 CCCGGAGTCTGCGGTGAAGCAGT No data
Right 1186522709 X:10220391-10220413 TGTCCCCAAAGGGGCCATCTGGG No data
1186522699_1186522709 22 Left 1186522699 X:10220346-10220368 CCCTGGGCTGTTTGGGGTGCCCG No data
Right 1186522709 X:10220391-10220413 TGTCCCCAAAGGGGCCATCTGGG No data
1186522704_1186522709 2 Left 1186522704 X:10220366-10220388 CCGGAGTCTGCGGTGAAGCAGTG No data
Right 1186522709 X:10220391-10220413 TGTCCCCAAAGGGGCCATCTGGG No data
1186522700_1186522709 21 Left 1186522700 X:10220347-10220369 CCTGGGCTGTTTGGGGTGCCCGG No data
Right 1186522709 X:10220391-10220413 TGTCCCCAAAGGGGCCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186522709 Original CRISPR TGTCCCCAAAGGGGCCATCT GGG Intronic