ID: 1186522709

View in Genome Browser
Species Human (GRCh38)
Location X:10220391-10220413
Sequence TGTCCCCAAAGGGGCCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186522703_1186522709 3 Left 1186522703 X:10220365-10220387 CCCGGAGTCTGCGGTGAAGCAGT 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1186522709 X:10220391-10220413 TGTCCCCAAAGGGGCCATCTGGG 0: 1
1: 1
2: 0
3: 21
4: 138
1186522704_1186522709 2 Left 1186522704 X:10220366-10220388 CCGGAGTCTGCGGTGAAGCAGTG 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1186522709 X:10220391-10220413 TGTCCCCAAAGGGGCCATCTGGG 0: 1
1: 1
2: 0
3: 21
4: 138
1186522700_1186522709 21 Left 1186522700 X:10220347-10220369 CCTGGGCTGTTTGGGGTGCCCGG 0: 1
1: 0
2: 1
3: 9
4: 169
Right 1186522709 X:10220391-10220413 TGTCCCCAAAGGGGCCATCTGGG 0: 1
1: 1
2: 0
3: 21
4: 138
1186522699_1186522709 22 Left 1186522699 X:10220346-10220368 CCCTGGGCTGTTTGGGGTGCCCG 0: 1
1: 0
2: 0
3: 8
4: 134
Right 1186522709 X:10220391-10220413 TGTCCCCAAAGGGGCCATCTGGG 0: 1
1: 1
2: 0
3: 21
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186522709 Original CRISPR TGTCCCCAAAGGGGCCATCT GGG Intronic
900307421 1:2017941-2017963 TGTACCCAAAGGACCCCTCTCGG + Intergenic
901559588 1:10059490-10059512 TCTCCCGGAAGGGGCCATCATGG + Intronic
903630664 1:24767256-24767278 TGTCCCCACTGGGGTAATCTTGG + Intronic
910733194 1:90421293-90421315 TGGGTCCAAAGGTGCCATCTGGG - Intergenic
912321888 1:108721167-108721189 TGTCCTCAAAGAGGCCTTCCCGG + Intronic
914829390 1:151159592-151159614 TATCCCCAAAGGGGTTCTCTGGG - Exonic
914865899 1:151428340-151428362 TGGCCTCACAGGGGTCATCTGGG + Exonic
917233467 1:172864020-172864042 TGTCCCCAAAGGCCACACCTTGG + Intergenic
922698323 1:227743091-227743113 TGTCTCCTGAGGGGCCATGTGGG + Intronic
1067377329 10:45739867-45739889 TGTCCAGAAAGGGGCAAACTTGG + Intronic
1067885034 10:50080552-50080574 TGTCCAGAAAGGGGCAAACTTGG + Intronic
1070915103 10:80148483-80148505 TGGGCCCAAAGGTGCCATCTGGG - Intergenic
1072564054 10:96602799-96602821 TGTCCCAAATTGGGCCAACTTGG + Intronic
1073714704 10:106091020-106091042 CCTCCCCACAGGTGCCATCTGGG + Intergenic
1075389898 10:122084543-122084565 TGTTCCCGAAGGAGCCATCTGGG + Exonic
1076422720 10:130342580-130342602 TGTCCCCAAATGGTCCAGCTAGG - Intergenic
1076618051 10:131770033-131770055 TGTCCCCCAAGGGGCTATTATGG - Intergenic
1079514809 11:21254824-21254846 TATCCCCTCAGTGGCCATCTCGG - Intronic
1081749503 11:45499751-45499773 TGAACCCAAAGAGGCCATCATGG + Intergenic
1083895713 11:65618801-65618823 TGCCCCCCAAGCGGCCATATGGG + Exonic
1084212942 11:67632193-67632215 TGTCCACACAGGGGCCCTGTGGG + Intronic
1087847720 11:102992285-102992307 TTTCCACAGAGGGGCCATATTGG - Intergenic
1088551685 11:111019723-111019745 TCTCCCCACAGGAGACATCTCGG - Intergenic
1089223683 11:116897192-116897214 TGGGCCCAAAGTGGACATCTGGG - Exonic
1091150453 11:133323772-133323794 TGGCCACTAAGGGGCCATCCTGG + Intronic
1093190439 12:16068495-16068517 TTTCCTCAAAGGAGGCATCTTGG + Intergenic
1094719882 12:33052713-33052735 TGTCCCCCACGGGGCAAGCTGGG + Intergenic
1095271417 12:40224440-40224462 ATTCCTAAAAGGGGCCATCTGGG + Intronic
1099113094 12:78587038-78587060 GGTTCCCAGATGGGCCATCTAGG - Intergenic
1099584894 12:84503907-84503929 TGTCCAGTAAGGGGCCAACTTGG + Intergenic
1100461167 12:94800704-94800726 TGTACCCAAATAGGCCAACTGGG - Intergenic
1102973493 12:117190008-117190030 GGTCCCCAAATGGCGCATCTAGG - Intronic
1104257359 12:127151425-127151447 TCTCCCAAATGGGACCATCTAGG - Intergenic
1104997608 12:132668414-132668436 TGTTCCCAGAGGGGCCAGCTCGG - Exonic
1105575370 13:21646312-21646334 TGTCCCCAAAGGGCCTCTCTGGG + Intergenic
1107250134 13:38350069-38350091 CGGCCCCAAAAGGCCCATCTCGG - Exonic
1112449343 13:99494778-99494800 CGTCCCCAGAGTGGCCATTTTGG + Intergenic
1112967136 13:105210944-105210966 GGTCTCCAAAGGGTCCATATTGG - Intergenic
1114291626 14:21293288-21293310 TGTCCCCAAAGCTGCCTCCTAGG - Intronic
1115670610 14:35607840-35607862 GATCCCCAAAGGGTCCTTCTTGG - Intronic
1119922028 14:78455370-78455392 TCTCCCTAAGGGGACCATCTGGG - Intronic
1119933672 14:78570989-78571011 TGTCCCCACAGGGCCCAGCGGGG - Intronic
1119936358 14:78595733-78595755 TCTCCCCAAAAGAGCCATCTTGG - Intronic
1120037212 14:79711651-79711673 TTTCCCCAAAGGGGATATCTAGG - Intronic
1122214465 14:100193825-100193847 TGTCCCCAAACAGTCCAGCTGGG - Intergenic
1127920069 15:63487482-63487504 TGTCCCCTAGGGGGCGAGCTGGG + Intergenic
1128478868 15:68020254-68020276 TGGGCCCAAAGGGACCATGTGGG - Intergenic
1132118268 15:99154018-99154040 TGTCCCTAATGGGGTCATTTTGG - Intronic
1132408883 15:101561854-101561876 TGTCCAAAACGGGGCCCTCTGGG - Intergenic
1132669652 16:1097327-1097349 TGTCCCCAGAGGGGGCCGCTGGG - Intergenic
1134041584 16:11073014-11073036 TTGCCCCCAAGGAGCCATCTGGG - Intronic
1136270565 16:29146026-29146048 TGTCCCCACAGGGCCCATGTTGG + Intergenic
1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG + Intronic
1141881069 16:86859768-86859790 TGGAGCCAAATGGGCCATCTGGG + Intergenic
1142074153 16:88107837-88107859 TGTCCCCACAGGGCCCATGTTGG + Intronic
1142668285 17:1474897-1474919 TGTCCCCACAGGGGCCTGCGGGG - Intronic
1143374036 17:6457027-6457049 AGTCCCCACACAGGCCATCTTGG + Intronic
1145122880 17:20276827-20276849 TGACCCCAAAGGGGCCGACGGGG - Intronic
1145282025 17:21475148-21475170 TCTCCCCACAGAGGCCAGCTTGG - Intergenic
1145814847 17:27788117-27788139 TGTTCCCATAGGAGCCATATTGG - Intronic
1146946067 17:36874504-36874526 TGAGCCCTAAGGGGTCATCTGGG - Intergenic
1148347187 17:46911221-46911243 TGTGTCCAAAGGGACCAGCTTGG + Intergenic
1151286262 17:73113690-73113712 TGTACCCAAAGCTGCCATCAGGG + Intergenic
1151720684 17:75854264-75854286 AGTCCCCAAAGGAGACATCGTGG - Intronic
1152292875 17:79450433-79450455 TGTCCCCATCGGAGCCATCCTGG + Intronic
1152300903 17:79495001-79495023 TGTCCACGCAGTGGCCATCTGGG + Intronic
1152608073 17:81302954-81302976 TGGCCACACGGGGGCCATCTAGG + Intergenic
1154967625 18:21375591-21375613 TTTACCCAATTGGGCCATCTTGG + Intronic
1155909955 18:31495871-31495893 TGTCCCCTGCGGGGCCCTCTGGG + Intergenic
1157395577 18:47338128-47338150 TGACCCAAATGGGCCCATCTGGG - Intergenic
1158557710 18:58489028-58489050 TTTCCCAAAAGCGGCCATCTTGG + Intronic
1158721018 18:59924805-59924827 TCTCTTCCAAGGGGCCATCTGGG + Intergenic
1160983225 19:1826296-1826318 TGTCCCCAAATTGGCCACCAGGG - Intronic
1161197343 19:2994129-2994151 TGGCCCCAAAGGGACCAGCCTGG + Intronic
1161481394 19:4512504-4512526 TGTGGCCAAAGGGGCCGTCCAGG - Exonic
1163622372 19:18368757-18368779 TGTCTCCAAAAGGGACGTCTAGG - Exonic
1163885797 19:19963688-19963710 TGTCCCCTGGGGGGCCCTCTGGG + Intergenic
1163888697 19:19991982-19992004 TGTCCCCTGGGGGGCCCTCTGGG - Intergenic
1163935261 19:20436613-20436635 TGTCCCCTGGGGGGCCCTCTGGG + Intergenic
1163949461 19:20570502-20570524 TGTCCCCTGGGGGGCCCTCTGGG + Intronic
1163968618 19:20771399-20771421 TGTCCCCTGGGGGGCCCTCTGGG - Intronic
1164682310 19:30144126-30144148 GGTCCCCAACCTGGCCATCTGGG - Intergenic
1167017584 19:46850916-46850938 TTTCACCAAAGGGGCCAGCCTGG + Exonic
927854421 2:26518959-26518981 TTTCCCATATGGGGCCATCTGGG - Intronic
929561188 2:42957589-42957611 TGTCTCCACTGTGGCCATCTGGG - Intergenic
937244637 2:120484808-120484830 TGTCCCCACAGGGGCCAGGGTGG + Intergenic
937908870 2:127065680-127065702 TGTCCCCACCGTTGCCATCTGGG - Intronic
940211851 2:151262929-151262951 TGTCCCCACAGGCGCCATTCGGG - Intergenic
942514520 2:176737910-176737932 TGGCCCAAAAGGGGGCACCTGGG - Intergenic
944199629 2:197091978-197092000 TGTCCCTTAAGGGGTCATCCTGG - Intronic
947154318 2:227146172-227146194 TGGCCCCGAGGGGGCCAGCTCGG + Intronic
947458788 2:230283746-230283768 TGTCCTCAAACTGGCCATCTGGG - Intronic
948597924 2:239092364-239092386 TGTCCCCACAGGGGCAGCCTCGG - Intronic
1168790345 20:572061-572083 TTTCCCCAGAGGGTCCCTCTGGG + Intergenic
1173115559 20:40239273-40239295 TGTCCCCAATGGCGTGATCTCGG + Intergenic
1176264157 20:64199989-64200011 TGTCCCAAACGGGGTCTTCTTGG + Intronic
1176338631 21:5622213-5622235 TGTCCCCTGGGGGGCCCTCTGGG - Intergenic
1176340039 21:5685286-5685308 TGTCCCCTGGGGGGCCCTCTGGG - Intergenic
1176472293 21:7117439-7117461 TGTCCCCTGGGGGGCCCTCTGGG - Intergenic
1176495854 21:7499217-7499239 TGTCCCCTGGGGGGCCCTCTGGG - Intergenic
1176504788 21:7639170-7639192 TGTCCCCTGGGGGGCCCTCTGGG + Intergenic
1182275025 22:29182629-29182651 GGGCCCCAAAGGGATCATCTTGG - Intergenic
1183494985 22:38138060-38138082 TGTCCCCACACAGGCCATCCTGG - Intronic
1185294084 22:50044890-50044912 TCTCCCCAAAGGGGCCCCGTGGG - Intronic
952203066 3:31151246-31151268 TGGGTCCAAAGGTGCCATCTGGG + Intergenic
961665476 3:128491250-128491272 TGGTCCCAAAGGGGCCGCCTCGG - Intronic
961824590 3:129592463-129592485 TATGCCCAAAGGTGTCATCTGGG - Intronic
967867615 3:194203549-194203571 TCTGCCCACAGGGGCCTTCTAGG + Intergenic
968027101 3:195451574-195451596 AGTCCACACAGGGGCCATCCGGG - Intergenic
968073721 3:195804337-195804359 AGTCACCAGAGGGGCCATCTGGG - Intronic
969347042 4:6576168-6576190 TGACCCCAAAGGGGCCTGCTGGG - Intronic
973309959 4:48698482-48698504 TGTCCCAAAAGTGGTTATCTTGG + Intronic
975584955 4:75940403-75940425 TGGTCCCAAAGGGGCAAGCTTGG + Intronic
976337599 4:83908534-83908556 TGTTCCCGAAAGGGCCATTTTGG + Intergenic
987120766 5:14764425-14764447 TGTCCCAACAGAGGCCATCTAGG + Intronic
989358668 5:40574185-40574207 TGTACCCAAAATGGCCACCTTGG + Intergenic
990336199 5:54775017-54775039 CCTCCCCAAAGGGGCCATGTTGG - Intergenic
998390665 5:141785234-141785256 TGACCCCAAAGCAGCCACCTCGG + Intergenic
1006078017 6:31546781-31546803 AGTACCCAAAGGGGCCGCCTGGG + Exonic
1006770448 6:36548272-36548294 TGCCTGCAAAGGGGCCATCTAGG + Intergenic
1007142172 6:39587162-39587184 TGTCCCGAAAGGAGGCACCTGGG + Intronic
1009906350 6:69874042-69874064 TGTCCCCACAGGTCCCAGCTAGG - Intronic
1013944241 6:115703736-115703758 TGTCTCCACAGGAGCCATCCTGG - Intergenic
1015270279 6:131330988-131331010 TGTCCTTAAAGAGGCCTTCTTGG + Intergenic
1017739753 6:157396265-157396287 TGTCCCACAAGGGGACAGCTAGG + Intronic
1020033888 7:4952120-4952142 TGTTCCCCAAGGGGCCAGCATGG - Intronic
1023942956 7:44781837-44781859 TGTCCCCCATGGGGCAATCTCGG + Intergenic
1023986458 7:45100002-45100024 TGTCCCTAAAGCAGCCCTCTTGG + Intergenic
1024237437 7:47408961-47408983 TGTCCCCAACGGGATCCTCTAGG + Intronic
1026841684 7:73672785-73672807 TTTCTCCAAAGGTGCCATTTGGG - Intergenic
1027265425 7:76492567-76492589 TTTCCTTAAAGGGGCCCTCTGGG + Intronic
1027316796 7:76990684-76990706 TTTCCTTAAAGGGGCCCTCTGGG + Intergenic
1029452405 7:100648538-100648560 TGTCCCCAGAGGCCCCACCTTGG + Exonic
1033724760 7:144103279-144103301 TGTCTCTAAAGGGGCCTCCTTGG - Intergenic
1034511494 7:151539059-151539081 TGTGCCCTAAGGGTCCCTCTGGG + Intergenic
1035269308 7:157710617-157710639 TGTCCCCCCAGGGGACATCTGGG - Intronic
1036158344 8:6363309-6363331 TGCCCCCAAAGTGGCCATTTCGG - Intergenic
1036564298 8:9925170-9925192 TGTCTCCAAGGGGACCCTCTGGG - Intergenic
1039419457 8:37423838-37423860 AGGCCCCAAAGGGAGCATCTGGG + Intergenic
1041272502 8:56122907-56122929 TGTCTCCTGTGGGGCCATCTGGG - Intergenic
1042704255 8:71650117-71650139 ACTCCCCAAAGAGGCCTTCTTGG - Intergenic
1046387849 8:113526596-113526618 TGTCCTCTAATGGGCAATCTAGG - Intergenic
1046921923 8:119739643-119739665 TGGCTCTAAGGGGGCCATCTAGG + Intronic
1049255262 8:141610391-141610413 TGTGCCCAGAGGGGCCAACAGGG - Intergenic
1055340191 9:75273251-75273273 CGTCCCCAGAGCGGCCATTTTGG + Intergenic
1057553150 9:96066836-96066858 TGTCCCCAAAGGGGGCATGGGGG - Intergenic
1061319494 9:129819275-129819297 TGTCATCAAAGGGGCAATGTGGG + Intronic
1062021796 9:134323080-134323102 TGTCCCCAAAGGAGCCACAACGG + Intronic
1203793088 EBV:161927-161949 TGTCCCCAGCGGGGCCAGCGCGG - Intergenic
1203423028 Un_GL000195v1:12707-12729 TGTCCCCTGGGGGGCCCTCTGGG + Intergenic
1186522709 X:10220391-10220413 TGTCCCCAAAGGGGCCATCTGGG + Intronic
1188802510 X:34549519-34549541 TCTCCCCAAAGGGGGAAACTTGG + Intergenic
1189417130 X:40825261-40825283 TGTCTCCAATGTGGCCTTCTGGG + Intergenic
1191103956 X:56760776-56760798 TTTCCCCAAAGTGACCATGTAGG - Intergenic
1191111146 X:56803888-56803910 TTTCCCCAAAGAGACCATGTAGG - Intergenic
1192318567 X:70069808-70069830 TGTCCCCAGAGGGGCACTTTTGG - Intergenic
1195663495 X:107405988-107406010 TGTCCTCAAGGGGGCTAGCTTGG - Intergenic
1196109127 X:111927256-111927278 TGTCCCCAAGGGGGACATTTTGG - Intronic
1197544541 X:127808739-127808761 TGTTTCCAAAGGTGCCATCCAGG - Intergenic
1198935299 X:141897444-141897466 TGTCCCCGAGGAGGTCATCTGGG + Exonic
1200737004 Y:6810770-6810792 TGTCCCCAAAGGGGCTATCTTGG + Intergenic