ID: 1186523768

View in Genome Browser
Species Human (GRCh38)
Location X:10228951-10228973
Sequence GGGATGCTGCTGCATCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186523766_1186523768 -8 Left 1186523766 X:10228936-10228958 CCATAATGGGGGATGGGGATGCT 0: 1
1: 1
2: 0
3: 17
4: 154
Right 1186523768 X:10228951-10228973 GGGATGCTGCTGCATCTAGTGGG 0: 1
1: 0
2: 3
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186523768 Original CRISPR GGGATGCTGCTGCATCTAGT GGG Intronic
900742910 1:4341602-4341624 GGGATGATGCTGCATTTATCAGG - Intergenic
900931326 1:5739727-5739749 GGGAGGCTGCTGCCTCGAGTGGG + Intergenic
902820523 1:18940467-18940489 GGGATGATGCTGCATGAACTGGG - Intronic
904212222 1:28893553-28893575 GGGACGCTGCTGCCTCTAGTGGG + Intronic
904733382 1:32611973-32611995 AGGACGGTGCTGGATCTAGTCGG - Intronic
905930425 1:41783075-41783097 GGGATGCAGCTGACTCTGGTGGG + Intronic
906102692 1:43273212-43273234 GGCCTGCTGCTGTATCAAGTGGG + Exonic
906255296 1:44344535-44344557 GGGATGCTGCTGCAGGGAGCAGG - Intronic
914708053 1:150187688-150187710 GGAGTGCTACTGCATCAAGTGGG - Intergenic
916664046 1:166949199-166949221 GGGATGCTGTGGCATCTAGTGGG - Intronic
917537836 1:175887481-175887503 GGGAAGCTGCTGCCTTTCGTGGG - Intergenic
921760628 1:218909769-218909791 TGAATGCTGCTGCCACTAGTAGG + Intergenic
922360013 1:224812568-224812590 GGGATGCTGCTGCAACCTCTTGG - Intergenic
1067233144 10:44425920-44425942 GGGATTCTGCACCTTCTAGTAGG - Intergenic
1068013885 10:51489436-51489458 GTGATGCTGATGCTGCTAGTTGG - Intronic
1068904385 10:62307022-62307044 GGCCTGCAGCAGCATCTAGTGGG + Intergenic
1068917382 10:62446892-62446914 AGGATGCTCCTGAATCAAGTGGG + Intronic
1069630770 10:69895736-69895758 GGGATGGTGGTGCGTCTGGTGGG + Intronic
1074410248 10:113221953-113221975 GGGATCCTGCTGCAGTTAGGAGG - Intergenic
1074729861 10:116359553-116359575 AGGGTGCTACTGCATCTAGTGGG - Intronic
1075092940 10:119453605-119453627 GGCGTGTTGCTGCATCTGGTGGG - Intronic
1078590027 11:12632537-12632559 TGTATACTGCTACATCTAGTAGG - Intergenic
1079066573 11:17299315-17299337 GTGATGCTGATGCTTCCAGTTGG + Intronic
1079256706 11:18837360-18837382 TGACTGCTGCTGCTTCTAGTCGG - Intergenic
1079336914 11:19578066-19578088 GGGACGCTGCTGGATTTAATAGG - Intronic
1080421531 11:32115500-32115522 GGGATTCTGCAGGATCTAGCAGG + Intergenic
1081570217 11:44286149-44286171 AGGAGGCTGCTGCATGGAGTCGG + Intronic
1081631175 11:44691033-44691055 GGGATGCTGCTGGATCTCAGGGG + Intergenic
1082048575 11:47751470-47751492 GGAGTGCTACTGTATCTAGTGGG - Intronic
1084333753 11:68445424-68445446 GGGATCCTGCTGCAGCCAGAAGG + Intronic
1088004727 11:104926796-104926818 GATTTGCTGCTGCTTCTAGTTGG - Intergenic
1088979903 11:114852880-114852902 AGGATGCTATTGCATCTAGTGGG - Intergenic
1089663344 11:120000364-120000386 GTGATGCCCGTGCATCTAGTGGG - Intergenic
1090324918 11:125877095-125877117 AGAGTGCTGCTGCATCTAGTGGG + Intergenic
1090364705 11:126196329-126196351 GGGATGCAGATACATCTAGGAGG + Intergenic
1092132043 12:6119474-6119496 GGGAGGGTGCTGCATGTGGTGGG - Intronic
1095298383 12:40553319-40553341 GATATGCTGCTGGATTTAGTTGG + Intronic
1095906382 12:47382478-47382500 AGGATGCTACCCCATCTAGTGGG + Intergenic
1097184800 12:57190819-57190841 GGGATGCTGCTCATTCCAGTTGG - Exonic
1099937030 12:89138600-89138622 GTGATGCTGATGCTTCTGGTTGG - Intergenic
1102800296 12:115726674-115726696 ATGATGCTGCTGAATCCAGTGGG - Intergenic
1109722169 13:66288977-66288999 TGGATGCTGCTGTAGCTACTAGG - Intergenic
1118000634 14:61519730-61519752 GGAATGCTGCTGCTTTTAGTAGG + Intronic
1121223854 14:92306954-92306976 GTGATGCTGCTGCTGCTGGTTGG + Intergenic
1121226290 14:92323879-92323901 GAGATGCTGCCGCAGCAAGTCGG + Exonic
1125718001 15:41830606-41830628 AGGCTGCAGCTGCATCTAGGAGG - Intronic
1127647805 15:60975181-60975203 TGGAAGCTGCTGCACCTAGCAGG + Intronic
1129721053 15:77878277-77878299 CGGAGGCTGCTGCATACAGTAGG - Intergenic
1129773384 15:78217090-78217112 GGAATTCTGCTGCATCAGGTAGG + Intronic
1131558635 15:93420449-93420471 GGGATAGTGTTGCTTCTAGTGGG + Intergenic
1132376879 15:101334035-101334057 GGGATGCTGTTTCATGTAGGAGG - Intronic
1133020818 16:2966258-2966280 GGAACGCTGCTGCATCTGGGAGG + Intronic
1133800689 16:9082695-9082717 GGGTTGCTGCCACATCTAGTGGG - Intergenic
1135154720 16:20042471-20042493 GGAATGCAGCTGCAACTAGAGGG - Intronic
1141506166 16:84480067-84480089 AGGAAGCTGCTGCCTCTTGTTGG - Intronic
1141663147 16:85452572-85452594 GGGGTGCTGCTGCATCTCAAAGG + Intergenic
1145045829 17:19614983-19615005 GGGAGGATGCTGTTTCTAGTAGG + Intergenic
1146368570 17:32249267-32249289 GGGAGGCTTCAGCATATAGTTGG - Intronic
1148777702 17:50104917-50104939 GGGGTGTTGTTGCATCCAGTGGG - Intronic
1148875879 17:50686895-50686917 GGGATGCTGTGGCCTCTGGTTGG + Intronic
1149604373 17:57914529-57914551 GGGATCCTGTTGCATCCATTTGG + Intronic
1149986780 17:61353422-61353444 GTGATGCTGCTGCTGCTGGTGGG + Intronic
1156530114 18:37806651-37806673 TGATTGCTGCTGCTTCTAGTTGG + Intergenic
1157576059 18:48744255-48744277 GGGGTCCTGCTGCACCTAGCAGG - Intronic
1157719254 18:49911107-49911129 AGGTAGCTGCTGCATCTAGCTGG - Intronic
1158571696 18:58601972-58601994 GGGGTGCTACTGCATCTGGCGGG - Intronic
1166235096 19:41449973-41449995 GGGATGCAGCAGCCTCTAGAAGG + Intergenic
1168387124 19:55973546-55973568 AGGATGCTTCTGCATCCAGAGGG + Intronic
925433297 2:3815453-3815475 CGAATGCTGCTGCTTCTAGTTGG + Intronic
926075836 2:9942077-9942099 GGGAGGATGCTGCATATTGTGGG - Intergenic
928624206 2:33122703-33122725 GGGATGGGGCAGCATATAGTGGG + Intronic
929405444 2:41636842-41636864 GGATCGCTGCTGCTTCTAGTTGG - Intergenic
929462984 2:42118169-42118191 GTGATGCTGATGCTGCTAGTTGG - Intergenic
930552550 2:52853058-52853080 TGATTGCTGCTGCTTCTAGTGGG + Intergenic
935213921 2:100961063-100961085 GGGCTGCTCCTGCAGTTAGTGGG + Intronic
938702377 2:133891083-133891105 ACGATGCTACTACATCTAGTGGG + Intergenic
938714896 2:134010204-134010226 TGGCTGCTTCTGCATCTGGTGGG - Intergenic
940282542 2:152002748-152002770 TTGATGCTGCTGTATCTATTTGG - Intronic
941873342 2:170408514-170408536 GGGATTCTGCTGCTTTTAGCTGG + Intronic
944354745 2:198773900-198773922 GGGAAGCTGCTGCCTCCAGCAGG - Intergenic
945948575 2:216017567-216017589 CAGATGCTGCTGCATGTGGTTGG - Intronic
948992168 2:241560739-241560761 CGCCTGCTGCTGCCTCTAGTCGG + Intronic
1170737296 20:19022984-19023006 GGCATGCAGCTGCAGCTGGTGGG - Intergenic
1172287224 20:33749230-33749252 GGGAAGCTGCTACGTCTAGGTGG + Intronic
1172489435 20:35323395-35323417 GGGATGCTATTACATCTACTTGG - Intronic
1172917880 20:38457413-38457435 GGAAGGCTGCTGCATCTTGTGGG + Intergenic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1175374319 20:58514321-58514343 GGGATCCTCCTGCATCTTCTTGG + Intronic
1176093685 20:63329928-63329950 GGGAGTCTGCTGCACCTCGTGGG + Intronic
1176720061 21:10385366-10385388 GCGATGCTGGAGCTTCTAGTGGG - Intergenic
1177879044 21:26669958-26669980 TGAATGCTGCTGCTTCTAGGTGG + Intergenic
1178291691 21:31373931-31373953 AGGATGCTGCTGCTTCCAGAGGG - Intronic
1179086568 21:38223451-38223473 GGGATGCTGTGAAATCTAGTTGG + Intronic
1180240352 21:46499319-46499341 GGGAAGCTGGTGCATGCAGTAGG + Intronic
1180320131 22:11312606-11312628 GGGACACAGCTGCTTCTAGTCGG - Intergenic
1182782252 22:32877537-32877559 GGAGTGCTGCTGCGTCTAGTGGG - Intronic
1185159492 22:49214657-49214679 GGGTTGCTGTTGCATGCAGTAGG + Intergenic
949905611 3:8856060-8856082 GCTGTGCTGTTGCATCTAGTGGG + Intronic
950604298 3:14064732-14064754 GGGCTGCTGCTGCTACTACTGGG - Exonic
950604301 3:14064753-14064775 GGGCTGCTGCTGCTGCTACTGGG - Exonic
953013933 3:39054372-39054394 GAGATGCTACTACATCTAGTTGG - Intronic
953336740 3:42099964-42099986 AGGATGCAGCACCATCTAGTGGG + Intronic
954664366 3:52244055-52244077 TGGATGCTGCTTCATCCAGCTGG - Intergenic
955102359 3:55862780-55862802 GTGATCCTGCTGCATGTGGTGGG - Intronic
955106820 3:55906472-55906494 GTGATGCTGCTGCTGCTGGTTGG - Intronic
956469422 3:69550700-69550722 TAGAGGCTACTGCATCTAGTAGG - Intergenic
958019761 3:87980980-87981002 GGGCTGCTGCTGCACCTGGGGGG + Intergenic
959050710 3:101522494-101522516 GGGGTGTTGCTGCATCTTTTTGG - Intergenic
970467320 4:16338138-16338160 GGGATGCTGCTGATTTAAGTTGG + Intergenic
972511543 4:39771751-39771773 GGGATGCTGATGCTGCTGGTTGG + Intronic
975399151 4:73914459-73914481 GGGATGCTACTGGAACTATTGGG - Intergenic
978656706 4:111074255-111074277 CGAAAGCTGCTGCTTCTAGTTGG - Intergenic
980534831 4:134104435-134104457 AGGATTCTGCTGTATGTAGTAGG - Intergenic
981487369 4:145301458-145301480 AGGATGGTGCTGCATCTCATAGG + Intergenic
986979771 5:13434022-13434044 GTCATGCTGCTGAATCTACTGGG - Intergenic
987650347 5:20732889-20732911 GGAATGCTGATGCAACAAGTGGG + Intergenic
988745204 5:34128578-34128600 GGAATGCTGATGCAACAAGTGGG - Intergenic
992351069 5:75929401-75929423 GGGAAGCTGCGGCATCTGCTTGG + Intergenic
995024760 5:107407240-107407262 GGGCTGCTGCTGCTCCTACTCGG - Intronic
995264305 5:110139653-110139675 TGACTGCTGCTGCTTCTAGTTGG + Intergenic
996403325 5:123085825-123085847 TGGGTGCTCCTGCTTCTAGTAGG - Intergenic
999988480 5:157027230-157027252 AGGATGCAGCCCCATCTAGTGGG + Intergenic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1005543328 6:26836327-26836349 GGAATGCTGATGCAACAAGTGGG - Intergenic
1007285089 6:40741833-40741855 AGGATTCTGGTGAATCTAGTAGG - Intergenic
1007688079 6:43679220-43679242 GGAGTGCTACTGCATCTAGCAGG + Intronic
1007714461 6:43847710-43847732 GGGATAGTGCTGCATCCAGCTGG + Intergenic
1009014152 6:57878497-57878519 GGAATGCTGATGCAGCAAGTGGG - Intergenic
1010166209 6:72917984-72918006 GGGGTGCTATTGCGTCTAGTGGG - Intronic
1011557981 6:88588852-88588874 GGGATTCTGCTGATTCTGGTGGG + Intergenic
1012062922 6:94511276-94511298 GGATTGCTGCTGCTTCTATTCGG - Intergenic
1014319177 6:119905301-119905323 GGGATGCTTCTGGAGCTAGATGG - Intergenic
1017575561 6:155798556-155798578 GGGATGCTGCTGCAGGTGGATGG + Intergenic
1020208042 7:6134639-6134661 GTGATGCTGCAGCATCTAGTGGG - Intronic
1022634520 7:32119507-32119529 TGGTTGCAGCTGCTTCTAGTCGG - Intronic
1022916532 7:34961091-34961113 GGGATTGTGCTGAATCAAGTTGG - Intronic
1022953930 7:35364216-35364238 GGGATGCTGATGCTTCTGGTTGG + Intergenic
1025102343 7:56146008-56146030 GGAATGTTGCTGTTTCTAGTCGG + Intergenic
1025248226 7:57334039-57334061 GGCATGCTACTGCATCTAGATGG + Intergenic
1025943732 7:66091145-66091167 GTGATGCTGGTGCTGCTAGTTGG - Intronic
1026107459 7:67432546-67432568 TGGATGCTGCTGCTCCCAGTTGG + Intergenic
1032463737 7:132130372-132130394 GGGATGCTGCTGATGCCAGTCGG + Exonic
1033252699 7:139775054-139775076 GGGGTGCTGCTGCACCAAGTTGG - Intronic
1038254153 8:25935196-25935218 GGGGTGTTGCTGCAGCCAGTTGG + Intronic
1039686052 8:39802397-39802419 CGAATGCTGCTGCTTCAAGTCGG + Intronic
1047544055 8:125797983-125798005 GGGCTCCTGCTGCATCAACTTGG + Intergenic
1050537200 9:6641203-6641225 GGGAGGCTGCTGGAGGTAGTGGG - Intronic
1050618374 9:7426811-7426833 TGATTGCTGCTGCTTCTAGTTGG + Intergenic
1052407532 9:28081174-28081196 AAGGTGCTACTGCATCTAGTGGG - Intronic
1052989776 9:34512403-34512425 GGGTTGCAGCTGCACCCAGTGGG + Exonic
1062067787 9:134538032-134538054 CGGAGGCTGCTGCATCTCGGCGG - Intergenic
1062216751 9:135393432-135393454 GGGGAGCTGCTGCCTCAAGTGGG + Intergenic
1186242615 X:7586362-7586384 GGGAATCTTCTGAATCTAGTTGG - Intergenic
1186523768 X:10228951-10228973 GGGATGCTGCTGCATCTAGTGGG + Intronic
1189364821 X:40380345-40380367 GGGCTGCTGCCGCATCTGGAGGG + Intergenic
1190827744 X:54033029-54033051 TGGATCCTGCTGTCTCTAGTCGG - Intronic
1201192428 Y:11456679-11456701 TGTATGCTACTGCATTTAGTGGG - Intergenic