ID: 1186525276

View in Genome Browser
Species Human (GRCh38)
Location X:10242597-10242619
Sequence GGGGTGCGATGGCATCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186525276_1186525285 28 Left 1186525276 X:10242597-10242619 CCCACTAGATGCCATCGCACCCC No data
Right 1186525285 X:10242648-10242670 CCAGACGTTGCCAAGTGTCCTGG No data
1186525276_1186525286 29 Left 1186525276 X:10242597-10242619 CCCACTAGATGCCATCGCACCCC No data
Right 1186525286 X:10242649-10242671 CAGACGTTGCCAAGTGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186525276 Original CRISPR GGGGTGCGATGGCATCTAGT GGG (reversed) Intergenic
No off target data available for this crispr