ID: 1186525276 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:10242597-10242619 |
| Sequence | GGGGTGCGATGGCATCTAGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1186525276_1186525285 | 28 | Left | 1186525276 | X:10242597-10242619 | CCCACTAGATGCCATCGCACCCC | No data | ||
| Right | 1186525285 | X:10242648-10242670 | CCAGACGTTGCCAAGTGTCCTGG | No data | ||||
| 1186525276_1186525286 | 29 | Left | 1186525276 | X:10242597-10242619 | CCCACTAGATGCCATCGCACCCC | No data | ||
| Right | 1186525286 | X:10242649-10242671 | CAGACGTTGCCAAGTGTCCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1186525276 | Original CRISPR | GGGGTGCGATGGCATCTAGT GGG (reversed) | Intergenic | ||