ID: 1186526742

View in Genome Browser
Species Human (GRCh38)
Location X:10255710-10255732
Sequence GAGCAAGCTGCCACTGTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186526742_1186526749 14 Left 1186526742 X:10255710-10255732 CCACTAACAGTGGCAGCTTGCTC No data
Right 1186526749 X:10255747-10255769 GGCCACACAAACCCAGGTGGTGG No data
1186526742_1186526750 15 Left 1186526742 X:10255710-10255732 CCACTAACAGTGGCAGCTTGCTC No data
Right 1186526750 X:10255748-10255770 GCCACACAAACCCAGGTGGTGGG No data
1186526742_1186526748 11 Left 1186526742 X:10255710-10255732 CCACTAACAGTGGCAGCTTGCTC No data
Right 1186526748 X:10255744-10255766 GTGGGCCACACAAACCCAGGTGG No data
1186526742_1186526747 8 Left 1186526742 X:10255710-10255732 CCACTAACAGTGGCAGCTTGCTC No data
Right 1186526747 X:10255741-10255763 TCTGTGGGCCACACAAACCCAGG No data
1186526742_1186526752 19 Left 1186526742 X:10255710-10255732 CCACTAACAGTGGCAGCTTGCTC No data
Right 1186526752 X:10255752-10255774 CACAAACCCAGGTGGTGGGATGG No data
1186526742_1186526754 25 Left 1186526742 X:10255710-10255732 CCACTAACAGTGGCAGCTTGCTC No data
Right 1186526754 X:10255758-10255780 CCCAGGTGGTGGGATGGATTTGG No data
1186526742_1186526744 -8 Left 1186526742 X:10255710-10255732 CCACTAACAGTGGCAGCTTGCTC No data
Right 1186526744 X:10255725-10255747 GCTTGCTCCAGCAAGGTCTGTGG No data
1186526742_1186526745 -7 Left 1186526742 X:10255710-10255732 CCACTAACAGTGGCAGCTTGCTC No data
Right 1186526745 X:10255726-10255748 CTTGCTCCAGCAAGGTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186526742 Original CRISPR GAGCAAGCTGCCACTGTTAG TGG (reversed) Intergenic
No off target data available for this crispr