ID: 1186532310

View in Genome Browser
Species Human (GRCh38)
Location X:10309808-10309830
Sequence AAGCAATCTCACCCATTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186532310_1186532313 3 Left 1186532310 X:10309808-10309830 CCCCATAATGGGTGAGATTGCTT No data
Right 1186532313 X:10309834-10309856 GAGTCATCTTTCTCCCTTTTTGG No data
1186532310_1186532316 8 Left 1186532310 X:10309808-10309830 CCCCATAATGGGTGAGATTGCTT No data
Right 1186532316 X:10309839-10309861 ATCTTTCTCCCTTTTTGGAGGGG No data
1186532310_1186532315 7 Left 1186532310 X:10309808-10309830 CCCCATAATGGGTGAGATTGCTT No data
Right 1186532315 X:10309838-10309860 CATCTTTCTCCCTTTTTGGAGGG No data
1186532310_1186532314 6 Left 1186532310 X:10309808-10309830 CCCCATAATGGGTGAGATTGCTT No data
Right 1186532314 X:10309837-10309859 TCATCTTTCTCCCTTTTTGGAGG No data
1186532310_1186532317 11 Left 1186532310 X:10309808-10309830 CCCCATAATGGGTGAGATTGCTT No data
Right 1186532317 X:10309842-10309864 TTTCTCCCTTTTTGGAGGGGAGG No data
1186532310_1186532318 15 Left 1186532310 X:10309808-10309830 CCCCATAATGGGTGAGATTGCTT No data
Right 1186532318 X:10309846-10309868 TCCCTTTTTGGAGGGGAGGATGG No data
1186532310_1186532320 16 Left 1186532310 X:10309808-10309830 CCCCATAATGGGTGAGATTGCTT No data
Right 1186532320 X:10309847-10309869 CCCTTTTTGGAGGGGAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186532310 Original CRISPR AAGCAATCTCACCCATTATG GGG (reversed) Intergenic