ID: 1186540164

View in Genome Browser
Species Human (GRCh38)
Location X:10392329-10392351
Sequence ATTCTTTTATGGGTCATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186540164_1186540169 27 Left 1186540164 X:10392329-10392351 CCATTGATGACCCATAAAAGAAT No data
Right 1186540169 X:10392379-10392401 TTATTTATAAAAACAGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186540164 Original CRISPR ATTCTTTTATGGGTCATCAA TGG (reversed) Intergenic
No off target data available for this crispr