ID: 1186545494

View in Genome Browser
Species Human (GRCh38)
Location X:10444931-10444953
Sequence AAGTGTGTGAAGCACTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186545494_1186545496 0 Left 1186545494 X:10444931-10444953 CCAGGGCAGTGCTTCACACACTT No data
Right 1186545496 X:10444954-10444976 CCACTAGTATCAAAATCCCCTGG No data
1186545494_1186545498 2 Left 1186545494 X:10444931-10444953 CCAGGGCAGTGCTTCACACACTT No data
Right 1186545498 X:10444956-10444978 ACTAGTATCAAAATCCCCTGGGG No data
1186545494_1186545497 1 Left 1186545494 X:10444931-10444953 CCAGGGCAGTGCTTCACACACTT No data
Right 1186545497 X:10444955-10444977 CACTAGTATCAAAATCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186545494 Original CRISPR AAGTGTGTGAAGCACTGCCC TGG (reversed) Intergenic
No off target data available for this crispr