ID: 1186545542

View in Genome Browser
Species Human (GRCh38)
Location X:10445301-10445323
Sequence CTGGGTTTCCACTTCTATAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186545536_1186545542 14 Left 1186545536 X:10445264-10445286 CCCCATCTATAAGACTTGAAATC 0: 1
1: 0
2: 0
3: 23
4: 190
Right 1186545542 X:10445301-10445323 CTGGGTTTCCACTTCTATATAGG 0: 1
1: 0
2: 1
3: 8
4: 122
1186545537_1186545542 13 Left 1186545537 X:10445265-10445287 CCCATCTATAAGACTTGAAATCA 0: 1
1: 0
2: 1
3: 22
4: 257
Right 1186545542 X:10445301-10445323 CTGGGTTTCCACTTCTATATAGG 0: 1
1: 0
2: 1
3: 8
4: 122
1186545535_1186545542 19 Left 1186545535 X:10445259-10445281 CCTCACCCCATCTATAAGACTTG 0: 1
1: 0
2: 1
3: 8
4: 123
Right 1186545542 X:10445301-10445323 CTGGGTTTCCACTTCTATATAGG 0: 1
1: 0
2: 1
3: 8
4: 122
1186545538_1186545542 12 Left 1186545538 X:10445266-10445288 CCATCTATAAGACTTGAAATCAA 0: 1
1: 0
2: 2
3: 13
4: 208
Right 1186545542 X:10445301-10445323 CTGGGTTTCCACTTCTATATAGG 0: 1
1: 0
2: 1
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186545542 Original CRISPR CTGGGTTTCCACTTCTATAT AGG Exonic
901013502 1:6214102-6214124 CTGGGTATCAAATTCTAGATGGG + Intronic
906874189 1:49518215-49518237 CTGGGTTTTCCCTGATATATTGG - Intronic
907002887 1:50880062-50880084 CTGGGTTAAAACTTCTATTTTGG + Intronic
907089366 1:51709958-51709980 CTGGGTTGCCATTTCTATGGAGG - Intronic
910583118 1:88849934-88849956 GTGGGTGTTCACTTTTATATAGG + Intergenic
913320779 1:117587062-117587084 TTGGGTTCCCACTTCTGGATTGG - Intergenic
914959540 1:152194272-152194294 TTGGGTTTTCCCTTCAATATGGG + Intergenic
917219381 1:172711507-172711529 ATGGGTTGCCACTTCTCTTTTGG + Intergenic
921372789 1:214442573-214442595 CTGAGTTTCCTCTTCATTATAGG + Intronic
1068707222 10:60090387-60090409 CTGGGTTTCCAGTTTTGTATAGG - Intronic
1068872260 10:61958015-61958037 GTGGGTTTCCTCTTTTAGATTGG + Intronic
1069290272 10:66770396-66770418 TTTGGCTTCCATTTCTATATTGG - Intronic
1069442684 10:68443039-68443061 CTGGGTTTCTTCTTCTATTTTGG + Exonic
1073724282 10:106211592-106211614 CTGTGTTTGCACTTCTATCCAGG - Intergenic
1074416014 10:113267314-113267336 CTGTGTTTCAATTTCTATTTTGG + Intergenic
1074972334 10:118549381-118549403 CTGGGTCTCAATTTCTTTATTGG + Intergenic
1075915277 10:126161323-126161345 CTTGGTTTCCTCTTTTAAATAGG - Intronic
1076124460 10:127962977-127962999 CCAGGTTTCCACCTCTACATAGG - Intronic
1078173411 11:8948736-8948758 CTTGGTCTCCACTTCTTTAAGGG - Intronic
1080204683 11:29714989-29715011 CTGTGTTCTCACTTGTATATAGG - Intergenic
1080502627 11:32885266-32885288 CTGGGGTTCCAGGTTTATATGGG - Intergenic
1082206232 11:49437615-49437637 CTGGGTTTCCACTTCTGGATTGG + Intergenic
1083417271 11:62533817-62533839 CTGGGTCTCCACATCCACATTGG + Exonic
1086859786 11:91911834-91911856 CTGGTTTTCCATTCTTATATAGG + Intergenic
1087936298 11:104037457-104037479 CCGGATTTCCTCTTCTATTTTGG - Exonic
1089185003 11:116608775-116608797 CTCGGTTTCCACATCTGTAATGG - Intergenic
1099196675 12:79625181-79625203 CTAGTTTTCCATTTCTCTATAGG + Intronic
1100898969 12:99216656-99216678 GTGGGTTTCCCCTTAAATATTGG + Intronic
1101820545 12:108180937-108180959 CTGGGTTTCCCCATCTGTAGAGG - Intronic
1105928233 13:25027485-25027507 GCGCGTTTCCACTTCTATAAGGG - Intergenic
1105942657 13:25163602-25163624 GCGCGTTTCCACTTCTATAAGGG + Intronic
1108289085 13:48939998-48940020 ATGGGCTTCGACTTCTCTATAGG - Intergenic
1109129218 13:58560079-58560101 CTGTGTTGCCATTGCTATATGGG + Intergenic
1114054617 14:18956659-18956681 CTGGGTTTCCTATTCTGTCTAGG + Intergenic
1114107937 14:19445272-19445294 CTGGGTTTCCTATTCTGTCTAGG - Intergenic
1116907564 14:50419588-50419610 CAAGGTTTTCACTTTTATATTGG - Exonic
1119069636 14:71569576-71569598 GAGGGTTTCCCCTTCTATACTGG - Intronic
1121461638 14:94084026-94084048 CTATGTTTCCACTACTATAATGG - Intronic
1125121097 15:36159504-36159526 CTGCCTTTCTTCTTCTATATTGG - Intergenic
1126308460 15:47288231-47288253 CTGAGATTCCATTTCTATCTTGG + Intronic
1127032689 15:54881230-54881252 CTGGGTGGCCACTCCTTTATGGG - Intergenic
1128398956 15:67257004-67257026 CGTGGATTCCACTTCTATTTGGG + Intronic
1129200984 15:73999547-73999569 GTGGCTTTCCACTTGTTTATTGG + Intronic
1130882374 15:88066425-88066447 CTGTGTGTCCATTTCTCTATGGG - Intronic
1138982674 16:62289168-62289190 ATGTGTTTTCACTTCTCTATGGG - Intergenic
1146693816 17:34893995-34894017 CAGGGTTTCCTCATCTATAAAGG + Intergenic
1148246421 17:46033776-46033798 CTGGGTATGCATTTCCATATGGG - Intronic
1153855377 18:9139334-9139356 ATGGTTTTCAACTTCTATAGGGG - Intronic
1157366718 18:47071678-47071700 CTGAGTTTCCTCTTCTGTCTAGG - Intronic
1158066591 18:53417763-53417785 ATGGCTTTCCACTTCTCTCTGGG + Intronic
1159788809 18:72750605-72750627 CTGGTTTTCCTCTTCTCTATAGG + Exonic
1163983668 19:20924944-20924966 CTGGGTTTTCAGTACTGTATGGG + Intronic
925936519 2:8767108-8767130 CTTAGTTTCCTCTCCTATATGGG + Intronic
926211324 2:10872793-10872815 CTGCTTTTCCACTCATATATGGG + Intergenic
930396672 2:50830117-50830139 CTGGGCTTGCACTTCTTTACTGG + Intronic
930671612 2:54157755-54157777 GTGGTTTTCCAATTCTAGATGGG + Intronic
933299414 2:80525378-80525400 CTGGATTTCCCCTTCTGTGTTGG + Intronic
933612722 2:84453994-84454016 CTGTTATTCCACTTCTAGATGGG - Intronic
934939020 2:98486507-98486529 CTGGGTTTCCACGCCTTTTTAGG - Intronic
938472631 2:131579514-131579536 CTGGGTTTCCTATTCTGTCTAGG + Intergenic
939538763 2:143466199-143466221 ATGGTTCTCTACTTCTATATAGG + Intronic
942049885 2:172129813-172129835 CTGGGGTTCCAATTATATGTAGG + Intergenic
944799403 2:203223437-203223459 CTGTGTTTCCACTTATGTAATGG + Intronic
944958886 2:204845903-204845925 CAGATTTTCCACTTTTATATAGG - Intronic
946472463 2:219974963-219974985 CTGAGTTGCCTGTTCTATATGGG - Intergenic
946920350 2:224574534-224574556 CTGTGTTACCATTTGTATATGGG - Intronic
947562611 2:231170554-231170576 CTGTGTTTCCAGCTCTCTATTGG + Exonic
948682883 2:239648368-239648390 CTGGCCTTCCACTTCTCTTTGGG + Intergenic
1169312321 20:4554706-4554728 CTGGGTTTCCGTTTCTTCATTGG + Intergenic
1170693362 20:18635275-18635297 CTGAGTTCCCACTTCTGTTTTGG - Intronic
1170915685 20:20622576-20622598 CTGGGTGTCAAATTCTAAATTGG - Intronic
1176231367 20:64034730-64034752 CTCGGTTTCCACATCTGTACAGG - Intronic
1176231392 20:64034832-64034854 CTCGGTTTCCACATCTGTACAGG - Intronic
1176231403 20:64034883-64034905 CTCGGTTTCCACATCTGTACAGG - Intronic
1177519034 21:22193575-22193597 CTGGATTTCATATTCTATATGGG + Intergenic
1180473086 22:15679051-15679073 CTGGGTTTCCTATTCTGTCTAGG + Intergenic
1181087760 22:20450314-20450336 TAGGGTTTCCCCTTCTATAAAGG - Intronic
1182031366 22:27161950-27161972 CTGGGTTTCAACTTCCCCATTGG - Intergenic
949889380 3:8722171-8722193 ATGGGATTACATTTCTATATGGG - Intronic
957970507 3:87376021-87376043 CTGGGTTGCCACTGCTAGCTTGG - Intergenic
958041220 3:88229018-88229040 TTGGGTTTCCATTCCTTTATAGG + Intergenic
958619587 3:96540295-96540317 CTGTGTTTCCACAGATATATAGG - Intergenic
962249315 3:133825641-133825663 ATGTGTTTCCACTTGTAAATAGG + Exonic
966497828 3:180600999-180601021 CTGTGTTACCACTTTTGTATAGG - Intergenic
973724695 4:53763653-53763675 TTGGGCTTCCACTTCAATTTTGG + Intronic
975109567 4:70608441-70608463 CTGTGTTTTCATTTCTATAATGG + Intergenic
977899643 4:102404762-102404784 CTGACTTTCCACTTCTTTAGGGG + Intronic
979419461 4:120486398-120486420 CTTTGTTTCCATTCCTATATTGG - Intergenic
980201840 4:129665506-129665528 CTGATTATCCACTTCTATAATGG - Intergenic
983081488 4:163390717-163390739 CTTGGTTTTTACTTCTATCTGGG + Intergenic
989099482 5:37810858-37810880 CTGATTTTCCACCTCTATCTCGG + Intergenic
996198360 5:120638284-120638306 CTGTGATGCCATTTCTATATAGG - Intronic
996423433 5:123287027-123287049 CTGGGTTTCCTCTTCTATGAAGG + Intergenic
999427792 5:151502615-151502637 CTGGGTTTCCACCTTTCTAATGG - Intergenic
1001408895 5:171496360-171496382 CTGGGGTTCCCGTCCTATATGGG + Intergenic
1003374350 6:5561773-5561795 CTAGGTTTCCTGTTGTATATTGG + Intronic
1004314862 6:14577268-14577290 CTGGGTGTCATGTTCTATATAGG + Intergenic
1006831732 6:36972189-36972211 CTGGGTCTCGATTTCTGTATTGG + Intronic
1007719196 6:43875443-43875465 CTGGGCTTCCACTTCCAGACTGG + Intergenic
1011773651 6:90703672-90703694 CAAGGTTTCCAATTCTATATTGG + Intergenic
1013865585 6:114692436-114692458 TTGGGTTTCCACATGAATATTGG - Intergenic
1014663027 6:124197540-124197562 CAGGATTTCCACTTCTACTTAGG - Intronic
1015824389 6:137296133-137296155 CTGGGAATCCATTTCTATATCGG + Intergenic
1015928727 6:138335224-138335246 CTGGGTTTCCAGTACTGGATGGG + Intronic
1016072234 6:139752706-139752728 AATGGTTTACACTTCTATATGGG + Intergenic
1016596057 6:145802724-145802746 CTGGGTTCCTACTTCCATTTGGG - Intronic
1017631857 6:156403715-156403737 CAGGGTTTTCAGTTCTATATAGG + Intergenic
1019884342 7:3891089-3891111 CTGTGTTTCCAGTTCTATTCCGG - Intronic
1021785378 7:24146391-24146413 CTGGATTTCCATTTCTGTAGTGG + Intergenic
1022276010 7:28855671-28855693 CTGGGTTTCTTCTTCGATTTGGG + Intergenic
1023168388 7:37365596-37365618 CTGGGTTTGAACTTCTATGATGG - Intronic
1023367339 7:39476873-39476895 CAGGGTTTCCACTTATAATTTGG - Intronic
1023653192 7:42391604-42391626 CAGGGTTTCCAGTTCTCTCTTGG + Intergenic
1027679904 7:81206957-81206979 CTGGGTTTTCACGTCTACTTTGG - Intergenic
1029569873 7:101362523-101362545 CTCAGTTTCCACTTCTGAATGGG + Intergenic
1033200254 7:139362190-139362212 CTGGATTTTCACTGCTGTATTGG + Intronic
1037895931 8:22655227-22655249 CTGGGTTTCCACTTTCTTAATGG + Intronic
1042481296 8:69306653-69306675 CTTGATTTGCATTTCTATATAGG - Intergenic
1043414102 8:80030629-80030651 TTGGGCTTCCACTTCTAAATAGG - Intronic
1043554930 8:81420303-81420325 CTGGCTGTCCACTTCAATGTGGG + Intergenic
1046246588 8:111571251-111571273 CTTGGTTTCAAGTTCTGTATAGG - Intergenic
1047444550 8:124907559-124907581 CTGGCTTCCCGCTTCTTTATGGG - Intergenic
1048370503 8:133772466-133772488 CTGGGTTTTTACCTCTACATGGG - Intergenic
1051815908 9:21105322-21105344 CTGGTTTTCCACATATATAGTGG - Intergenic
1055810718 9:80144837-80144859 ATGGATTTCCACTTATAAATAGG + Intergenic
1061913910 9:133739094-133739116 CTGGGTGTCTACTTCTGTCTGGG - Intronic
1186545542 X:10445301-10445323 CTGGGTTTCCACTTCTATATAGG + Exonic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1194751502 X:97689802-97689824 CTTGGTTTACACCTCTATTTGGG - Intergenic
1197176145 X:123487605-123487627 CTCTGTTTCCACTTTTAAATGGG - Intronic
1198296729 X:135294602-135294624 GTGGGTTTCCTGTCCTATATTGG + Intronic
1200751280 Y:6946312-6946334 CTGGGTTTACATTTATATTTTGG - Intronic