ID: 1186547377

View in Genome Browser
Species Human (GRCh38)
Location X:10464655-10464677
Sequence GAGACAGATGTGCAGCAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186547377 Original CRISPR GAGACAGATGTGCAGCAGTC GGG Intronic
909241775 1:73222482-73222504 GAGACAAATGTGCAAAAGTTTGG - Intergenic
911753600 1:101527022-101527044 GAGAGACACGTGGAGCAGTCAGG + Intergenic
912346718 1:108969657-108969679 GAGCCAGCTGTGCAGAAGACTGG - Intergenic
913540562 1:119816259-119816281 CAGCCAGATGGGCAGCAGTGTGG + Intergenic
914372657 1:147042975-147042997 GAGACAGCTCTATAGCAGTCTGG - Intergenic
914576843 1:148979802-148979824 GAGACAGCTCTATAGCAGTCTGG + Exonic
915490518 1:156247752-156247774 CAGATAGATGGGCAGCACTCAGG - Intronic
917954543 1:180080523-180080545 GACACAGATGTGCAGCTTTTGGG - Exonic
918119641 1:181527235-181527257 CAGACAGCTGTCCAGCAGCCAGG - Intronic
919887764 1:201947279-201947301 GAGAAGGATCTGCAGAAGTCGGG + Intergenic
919972913 1:202592263-202592285 CAGGCAGATGTGCAGCAAACAGG + Exonic
921886989 1:220317064-220317086 GGGAGAGATGTTCAGCAGTGTGG + Intergenic
922776427 1:228216179-228216201 GAGACAGAGGTGGAACAGCCAGG - Intronic
923105742 1:230851924-230851946 CATACAGAGGTGCAGCAGTTGGG + Intronic
1063302739 10:4866557-4866579 GAGCCAGCTGTGCAGGAGACCGG + Intergenic
1063482803 10:6391208-6391230 GAGCCAGCTGTGCAGGAGACTGG - Intergenic
1064723097 10:18249820-18249842 GACATCGATGTGGAGCAGTCAGG - Intronic
1065173706 10:23056787-23056809 GAGACAGATTTGAGCCAGTCTGG - Intergenic
1065217072 10:23459412-23459434 GAGCCAGCTGTGCAGGAGACCGG - Intergenic
1065761711 10:28988883-28988905 GGGAGAGATGTGCAGCAGCCTGG - Intergenic
1066371232 10:34819861-34819883 AAGACAAATGTGCAGCAGAGTGG + Intergenic
1070660916 10:78304643-78304665 GAGACAGATGTGCCAGAGCCAGG - Intergenic
1071166669 10:82815817-82815839 GAGCCAGGGGTGCAGCAGTGAGG + Intronic
1072120601 10:92402522-92402544 GAGCCAGCTGTGCAGGAGACTGG - Intergenic
1074118563 10:110476306-110476328 AAGACAGGTGGGCAGCAGGCAGG - Intergenic
1074256752 10:111810747-111810769 GAGAGAGATGTGCAGCCACCTGG + Intergenic
1075064821 10:119282329-119282351 GAGACAGCTCTGCTGCAGTCTGG - Intronic
1075196485 10:120364025-120364047 GAGAAAAATGTGGAGCAGTGAGG - Intergenic
1075467027 10:122659231-122659253 GATACAGAGGTGCTGCAGGCAGG + Intergenic
1076227726 10:128793771-128793793 GAGAAGGATCTCCAGCAGTCAGG + Intergenic
1076767559 10:132644826-132644848 GGGACACATGTGAGGCAGTCGGG - Intronic
1078612020 11:12829135-12829157 AAGACGGAAGTGCAGCAGGCAGG + Intronic
1080028737 11:27638508-27638530 GAGCCAGCTGTGCAGGAGACTGG + Intergenic
1080432307 11:32210232-32210254 GAAACTGAAGTGCAGGAGTCAGG - Intergenic
1081044002 11:38249854-38249876 AAGACAGGTGTGGAGCAGTGAGG + Intergenic
1081621349 11:44620774-44620796 GAGTAAGATGTGCAGAATTCAGG + Intergenic
1083252647 11:61478152-61478174 GAGACAGGTGTCCAGCAGGCTGG - Intronic
1083503781 11:63136594-63136616 GAGCCAGCTGTGCAGGAGACCGG - Intronic
1085869397 11:80331541-80331563 TAAAAAGATGTGCAGCAGCCAGG + Intergenic
1087870667 11:103289259-103289281 GAGCCAGCTGTGCAGGAGACTGG - Intronic
1088726994 11:112647898-112647920 GAAACAGATTTGCAGGAGTATGG + Intergenic
1090502162 11:127271911-127271933 GAGACAGCTGTACAGCTGTCAGG + Intergenic
1091344952 11:134846203-134846225 GGGCCAGAGGTGCAGCAGGCTGG + Intergenic
1092879428 12:12876415-12876437 GAGCCAGCTGTGCAGGAGACTGG - Intergenic
1094301406 12:28968507-28968529 GAGACACATACGGAGCAGTCAGG - Intergenic
1095949119 12:47772286-47772308 GAGACAGATCTGTAGCAGGAGGG - Intronic
1097078458 12:56412356-56412378 GAACCAGATGTGCAGCAGCAAGG + Intergenic
1097446399 12:59678031-59678053 GAGCCAGGTGTGGAGCAGTGAGG + Intronic
1097582013 12:61469737-61469759 AAGACAGATGTGCAGTCTTCAGG - Intergenic
1098290719 12:68955054-68955076 GAGCCAGATGTGGAGCAGCAAGG - Intronic
1099033862 12:77560874-77560896 GAGCCAGAAGTGCAGCAGTGAGG - Intergenic
1100295272 12:93255027-93255049 GAGCCAGCTGTGCAGGAGACTGG + Intergenic
1102864771 12:116365772-116365794 GAGACAGAAGTGAAGCAATTTGG + Intergenic
1102918858 12:116776740-116776762 GAGACAGATGGGATTCAGTCTGG + Intronic
1103591889 12:121997462-121997484 GAGGCAGCTGTGCTGCAGCCTGG + Intronic
1104763521 12:131312397-131312419 GAGACAGATGCGAAGCAGAAAGG - Intergenic
1105316247 13:19266956-19266978 AAGACAGAAGTCCAGCTGTCTGG - Intergenic
1106107176 13:26742895-26742917 GAGTCAGATGTAAAGCCGTCAGG - Intergenic
1110658674 13:78032210-78032232 GATACAGACCAGCAGCAGTCAGG - Intergenic
1114438472 14:22727393-22727415 GAGCCAGCTGTGCAGGAGACTGG + Intergenic
1115160751 14:30390800-30390822 GAGGCAGAAGAGTAGCAGTCAGG + Intergenic
1115976076 14:38998687-38998709 AAGACAGATGTAGAGCAGTGAGG + Intergenic
1117181193 14:53193535-53193557 GAGCCAGCTGTGCAGGAGACCGG - Intergenic
1119036325 14:71232744-71232766 GAGTCAGGTGTGGAGCAGTGAGG - Intergenic
1119109800 14:71960841-71960863 GTGACAGATGAGCAGAAGCCTGG - Intronic
1119422943 14:74518366-74518388 GAAACAGATGAGAAGCAGGCTGG - Intronic
1119480027 14:74953318-74953340 GAGACATATGTACAGAAGGCAGG - Intronic
1119861671 14:77940500-77940522 GGGACAGATGGTCAGCAGTGTGG + Intergenic
1120506392 14:85357985-85358007 GATACAGATGAGCAGCAATATGG + Intergenic
1126096350 15:45093539-45093561 GAGACAGAGTTGAGGCAGTCGGG + Exonic
1127366201 15:58293036-58293058 GAGACAGTTCTGCAGCATTGTGG - Intronic
1127918403 15:63474105-63474127 GAAACAGATGGGCAGAAGTGAGG - Intergenic
1129903871 15:79172507-79172529 GGGTCAGAAATGCAGCAGTCTGG - Intergenic
1129960260 15:79678065-79678087 AAGCCAGCTGTGCAGGAGTCTGG + Intergenic
1130235215 15:82126877-82126899 AAGACAGATGTGCTGCAGAGTGG + Intergenic
1130837293 15:87663536-87663558 GAGCCAGCTGTGCAGGAGACCGG - Intergenic
1133362317 16:5184286-5184308 GAGCCAGCTGTGCAGGAGACTGG + Intergenic
1133670595 16:8015324-8015346 CAGACATATGTTCAGCAGTGAGG - Intergenic
1133764800 16:8830371-8830393 GAGCCAGCTGTGCAGGAGACTGG + Intronic
1133863514 16:9619444-9619466 GATGCAGAAGTGCACCAGTCGGG + Intergenic
1134599486 16:15522223-15522245 GAGACAGAACTGCAGCAGGCAGG + Intronic
1136356875 16:29749945-29749967 GAGCCAGCTGTGCAGGAGACCGG - Intergenic
1137879867 16:52034834-52034856 GAGTCACTTGTGCAGCAGTAAGG - Intronic
1138046305 16:53729062-53729084 GAGACAGAAGTGCAGCCTCCTGG - Intronic
1138222959 16:55268640-55268662 GAGACAGCTGAGGAGGAGTCTGG - Intergenic
1139014860 16:62677684-62677706 GAGCCAGCTGTGCAGGAGACTGG - Intergenic
1139668193 16:68472853-68472875 GCGTCAGAGGTGCAGCAGCCTGG - Intergenic
1140476210 16:75240334-75240356 GACACAGATGTCCCGCAGCCAGG + Intronic
1142123859 16:88400569-88400591 GGGACTGATGTGGAGCAGTTGGG - Intergenic
1142321883 16:89388556-89388578 GAGACACACATGCAGCATTCAGG - Intronic
1142483435 17:232175-232197 GAGAAACACCTGCAGCAGTCAGG - Intronic
1143276125 17:5712226-5712248 GAGACAGATGAGCAGGAGGAGGG + Intergenic
1143795401 17:9332112-9332134 CAAACAGAGGTCCAGCAGTCAGG - Intronic
1147595979 17:41717585-41717607 GAGACAGACGTGCAGCCCTCCGG - Intergenic
1148649823 17:49242154-49242176 GAGACAGTTATGCAGGAGACCGG + Intergenic
1148735424 17:49862386-49862408 GAGACAGAGGTGCGGCCATCTGG + Intergenic
1149281776 17:55112804-55112826 GGGCCAGATGAGGAGCAGTCAGG + Intronic
1149701396 17:58658188-58658210 GAGCCAGCTGTGCAGGAGACCGG - Intronic
1150144612 17:62757598-62757620 GAATCAGTTGTGCAGCAATCTGG - Intronic
1152132451 17:78485372-78485394 GAGACAGAGGAGGAGCAGCCGGG - Intronic
1152396808 17:80038034-80038056 TAAACAGATGTGCAGAATTCAGG + Intronic
1155830750 18:30512987-30513009 AAGCCAGGTGTGCAGCAGTAAGG + Intergenic
1157798367 18:50597367-50597389 GAGACAGGTGAGCATCATTCAGG - Intronic
1157803946 18:50644271-50644293 GAGACAGAAGAGCAGCTGACAGG + Intronic
1158958001 18:62560186-62560208 GAGGCAAATATGGAGCAGTCTGG + Intronic
1159065025 18:63560042-63560064 GAGAGAGAAGTGCAGCAACCAGG - Intronic
1159991364 18:74912567-74912589 GAGAGAGCTGAGTAGCAGTCTGG + Intronic
1162031556 19:7919683-7919705 GAGGCAGATGGGCAGGTGTCCGG - Intergenic
1162193573 19:8966218-8966240 GAGATAGATGCCCAGCAGTAGGG + Exonic
1162500610 19:11051313-11051335 GAGACAGAGGTGCAGGTGTGTGG + Intronic
1162646671 19:12055033-12055055 GAGACAGATCTCCTGCAGTGGGG + Intergenic
1163007602 19:14406356-14406378 GAAACAGTAGTGCAGCAGCCCGG - Exonic
1164617278 19:29674683-29674705 GGGACAGATGTTCTGCAGGCCGG - Exonic
1164617856 19:29677391-29677413 GAGACACAGGTGCAGAAGCCAGG + Intergenic
1164749588 19:30642705-30642727 GAGACTGTTGTGCTGCAGACCGG + Intronic
1167055687 19:47110894-47110916 GAGACACAAGTGCAGCAGTTTGG - Intronic
1167800278 19:51736165-51736187 GACACAGAGCTGCAGAAGTCCGG + Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
928142289 2:28740160-28740182 GTGACACATGAGCAGCAATCTGG - Intergenic
928672526 2:33616995-33617017 GAGCCAGCTGTGCAGGAGACTGG + Intergenic
931667168 2:64617795-64617817 GGCACAGATGTGCAGCAGCTTGG + Intergenic
932408188 2:71528222-71528244 GAGACAGATGGGGGACAGTCAGG + Intronic
935586390 2:104803650-104803672 GAGACAGAAGTGCAGCCCTGAGG + Intergenic
935613090 2:105046525-105046547 AAGACAGATGTCCAGGAGGCAGG - Intronic
935847323 2:107180772-107180794 CAGACAGATGTGCAGCAGATTGG - Intergenic
936108281 2:109644323-109644345 GAGTCAGCTGTGCAGGAGACTGG - Intergenic
936746621 2:115584095-115584117 GATACAGAATTGCAGCAGTTTGG - Intronic
937163910 2:119794394-119794416 GAGCCAGATGTGGAGCAGCAAGG + Intronic
938225419 2:129611702-129611724 GACACAGATGTGCATCTGGCGGG - Intergenic
938691192 2:133791134-133791156 GAGAGACATGAGCAGCCGTCTGG + Intergenic
939726551 2:145727580-145727602 GAGTCAGCTGTGCAGGAGACCGG - Intergenic
940362914 2:152814816-152814838 GAGCCAGATGTGCAGGAGACTGG - Intergenic
941929040 2:170923179-170923201 GAGGCAGGTGTGGAGCAGTGAGG + Intergenic
942997752 2:182285167-182285189 GATATAGCTGTGCAGAAGTCAGG - Intronic
944692263 2:202168948-202168970 GAGACAGATGTGTAGTAGATAGG + Intronic
944835005 2:203570513-203570535 GAGATAGATTTACAGCAATCAGG + Intergenic
945194171 2:207222951-207222973 GAGACAGAAGGGAAGAAGTCAGG + Intergenic
945199407 2:207266168-207266190 GAAACATATGTGCAGATGTCTGG - Intergenic
945633155 2:212309701-212309723 GACACAGATTTGCAGCAGAGAGG - Intronic
946309101 2:218872933-218872955 GAGACAGATGCCCAGGAGGCTGG + Intronic
947192497 2:227521973-227521995 GTTACAGGTGTGCAGCAGTCTGG - Intronic
947522842 2:230861865-230861887 CTGAGAGGTGTGCAGCAGTCTGG + Intergenic
948782634 2:240332180-240332202 GGCACAGATGTGCAGCCATCTGG + Intergenic
1169530881 20:6483698-6483720 CAGATAAATGTGCAGCAGTGAGG + Intergenic
1171021680 20:21589843-21589865 GGGACAGATATGCTGCATTCAGG + Intergenic
1171173090 20:23033066-23033088 GAGACAGAGAGGCAGCAGCCTGG - Intergenic
1173189994 20:40868887-40868909 GAGACAGAGAAGCAGCAGCCAGG + Intergenic
1173600878 20:44294323-44294345 GAGCCAGCTGTGCAGGAGACCGG + Intergenic
1173655336 20:44696599-44696621 GGGAGAGCTGTGCATCAGTCAGG - Intergenic
1173811287 20:45957435-45957457 GAGACAGATCTGCTGAAGTCTGG - Intronic
1175799369 20:61792351-61792373 GAGACAGATGTGCAGGAGGGGGG - Intronic
1175923826 20:62462432-62462454 GAGGCAGATGTGCAGGAGCTGGG + Intergenic
1177936216 21:27349498-27349520 GAGACAGGTTGGCAGCAGTAAGG - Intergenic
1178382452 21:32122125-32122147 GAGCCAGCTGTGCAGGAGACCGG - Intergenic
1178904323 21:36623988-36624010 GAGCCAGATGTTTAGTAGTCTGG - Intergenic
1181304458 22:21906994-21907016 AGGCCAGATGAGCAGCAGTCAGG - Intergenic
1184479292 22:44737601-44737623 GAGACAGGTGTGCTGGAGTCTGG - Exonic
949403457 3:3689732-3689754 CAGGCAGATGTGCATCTGTCAGG - Intergenic
950583115 3:13875912-13875934 GAGACAGCTGTGCACCTGACAGG + Intronic
951302897 3:21020244-21020266 GTCACAGATGTGCAGTGGTCAGG + Intergenic
952824838 3:37516074-37516096 GAGACATTTGTGTAGGAGTCAGG + Intronic
956653040 3:71522743-71522765 GACACAGATGTGCAGTAGGTGGG - Intronic
956692556 3:71891395-71891417 AAGGCAGATGTGCAGGAGGCAGG + Intergenic
956989859 3:74751079-74751101 GAGCCAGGTGTGGAGCAGTGAGG + Intergenic
958755822 3:98248206-98248228 GAGACAGATGAGCAGCGGGACGG - Intergenic
961048140 3:123723506-123723528 GAGACACATTGGCGGCAGTCAGG - Intronic
962094160 3:132276489-132276511 GAGCCAGCTGTGCAGGAGACTGG + Intronic
963066222 3:141266501-141266523 GAGACAGAACAGCAGCAGCCAGG + Intronic
963908111 3:150790990-150791012 GAGCCAGATGTGCTTCAGTGAGG + Intergenic
964220542 3:154339589-154339611 TAGACAAATGGGCAGGAGTCGGG + Intronic
964859674 3:161187219-161187241 GTGACAGTTATGCAGCAGGCTGG + Intronic
965518049 3:169643429-169643451 AAAACAGATGTGCAGCAGAAAGG - Intronic
966574736 3:181487779-181487801 GAAACAGGTGTGCAGGACTCCGG - Intergenic
967279241 3:187806253-187806275 GAGACAGAGGGGCAGGAGGCAGG - Intergenic
967364964 3:188675911-188675933 GAGAGAGGATTGCAGCAGTCGGG - Intronic
967739553 3:192989909-192989931 CAGTCAGATGAGCAGCAGTATGG + Intergenic
968047075 3:195630459-195630481 GAGGCAGAGGTGCAGCATTGTGG - Intergenic
968307574 3:197659585-197659607 GAGGCAGAGGTGCAGCATTGTGG + Intergenic
969093768 4:4717229-4717251 GACACAGCTGTGCACCAGCCCGG + Intergenic
969272507 4:6112544-6112566 GAGACTGCTGGGCAGGAGTCTGG - Intronic
969680852 4:8642596-8642618 GAGACAGCTGGGCAGGGGTCAGG - Intergenic
971784694 4:31085042-31085064 GAGCCAGCTGTGCAGGAGACTGG + Intronic
971794494 4:31209431-31209453 GAGACTGATATGAAGGAGTCAGG + Intergenic
972165647 4:36280882-36280904 CAGGCAGATGGGCAGCAGTGGGG + Intergenic
976883960 4:89963768-89963790 GAGCCAGCTGTGCAGGAGACCGG + Intergenic
977352571 4:95907086-95907108 GAGACAGATGCCCAGCAGCATGG - Intergenic
977736076 4:100417707-100417729 CAGACAGCTGTGAAGCAGCCTGG - Intronic
979010912 4:115366641-115366663 GAGCCAGGTGTGCAGCAGTGTGG - Intergenic
982524522 4:156461070-156461092 GAGAGACATGAGGAGCAGTCTGG - Intergenic
982840968 4:160185588-160185610 AAGACAGATGAGCAGGAGGCTGG - Intergenic
983222018 4:165052867-165052889 GAGACTGAGGGGCAGCTGTCCGG - Intergenic
983357887 4:166687744-166687766 GAGAGAGATCTGCTTCAGTCTGG - Intergenic
984102011 4:175498646-175498668 GAGTCAGGTGTGGAGCAGTGAGG + Intergenic
985395093 4:189534613-189534635 GTGAAAGATGTGCAGAAGACAGG - Intergenic
985948753 5:3206653-3206675 GAGACAGCTGTGCAGGAGAAGGG + Intergenic
986999365 5:13643877-13643899 GAAAGAGAAGTGCAACAGTCTGG + Intergenic
988567451 5:32330572-32330594 CAGACAGAGGTGCAGGACTCAGG + Intergenic
990561065 5:56983277-56983299 GAGAAAGATGTTCATCAATCAGG + Intergenic
990794970 5:59529477-59529499 GAGAAGGATGTGCAGCAATAGGG + Intronic
991124320 5:63052516-63052538 GAGAGAGATGAGAAGCAGACAGG + Intergenic
992074213 5:73176022-73176044 GAGTAGGATCTGCAGCAGTCAGG + Intergenic
993229972 5:85222333-85222355 AAGTCAGGTGTGCAGAAGTCAGG - Intergenic
993395292 5:87379261-87379283 GACACAGAAGTGCAGCAGGTAGG + Intronic
994088290 5:95783851-95783873 CTCACAGATGTGCTGCAGTCTGG - Exonic
995911072 5:117187417-117187439 GAGGCAGATGTCCATCATTCAGG - Intergenic
996279255 5:121708206-121708228 CAGGCAGATCTGCAGCAATCTGG + Intergenic
996519795 5:124414022-124414044 GAGGCAGACGTCCTGCAGTCAGG - Intergenic
1001487035 5:172127291-172127313 GACAGAGCTGTCCAGCAGTCAGG + Intronic
1001717143 5:173825493-173825515 GAGACAGCTGTGGACCAGCCTGG + Intergenic
1003913077 6:10760287-10760309 GAGCCAGCTGTGCAGGAGACTGG - Intronic
1004017417 6:11744725-11744747 GAAACAGATGGGCAGCTCTCTGG + Intronic
1004368307 6:15030579-15030601 GAGCCAGCTGTGCAGGAGACTGG + Intergenic
1004390167 6:15203313-15203335 GAGCCAGCTGTGCAGGAGACTGG + Intergenic
1006383393 6:33714539-33714561 GGGACAGATGTGGACCAGTCAGG - Intergenic
1006410213 6:33869238-33869260 AAGACAGGCGTCCAGCAGTCTGG + Intergenic
1008519919 6:52353293-52353315 GAGAGAGATTTAAAGCAGTCAGG + Intergenic
1010475017 6:76276275-76276297 TAGACAGATGTCCAGGAGTCTGG - Intergenic
1010836472 6:80593730-80593752 GATACAGATGTGTAGAAATCTGG - Intergenic
1012449306 6:99338409-99338431 AAGACAGGTCTACAGCAGTCAGG + Intronic
1015158529 6:130125615-130125637 CAGACAGATGTGCTCCATTCTGG + Intronic
1015389074 6:132660856-132660878 GAGAGACATGTGGAACAGTCAGG + Intergenic
1016534746 6:145097670-145097692 GAGACATCTGGGCAGCAGTAAGG - Intergenic
1019138664 6:169929250-169929272 GAAAGAGATGTTCAGCAGTGAGG + Intergenic
1020637347 7:10712976-10712998 CAGACAGGTCTACAGCAGTCAGG + Intergenic
1024255754 7:47538939-47538961 GTGTCAGATGTGAAGCAATCTGG - Intronic
1024338964 7:48237840-48237862 GAGGCAGATATGCAGCCATCAGG - Intronic
1024697829 7:51874462-51874484 GAGAGAGATGGGCAACAGTACGG - Intergenic
1025230734 7:57201883-57201905 GACACAGCTGTGCAGCACACTGG - Intergenic
1031127782 7:117793883-117793905 GTGACAGCTGAGCAGAAGTCTGG - Intronic
1032408610 7:131676042-131676064 CAGAAAGGTTTGCAGCAGTCTGG + Intergenic
1033540246 7:142349664-142349686 GAGACAGCCGTGCAGCACTGTGG - Intergenic
1033545956 7:142400377-142400399 GAGGCAGCTGTGCAGCACTGTGG - Intergenic
1033548648 7:142425465-142425487 GAGGCAGCTGTGCAGCACTGTGG - Intergenic
1035406476 7:158601929-158601951 AAGACAGATCTGCAGGAGCCAGG - Intergenic
1037838835 8:22230121-22230143 GGGACAGGTGTGGAGCAGTGGGG + Intronic
1040386377 8:46917584-46917606 GAGCCAGCTGTGCAGGAGACTGG - Intergenic
1041478837 8:58295703-58295725 GAGCCAGCTGTGCAGGAGACTGG - Intergenic
1045082728 8:98646105-98646127 GAGACTGATGTCCAGCTGGCTGG - Intronic
1045837839 8:106544265-106544287 GAGGCAGATGTGCAACACACAGG + Intronic
1047062065 8:121238492-121238514 AAAACAGATGCGGAGCAGTCAGG + Intergenic
1048681120 8:136842848-136842870 GGGACTGAAGTGCAGCTGTCTGG + Intergenic
1050926772 9:11273552-11273574 GAGCCAGCTGTGTAGCAGACTGG - Intergenic
1052748999 9:32469490-32469512 GAAGCAGATGTGCAGGATTCAGG + Intronic
1055471199 9:76612774-76612796 GAGACAGAGGTGAAGCAATGAGG + Exonic
1056559779 9:87719974-87719996 AAGCCAGATGTGGAGCAGACAGG - Intergenic
1056587896 9:87940155-87940177 GAGGAAGATGAGCAGCAGTGGGG + Intergenic
1056608971 9:88112790-88112812 GAGGAAGATGAGCAGCAGTGGGG - Intergenic
1057226061 9:93293784-93293806 GAGACAGATGAGAGGCAGACAGG - Intronic
1057957956 9:99426395-99426417 CAAACAGAACTGCAGCAGTCTGG + Intergenic
1059253330 9:112906737-112906759 GAGTCAGCTGTGCAGGAGACTGG - Intergenic
1059721115 9:116960856-116960878 GAGTCAGCTGTGCAGGTGTCTGG - Intronic
1060829853 9:126706415-126706437 GAGGCTGATGGGCAGCTGTCAGG + Intergenic
1203746038 Un_GL000218v1:41146-41168 GAGACAGAGGTGCTGCAGAGGGG - Intergenic
1185922660 X:4111450-4111472 TTGACAGTTGTGCAGAAGTCTGG + Intergenic
1186547377 X:10464655-10464677 GAGACAGATGTGCAGCAGTCGGG + Intronic
1186578269 X:10789838-10789860 GATCCTGGTGTGCAGCAGTCTGG - Intronic
1188495988 X:30783455-30783477 GAGCCAGATGTGCAGGAGATGGG - Intergenic
1190234529 X:48605495-48605517 GAGACAGAGCTGCAGAAGTTGGG + Exonic
1190478460 X:50850868-50850890 GAGCCAGCTGTGCAGGAGACTGG + Intergenic
1192024567 X:67435476-67435498 GAGACAGATGGGAAGAAGTTGGG + Intergenic
1193626610 X:83829839-83829861 GAAACAGATGTGCAAAAGCCAGG + Intergenic
1195236232 X:102901350-102901372 GAGACAGATGTCCACCAATAAGG - Intergenic
1196543870 X:116939873-116939895 GAGCCAGCTGTGCAGGAGACTGG - Intergenic
1197050074 X:122046990-122047012 GAGCCACAAGTGCAGAAGTCAGG - Intergenic
1200247337 X:154533195-154533217 GCCACAGATGTGCAGCCCTCAGG + Intronic
1201502415 Y:14659658-14659680 TAAACAGATATGCAGCAGACTGG - Intronic