ID: 1186549546

View in Genome Browser
Species Human (GRCh38)
Location X:10488410-10488432
Sequence TCTCACAAACTGCTGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186549546_1186549553 12 Left 1186549546 X:10488410-10488432 CCCACCTCCAGCAGTTTGTGAGA 0: 1
1: 0
2: 0
3: 28
4: 265
Right 1186549553 X:10488445-10488467 TTCACATTTTTGCCAACACTTGG 0: 1
1: 7
2: 66
3: 313
4: 939

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186549546 Original CRISPR TCTCACAAACTGCTGGAGGT GGG (reversed) Intronic
902435514 1:16395961-16395983 TCTCCCAAAATACTAGAGGTGGG - Exonic
903542472 1:24104802-24104824 CTTCCCAAAGTGCTGGAGGTGGG + Intronic
903553308 1:24174248-24174270 TTTCTCAAAATTCTGGAGGTTGG - Intronic
903738733 1:25545773-25545795 CCCCACAAACAGCTGGAGGCAGG - Intronic
904305860 1:29589536-29589558 TCTCATGAACTGCTGGTGGGAGG + Intergenic
904332585 1:29771913-29771935 TCTCATACACTGCTGGTGGGAGG + Intergenic
905853628 1:41292605-41292627 TCTCCCACACTGCTGATGGTGGG - Intergenic
906762275 1:48386923-48386945 TGTCACAAGCTACTGGATGTAGG + Intronic
908037174 1:60068468-60068490 AATCACAACTTGCTGGAGGTGGG - Intronic
908437902 1:64124712-64124734 TCTCAAAAACTGCCAGGGGTGGG + Intronic
908480928 1:64538333-64538355 TCTCTGAAACTGCTGCAGGGGGG - Intronic
909937144 1:81564933-81564955 TCTCAGGCAGTGCTGGAGGTTGG - Intronic
913057460 1:115175599-115175621 TCTCACCCACTGCTGAAGGTGGG - Intergenic
914393037 1:147239068-147239090 TCTTACAAACTGATAGACGTGGG - Intronic
915090446 1:153420515-153420537 TCTTACACACTGCTGCTGGTAGG - Exonic
916964732 1:169925782-169925804 CCTCACAAACAGCCAGAGGTAGG - Intronic
918093375 1:181316055-181316077 CCTCAGAATCTGCTGGAGCTCGG - Intergenic
919085651 1:192917624-192917646 TCTCAGAGACTGAGGGAGGTAGG - Intergenic
919308029 1:195869329-195869351 TTTCTCACAGTGCTGGAGGTTGG + Intergenic
921045487 1:211474066-211474088 TTTCACAAACTACTGGAGGCGGG + Intergenic
921075289 1:211695734-211695756 TCTCACAGACAGCTGGAGGAGGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
922771257 1:228184558-228184580 ACTCACACACTGCTGGTGGAAGG - Intergenic
923435838 1:233966902-233966924 TCTCACACAGGGCTGGAAGTTGG - Intronic
923436301 1:233970816-233970838 GCTCTCACACTGCTGGAGGCTGG - Intronic
924009706 1:239651607-239651629 CCTCAGAAAGTGCTGGAGGTAGG - Intronic
1062818774 10:518844-518866 TCCTAGTAACTGCTGGAGGTGGG - Intronic
1065441981 10:25762331-25762353 TTTCACACAGTGCTGGAGGCTGG - Intergenic
1067055872 10:43049560-43049582 TCTCTGACACTGCTGCAGGTGGG - Intergenic
1067354223 10:45510244-45510266 TTTCTCAAAGTTCTGGAGGTAGG - Intronic
1067777215 10:49172386-49172408 TCTCACAAGCTGGAGGAAGTGGG + Intronic
1068898129 10:62230624-62230646 TCAAAAAAACTGCTCGAGGTAGG + Intronic
1069884568 10:71615673-71615695 CCTCGGACACTGCTGGAGGTTGG - Intronic
1070615263 10:77964821-77964843 TTCCACAGACTGCTGGAGGATGG - Intergenic
1072067511 10:91885234-91885256 TCTCCAACACTGCTGGACGTTGG - Intergenic
1075298072 10:121295621-121295643 AGCCATAAACTGCTGGAGGTAGG - Intergenic
1075618530 10:123908683-123908705 TCTCCAGAACAGCTGGAGGTGGG + Intronic
1076294079 10:129370543-129370565 TCTCACATAGTGCTGGGGGCAGG + Intergenic
1077182458 11:1222855-1222877 TCTCAGAAGCTGCTGGGGGTGGG + Intergenic
1077320822 11:1940913-1940935 TCTCTCACAGTCCTGGAGGTTGG + Intergenic
1077338998 11:2017710-2017732 TCTCTAACACTGCTGGAGGGCGG - Intergenic
1079304694 11:19311844-19311866 TCTCAAAGACTACTTGAGGTGGG + Intergenic
1079531802 11:21463216-21463238 TTTTACAAAGTGCTGGAGGTGGG - Intronic
1079780769 11:24600379-24600401 TCTCTCAAAGTTCTGGAGGCTGG - Intronic
1080792099 11:35530446-35530468 TCACACAAATTGCTGAAAGTCGG + Intergenic
1080840211 11:35977085-35977107 TTTCAGAGCCTGCTGGAGGTAGG + Intronic
1080922896 11:36726499-36726521 TCTCACACAGTTCTGGAGGCTGG - Intergenic
1082055235 11:47809308-47809330 TCTCATATACTGCTGGTGCTGGG + Intronic
1085805364 11:79630946-79630968 TCTCATACACTGCTGGTGGGAGG + Intergenic
1086921173 11:92588841-92588863 TCCCCCAAACTGTTGGAGGGAGG - Intronic
1089377347 11:118003971-118003993 TCTCTCACAGTTCTGGAGGTGGG + Intergenic
1089418490 11:118313693-118313715 TCTCACACACTGTGGGGGGTGGG - Exonic
1202821982 11_KI270721v1_random:72892-72914 TCTCTAACACTGCTGGAGGGCGG - Intergenic
1092120434 12:6039881-6039903 TCTCCCAAACTGCTGGTATTAGG - Intronic
1093801857 12:23383114-23383136 TCTTACACATTGCTGGAGGCCGG - Intergenic
1094335737 12:29350234-29350256 TGCAATAAACTGCTGGAGGTTGG + Intronic
1095358379 12:41305462-41305484 TTTCTCACAATGCTGGAGGTAGG + Intronic
1095465878 12:42487673-42487695 TCTCTAAAAATGCTGGAGTTTGG + Intronic
1096338395 12:50775504-50775526 TCCCAGATACTGCAGGAGGTGGG - Intronic
1096863594 12:54548196-54548218 TTTCAAAAAATTCTGGAGGTTGG - Exonic
1097357303 12:58616130-58616152 TTTCAACAGCTGCTGGAGGTAGG + Intronic
1098141690 12:67456641-67456663 CTTCAGAAACTGCTGGAGGGTGG - Intergenic
1100744125 12:97626893-97626915 TTTCAGAAACTGGAGGAGGTCGG + Intergenic
1101627967 12:106464393-106464415 TCTCACACAATTCTGGAGGGAGG + Intronic
1103240509 12:119409389-119409411 TGTCACAACTTGCTGGGGGTTGG - Intronic
1103302543 12:119939049-119939071 TCCCACAAACAGATGGTGGTGGG - Intergenic
1103454328 12:121053122-121053144 TCTTAAAAAATGCTGGAGGCCGG + Intergenic
1106024643 13:25945355-25945377 TCTCAAAAACTGCTGGCAGAAGG + Intronic
1108971761 13:56384711-56384733 TCTTATACACTGCTGGAGGAAGG - Intergenic
1111058904 13:82986235-82986257 TGTCACAAACTCCAGGAGCTAGG + Intergenic
1111102229 13:83603385-83603407 TCTCTTACACTTCTGGAGGTCGG - Intergenic
1112074704 13:95898839-95898861 TCTCTCATACTTCTGGAGGCTGG - Intronic
1112193258 13:97199008-97199030 TCTTACAAACTGCTTGTGGAAGG + Intergenic
1112451461 13:99514897-99514919 TCTCAAAAACTTCTTGAAGTAGG + Intronic
1112605832 13:100904773-100904795 CGTGACAAACTTCTGGAGGTTGG - Intergenic
1113053502 13:106240766-106240788 AGTCACAAAGTACTGGAGGTTGG + Intergenic
1113204992 13:107906911-107906933 TCACACAAACTGCTGTAGTGAGG - Intergenic
1113525416 13:110971111-110971133 TTTCACATACTTCTGGAGGCTGG + Intergenic
1114479634 14:23024657-23024679 TCTCCCAAAGTGCTGGTGCTGGG + Intronic
1116468898 14:45264884-45264906 ACTCACATACTGCTGCTGGTAGG - Intergenic
1116634362 14:47376835-47376857 TTTCAAAATCTGCTGGAGGTAGG + Intronic
1116772109 14:49138604-49138626 TCTCCCAAATGGCTGGAGCTTGG + Intergenic
1118327507 14:64791651-64791673 TCTGACACACTGCTGGGGGCCGG - Intronic
1121813818 14:96914003-96914025 TCTCTCACACTTCTGGAGGCTGG - Intronic
1122957406 14:105077158-105077180 TCACAGAAAATGCAGGAGGTTGG + Intergenic
1123919503 15:25060469-25060491 TCACACAAGCTGCAGCAGGTGGG - Intergenic
1125717484 15:41827549-41827571 TCTCACAAACTTCTGGCGAAGGG - Exonic
1126212434 15:46114800-46114822 TCTCAGAATCTGTTGCAGGTTGG + Intergenic
1126448472 15:48778448-48778470 TCTAATAAACTGCTGGTGGGTGG + Intronic
1126694241 15:51312849-51312871 CCTCACAAGCAGCTGGAGGGAGG - Intronic
1126893717 15:53235439-53235461 GGTCACACACTGCTGGTGGTGGG + Intergenic
1127288107 15:57547913-57547935 TCTCACGAACTGCTGCTGTTGGG + Exonic
1130357688 15:83149184-83149206 TCATACAAACTTCAGGAGGTAGG - Intronic
1134826795 16:17291259-17291281 CCTCTCAAACTGCTGGGTGTGGG + Intronic
1138407698 16:56811217-56811239 TCTCACATACTGCTGGTGGGAGG - Intronic
1139787552 16:69406195-69406217 TTGCCCAAGCTGCTGGAGGTAGG - Intronic
1139799505 16:69510346-69510368 TCTCCCAAAATGCTGTAGCTGGG + Intergenic
1140916942 16:79502407-79502429 CCTCCCAAAGTGCTGGAGTTAGG - Intergenic
1141945788 16:87308977-87308999 TCTCACAAACTGATGTGGATGGG + Intronic
1142912399 17:3105804-3105826 TCTCATACACTGCTGGCAGTAGG - Intergenic
1143233859 17:5381121-5381143 TGTCACCAGCTGCTGGGGGTGGG + Intronic
1146207296 17:30915722-30915744 TCTCTCAAATTGCTGCTGGTTGG + Intronic
1146587819 17:34097808-34097830 TCCCCCAAACTGCATGAGGTGGG + Intronic
1149163696 17:53725220-53725242 TCTCAGAATCTGCTGTAGGATGG - Intergenic
1150134016 17:62685570-62685592 TCTCAAAAACTGCTGGAGTATGG + Intronic
1150842413 17:68621152-68621174 TTTCACAAACAGCATGAGGTTGG - Intergenic
1151536194 17:74740262-74740284 TATCAGAATCTGCTGGGGGTGGG - Intronic
1151891096 17:76950668-76950690 TGTCACAGCCAGCTGGAGGTAGG - Intergenic
1154213443 18:12398526-12398548 TTTCTCAGAGTGCTGGAGGTGGG - Intergenic
1155068471 18:22290037-22290059 TCTCTCACAGTTCTGGAGGTTGG + Intergenic
1155837140 18:30600154-30600176 TCACCCAAACTCCTGGAGGAGGG - Intergenic
1157283988 18:46364731-46364753 GCTCACATACTGATGGAGGGTGG + Intronic
1158393215 18:57060304-57060326 ACACACAGACTGATGGAGGTAGG + Intergenic
1158685048 18:59605855-59605877 TCCCAAAAACTGCTAGAGGGAGG - Intronic
1159292228 18:66438297-66438319 TCTCACCTAATGCTGCAGGTAGG + Intergenic
1159561545 18:70000616-70000638 TCTCACCAACTGCACAAGGTAGG + Intergenic
1162011687 19:7820177-7820199 CCTCACTCACAGCTGGAGGTTGG + Intergenic
1162087416 19:8257060-8257082 TCTGACTACCTGCTGGAGGTGGG + Exonic
1163272656 19:16263477-16263499 TCTTAGAAAGAGCTGGAGGTGGG - Intergenic
1164552689 19:29224758-29224780 ACTCACCAACTGCTGGGGATAGG - Intergenic
1165760172 19:38316247-38316269 CCTCCCAAAGTGCTGGAGTTAGG - Intronic
1166369160 19:42291761-42291783 TCTCTCTACCTGCTGGATGTTGG + Intronic
1166608251 19:44164877-44164899 TATCACAGAATGCTGGAGTTGGG - Intergenic
1166859921 19:45804208-45804230 TCTCACAAACGGCAGGAGCAGGG - Intronic
928107208 2:28478186-28478208 TCTCCCAAAGAGTTGGAGGTGGG + Intronic
929380643 2:41347821-41347843 TCTCACAAAATACTATAGGTTGG + Intergenic
929574274 2:43042239-43042261 ACACACAAGCTGCTGGAGGAGGG - Intergenic
930145482 2:47998621-47998643 TCACACAAACTGTATGAGGTAGG + Intergenic
930666307 2:54102157-54102179 TCTCACGCACTGCTGGCGTTTGG - Intronic
931248595 2:60511008-60511030 TCTGAGGAACTGCTGGTGGTTGG - Intronic
931434167 2:62232711-62232733 TCTCTCCAACTTCTGGAGGAGGG - Intergenic
933402994 2:81822358-81822380 TCTCACATAGTTCTGGAGGCTGG - Intergenic
933565615 2:83946907-83946929 TCTGATAAACTGATTGAGGTAGG - Intergenic
934163005 2:89270205-89270227 TCTCTCACACTTCTGGAGGATGG - Intergenic
934204267 2:89912319-89912341 TCTCTCACACTTCTGGAGGATGG + Intergenic
935470712 2:103456398-103456420 CCTCACAAAGTTATGGAGGTTGG - Intergenic
935783091 2:106524962-106524984 TCTTACAGACTGCTGGAGACTGG - Intergenic
936092318 2:109509381-109509403 TCTCTCAAAGTGCTGGAGGCTGG + Intergenic
937695570 2:124804720-124804742 TTTCTCAAACTTCTGGAGGCTGG - Intronic
938189462 2:129262654-129262676 TCTGACAATCTGGTGGATGTTGG + Intergenic
939394808 2:141614790-141614812 TCTCTCACAGTTCTGGAGGTTGG - Intronic
940425386 2:153525648-153525670 TTTCACATACTGGTGGGGGTGGG - Intergenic
940903157 2:159145421-159145443 CCTCACAACCTGTAGGAGGTGGG + Intronic
941457595 2:165728144-165728166 TCTGTCAAGCTGCTGGAGTTGGG - Intergenic
943704582 2:191021277-191021299 TCTCACAAGAGGCTGGAGGTTGG - Intergenic
944038961 2:195333476-195333498 TCTCCAAAATTGGTGGAGGTGGG - Intergenic
946655525 2:221941845-221941867 TCTCACACCCTGCAGCAGGTGGG - Intergenic
947448210 2:230180819-230180841 TCTCAAACACTGGTGGAGGCAGG - Intronic
948263076 2:236618546-236618568 TCTCTCACAGTGCTGGAGGCCGG + Intergenic
948480512 2:238247342-238247364 TCTCACACACTGCTGGCTCTTGG - Intronic
948953674 2:241271911-241271933 TCTCACCAAGTTCTGGAAGTCGG + Intronic
1170548989 20:17459527-17459549 TCTCATATACTGCTCAAGGTAGG - Intronic
1173945686 20:46948970-46948992 TCTCAAAAATTGCAGGAGGTGGG + Intronic
1174583232 20:51588096-51588118 CCTCCCAAAGTGCTGGAGTTAGG - Intergenic
1176908675 21:14535842-14535864 TTTCTCACACTTCTGGAGGTTGG - Intronic
1177150159 21:17447111-17447133 TAATACAAACTGCTGGAGCTGGG - Intronic
1179257389 21:39728505-39728527 TCTCTCACATTTCTGGAGGTTGG - Intergenic
1179509231 21:41861458-41861480 CCTCCCAAACTGCATGAGGTGGG - Intronic
1179958543 21:44755046-44755068 TCTCACACAGTTCTGGAGGTTGG + Intergenic
1180052914 21:45340909-45340931 TTCCAGAAACTGCGGGAGGTGGG - Intergenic
1180708768 22:17825683-17825705 TGTCAGACACTGCTGGAGGAAGG - Intronic
1181683709 22:24514301-24514323 TCTCAGTAACAGCTGGAGGTGGG + Intronic
1182661708 22:31929707-31929729 TCTCACACACATCTGGTGGTTGG + Intergenic
1183011760 22:34952498-34952520 TCTCAAACACTTCTGGAGGCTGG - Intergenic
1183462610 22:37961309-37961331 GCTCCCAAAGTGCTGGAGCTGGG + Intronic
1183869349 22:40729431-40729453 TCTCACACAGTTCTGGAGGCTGG + Intergenic
1184135888 22:42549721-42549743 TCTCACCGCCTGCTGGAGGGAGG - Intergenic
949179776 3:1115002-1115024 TCTCTCAACCTACGGGAGGTTGG + Intronic
950479466 3:13235555-13235577 CCTCTGAGACTGCTGGAGGTGGG + Intergenic
950637253 3:14323817-14323839 ACTCACAGACTGATGGAGGATGG + Intergenic
951997251 3:28744813-28744835 TGTAACCTACTGCTGGAGGTGGG - Intergenic
952917295 3:38256688-38256710 TCTCACAGACTAGTGGGGGTGGG - Intergenic
953390915 3:42533276-42533298 TGTCACAGACTGCTGGATTTAGG + Intronic
953460471 3:43078029-43078051 TCTCATACACTGCTGGGGCTGGG - Intergenic
954737963 3:52722301-52722323 GCTCAGAAACTGCTGAACGTGGG + Intronic
955124126 3:56093126-56093148 TCTCAAATACTCCTGGAGGATGG + Intronic
956723013 3:72134806-72134828 TCTCTCACAGTTCTGGAGGTTGG - Intergenic
957334567 3:78810435-78810457 TCTTAGAAACTGATGGAGGGTGG + Intronic
961136000 3:124511872-124511894 TCTCACAAAATGCTGAGGGATGG - Intronic
961629217 3:128284023-128284045 TCACAGGAACTGCTGGAGGGAGG - Intronic
964354466 3:155837424-155837446 TCTCTTACACTGCTGGTGGTAGG + Intronic
965430022 3:168574768-168574790 GCTCATAAATTGCTGGAGGAAGG + Intergenic
969059075 4:4420666-4420688 TCTCGAAAGCAGCTGGAGGTGGG + Intronic
969880388 4:10168435-10168457 TCACACACACTGCTAAAGGTTGG - Intergenic
970124528 4:12793900-12793922 TCACACAATCTGATGGAGGGTGG - Intergenic
970371570 4:15412323-15412345 TCCCACAGACTGGTGGGGGTGGG - Intronic
971043759 4:22782353-22782375 TTTCTCACAGTGCTGGAGGTTGG + Intergenic
971325063 4:25636801-25636823 CATCACAAATTGCTGGGGGTGGG + Intergenic
973766715 4:54169653-54169675 TCTCACAGTCTTCTAGAGGTAGG + Intronic
975895830 4:79089086-79089108 TGTCTCAAAGGGCTGGAGGTTGG - Intergenic
977621726 4:99145444-99145466 TCTCATACACTGCTGCTGGTAGG - Intronic
978897230 4:113903571-113903593 CCTCAGAAACTGAAGGAGGTTGG - Exonic
981015350 4:139968605-139968627 CCTCACAAACTCCCTGAGGTGGG + Intronic
981300886 4:143185021-143185043 TCTCACGACCTGCTGGAGACTGG + Exonic
982952452 4:161716726-161716748 TCTCACATTCTACTGGAGGGTGG - Intronic
983454717 4:167948770-167948792 TCTCAGAACCTCCTGGAGTTTGG + Intergenic
984176916 4:176430415-176430437 TTTCTCACACTTCTGGAGGTTGG - Intergenic
984181233 4:176484746-176484768 TGTCACCAACTGAAGGAGGTAGG - Intergenic
984794290 4:183644036-183644058 TCTTAAAAACTTCTGGAGCTAGG + Intronic
984867551 4:184294986-184295008 TTTCTCACACTTCTGGAGGTGGG + Intergenic
987008154 5:13732337-13732359 TCTCACATAGTGCAGGAGCTGGG + Intronic
987082691 5:14439825-14439847 TCTCACCAACTGCTGCAGAGGGG - Intronic
988084031 5:26450253-26450275 GCTCACAAACAACTGCAGGTTGG - Intergenic
988711499 5:33781447-33781469 TCTCACAAGCTCCTTGAGGATGG + Intronic
990166789 5:53003465-53003487 TCTCACATACTGTTAGAGGGAGG + Intronic
991484740 5:67123220-67123242 CCTCAAAAACTGGTGGAGCTGGG + Intronic
991915293 5:71599052-71599074 TCTTAAAAACTTTTGGAGGTAGG - Intronic
991921850 5:71665089-71665111 TCAGGCAAACTGCTGGAAGTGGG + Intergenic
992299404 5:75363179-75363201 TCACACTAACAGCTGGAGTTAGG + Intergenic
992753955 5:79886835-79886857 TATAACAAACAGCTGGAGTTAGG - Intergenic
993827911 5:92715422-92715444 CCTCACACACTGGGGGAGGTAGG - Intergenic
994209816 5:97074683-97074705 TTTCTCAAAGTTCTGGAGGTGGG - Intergenic
995317013 5:110786530-110786552 TCTTACACACTGCTGGAGATGGG + Intergenic
996615899 5:125441059-125441081 GCACAGAAACTGCTGCAGGTGGG + Intergenic
997762095 5:136459103-136459125 TCTCTCACAGTTCTGGAGGTTGG - Intergenic
999611570 5:153375667-153375689 CCTGACAAACTCCTGGATGTAGG - Intergenic
999902678 5:156102577-156102599 TCTCAGAAACTGCTAGAATTTGG - Intronic
999979368 5:156943427-156943449 TCTCACAAAATGGCAGAGGTAGG + Intronic
1000352317 5:160361601-160361623 TCACACAAACTCCCTGAGGTAGG - Intronic
1000730106 5:164824319-164824341 ACTCACAATCTGCTAGTGGTTGG + Intergenic
1000974570 5:167750772-167750794 CCTGACATACTTCTGGAGGTTGG - Intronic
1001270673 5:170309313-170309335 TCTCCCAAACTCCTTGAGATTGG - Intergenic
1001516710 5:172360454-172360476 CCTCACACACTGCTGGAGGGAGG + Intronic
1003145964 6:3511027-3511049 TCTCCCAGACTCCTGGAGGCTGG - Intergenic
1004295128 6:14403236-14403258 TCTCTCACAGTTCTGGAGGTTGG + Intergenic
1004904617 6:20225551-20225573 TCTGACACACTGCTAGAGGTAGG - Intergenic
1005367074 6:25089340-25089362 TCTCATAAACTGGTGAAGCTGGG - Intergenic
1006265850 6:32922766-32922788 TCTCTCACAGTTCTGGAGGTTGG - Intergenic
1006932468 6:37696490-37696512 TCCCACACCCTGCTAGAGGTGGG - Intronic
1007861125 6:44909926-44909948 TCTCACGAATTGCTGGTGGGAGG + Intronic
1009197277 6:60702301-60702323 CCTCCCAAAGTGCTGGGGGTTGG + Intergenic
1011641954 6:89424100-89424122 TCTCAAAAAACGCTGGAGGGGGG + Intergenic
1012163147 6:95913205-95913227 ACTGACAAACTACTGCAGGTTGG - Intergenic
1014349208 6:120318141-120318163 TCTCACACAGTTCTGGAGGCTGG + Intergenic
1015663528 6:135602700-135602722 TCCCACACACTGCTGAAGGTGGG + Intergenic
1016278988 6:142391244-142391266 TCTCACAGTATGCTGTAGGTAGG - Intronic
1017140077 6:151182344-151182366 CCTCCCAAAGTGCTGGGGGTGGG - Intergenic
1017220379 6:151959548-151959570 CCTCAAAAGCTGGTGGAGGTAGG - Intronic
1018045756 6:159965088-159965110 TCTCACACAGTTCTGGAGGCCGG + Intergenic
1018315155 6:162549258-162549280 TTTCTCACACTGCTGGAGGCTGG - Intronic
1019674914 7:2305142-2305164 CCTCAGAAACAGCTGGAGGCAGG + Intronic
1022531691 7:31070785-31070807 AATCAGAAACTTCTGGAGGTGGG - Intronic
1022807992 7:33842435-33842457 TCTCACAGACTGTTGGACTTAGG + Intergenic
1023155189 7:37243747-37243769 TCTAACAAACTGTTTGAAGTAGG - Intronic
1024361787 7:48476089-48476111 TCTCACACAGTTCTGGAGGCTGG + Intronic
1025929701 7:65983721-65983743 CCTCCCAAAGTGCTGGAGTTTGG - Intergenic
1026471948 7:70701226-70701248 TCTCACAAGCTGATTGTGGTGGG + Intronic
1028562520 7:92191220-92191242 TCTTTCTAACTTCTGGAGGTAGG + Intergenic
1028677346 7:93480855-93480877 TCCCACAAAAGTCTGGAGGTTGG + Intronic
1028917540 7:96275982-96276004 TATCTCAAACTGCTGCATGTGGG + Intronic
1029401535 7:100350026-100350048 TCTCACACCCTGCTGGGGGATGG + Intronic
1030187442 7:106777716-106777738 TCTCACACAGTTCTGGAGGTTGG - Intergenic
1030409736 7:109161034-109161056 TCTAAGAAACTTCTGGAGGGAGG + Intergenic
1031789167 7:126078464-126078486 TCTCATAAACTGCTGGTGGAAGG - Intergenic
1032341945 7:131082072-131082094 TTTTACAAAGTGCTAGAGGTGGG - Intergenic
1032907069 7:136380642-136380664 TCTCTCACAGTTCTGGAGGTGGG - Intergenic
1039418356 8:37414939-37414961 TCTCAGCAACTGCATGAGGTAGG - Intergenic
1042185709 8:66134757-66134779 TCTAACAACCTGCTTGGGGTAGG - Intronic
1042804035 8:72752481-72752503 TCTCCCTCACTGCTGGAGCTGGG + Intronic
1044755134 8:95453617-95453639 TCTCATACACTGCTGGTGGAAGG - Intergenic
1046809529 8:118517403-118517425 TCTCCCATACAGCTGGAGATTGG + Intronic
1047327150 8:123850807-123850829 TCTCACAAACTGATGAGGGAAGG - Intergenic
1047963485 8:130028021-130028043 ACTCACAGAATGCTGGAGCTGGG - Intergenic
1049772096 8:144388026-144388048 TTTCACAAAATGTTGGAGGCCGG - Intronic
1050259661 9:3828183-3828205 TCTCACAGACTGCTTGAGGAAGG - Exonic
1050389006 9:5117182-5117204 TTTCTCATACTTCTGGAGGTTGG - Intronic
1050500270 9:6290689-6290711 TCTTACATTCTGCTGGAGCTAGG - Intergenic
1051563102 9:18465349-18465371 TCTCATAAAAGTCTGGAGGTGGG + Intergenic
1055012695 9:71584388-71584410 TTTCTCAAAGTTCTGGAGGTTGG - Intergenic
1055172383 9:73274833-73274855 TCTCCCAAACTGCTGGGTTTAGG - Intergenic
1056453005 9:86734775-86734797 TGTCAAGAACTACTGGAGGTGGG + Intergenic
1056459488 9:86795683-86795705 TCTCACAAACATCTGGAAGAAGG + Intergenic
1057696438 9:97326166-97326188 TCTCACACAGTCCAGGAGGTGGG + Intronic
1059717134 9:116923685-116923707 TCTCAAAAAGAGCTGGAGGGTGG + Intronic
1059862690 9:118482564-118482586 TGTCACATACTGCTGGAGGGAGG + Intergenic
1059971725 9:119675417-119675439 TCTGACAAGCTGCTTGACGTTGG + Intergenic
1060942156 9:127549017-127549039 TCACACCAACTCTTGGAGGTGGG - Intronic
1185645791 X:1614762-1614784 TCTCTCACACTTCTGGAGGCTGG - Intergenic
1186057104 X:5661388-5661410 TCTCTCAAAGTTCTGGAGGTGGG - Intergenic
1186140210 X:6563948-6563970 TCTGACTTACTGCTTGAGGTAGG - Intergenic
1186396556 X:9214519-9214541 TTTCTCACACTTCTGGAGGTTGG + Intergenic
1186549546 X:10488410-10488432 TCTCACAAACTGCTGGAGGTGGG - Intronic
1188281529 X:28275937-28275959 TCTCATATACTGCTGGTGGTAGG - Intergenic
1188845364 X:35065609-35065631 TCTCTCACAGTTCTGGAGGTTGG + Intergenic
1189385831 X:40536173-40536195 TCTCAAAAAAAGGTGGAGGTGGG + Intergenic
1191754287 X:64577357-64577379 GCTCACAAACTGCAGAATGTGGG + Intergenic
1193238154 X:79133895-79133917 TCTCTCAAAGTTCTGGAGGCTGG + Intergenic
1196405005 X:115352041-115352063 TCTCCCAAAGTGCTGGAATTAGG - Intergenic
1197529694 X:127607628-127607650 TATCACAAAGAGCTGGAAGTAGG - Intergenic
1199323342 X:146467654-146467676 TCACACCAACTGCTGGAGCTGGG - Intergenic
1199912809 X:152306210-152306232 TCTCACACACTGCTGCAGTTGGG + Intronic
1199998667 X:153044605-153044627 TCTCTCACAGTTCTGGAGGTTGG - Intergenic
1201232479 Y:11878687-11878709 TCTCTCACAGTGCTGGAGGCTGG - Intergenic
1201253128 Y:12080743-12080765 TCTCACTAACTCCTGGTGGTTGG - Intergenic