ID: 1186549985

View in Genome Browser
Species Human (GRCh38)
Location X:10493531-10493553
Sequence GTGCAAAACCTCAATTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186549983_1186549985 29 Left 1186549983 X:10493479-10493501 CCAAGTTTAAGGTAATTTGTTAT 0: 1
1: 37
2: 656
3: 2658
4: 6314
Right 1186549985 X:10493531-10493553 GTGCAAAACCTCAATTAGAGAGG 0: 1
1: 0
2: 2
3: 21
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186549985 Original CRISPR GTGCAAAACCTCAATTAGAG AGG Intronic
905583355 1:39098795-39098817 GTGCAACATCTCAATTTAAGAGG - Intronic
907342712 1:53748266-53748288 CTTCAAAACCTCATTCAGAGAGG + Intergenic
909235173 1:73143753-73143775 GAACAAAACCTCAAGAAGAGTGG - Intergenic
910323247 1:85974118-85974140 GGGCAAATCCACTATTAGAGAGG + Intronic
911708844 1:101045424-101045446 TTGCAAAACCTAAATTATATTGG + Intergenic
913120796 1:115738832-115738854 GTGCAAAGCCTCAATTAGACAGG - Intronic
914318467 1:146536217-146536239 GTGCAAAATCTGAGTCAGAGGGG - Intergenic
914495893 1:148197140-148197162 GTGCAAAATCTGAGTCAGAGGGG + Intergenic
915424387 1:155812263-155812285 GTGCAAAACCTGAATCTAAGAGG + Intronic
916714459 1:167437747-167437769 GTACAAAGCCTCAATTAGATAGG + Intronic
917319701 1:173767010-173767032 GTACAAAATTTCAGTTAGAGAGG - Intronic
919653166 1:200170581-200170603 GTGAACTACCTCAATTACAGTGG + Intronic
924355356 1:243168673-243168695 GTACAAAATCTCACTTAGACAGG - Intronic
924589076 1:245386363-245386385 GTACAAAGCCTCAGTTAGATAGG - Intronic
1063303507 10:4875331-4875353 GTTCAAAACCTGAATCAGAGGGG + Intergenic
1066603964 10:37140839-37140861 TTGCAAAACCTAACTTACAGAGG - Intronic
1067498354 10:46778939-46778961 GCACAAAGCCTCAATTAGACAGG + Intergenic
1067596293 10:47561476-47561498 GCACAAAGCCTCAATTAGACAGG - Intergenic
1071078900 10:81785706-81785728 GTACCAAATCTCAATTAGACAGG - Intergenic
1074433318 10:113411925-113411947 GTACAAAGCCTTAATTAGAAAGG + Intergenic
1078593790 11:12669445-12669467 GTGCAGAAGCCCAATTGGAGAGG + Intergenic
1079827322 11:25213590-25213612 GAGCAAACCTTCAATTAGAGTGG - Intergenic
1082682648 11:56195572-56195594 GTACAAAGTTTCAATTAGAGAGG + Intergenic
1086171329 11:83839889-83839911 AGTCAAAACCTGAATTAGAGGGG - Intronic
1091764964 12:3113802-3113824 TTGCAAAACCTCAAAGAGGGAGG - Intronic
1094266156 12:28562524-28562546 GTATAAAATTTCAATTAGAGAGG + Intronic
1096026708 12:48371044-48371066 ATGCAAAACTTCACTTAGATTGG + Intergenic
1097836521 12:64278704-64278726 GTACAAAACTTCAGTTAGACAGG - Intronic
1101042058 12:100765981-100766003 GTACAAAATTTCAATTAGATAGG - Intronic
1101051315 12:100866951-100866973 GAGCAAAGGCTCAATTACAGTGG - Intronic
1109084778 13:57955965-57955987 GTGCAAAGCCCCAATTAGACAGG - Intergenic
1119475855 14:74927688-74927710 GTGCAGAGCCTCAATTAGCCTGG + Intergenic
1128836461 15:70812801-70812823 GGGTAAAACCTCAAATAGAATGG - Intergenic
1130551357 15:84891712-84891734 GTGCAAAAACTGAATTGGAGCGG + Intronic
1131163306 15:90124011-90124033 GTACAAATCCTCAATTAGACAGG - Intergenic
1131352997 15:91718536-91718558 CTGCAAAAACTCAAAAAGAGAGG - Intergenic
1132402012 15:101516663-101516685 GTACAAAGCCTCAGTTAGACAGG - Intronic
1138048071 16:53746811-53746833 GTACAAAGCCTCAATTAGACAGG - Intronic
1138753527 16:59454006-59454028 GTGCAATTCCTCAATTAGAGAGG + Intergenic
1149430223 17:56591807-56591829 CTGCAAAACCTCTATTAAAAGGG - Intergenic
1156861606 18:41842809-41842831 GTGCAAAACAGGAATCAGAGTGG + Intergenic
1158487067 18:57877181-57877203 CTGCAAAAGCTCAGTTGGAGAGG + Intergenic
1162233679 19:9287871-9287893 GTGCAAAATTTCAGTTAGACAGG + Intergenic
1164646809 19:29864148-29864170 CTGAAAAACCTCAATTAGCCAGG + Intergenic
1165280203 19:34790641-34790663 GTGCAAAATTTCAGTTAGACAGG + Intergenic
1167417145 19:49380755-49380777 GGGCATTAGCTCAATTAGAGAGG + Intergenic
930980169 2:57514981-57515003 GAGCAAACCCTCAATTTCAGTGG + Intergenic
932941885 2:76176747-76176769 GTACAAAGTCACAATTAGAGAGG - Intergenic
934140764 2:89045102-89045124 GTGGAAAACAGGAATTAGAGAGG - Intergenic
934228472 2:90155440-90155462 GTGGAAAACAGGAATTAGAGAGG + Intergenic
938965306 2:136382897-136382919 GGGCAAAACCTAATTTAGATTGG + Intergenic
939720173 2:145639594-145639616 GTGCCAAATCTCAATTAGACGGG + Intergenic
940714858 2:157209889-157209911 GTACAAATCCACAATTATAGTGG - Intergenic
941516768 2:166490205-166490227 GTGCAAAATTTCAGTTAGAGAGG - Intronic
943342908 2:186702468-186702490 ATGCAAAACGCCAATTAAAGAGG - Intronic
944603954 2:201332669-201332691 GTACAAAATCTCAATTAGGCAGG - Intronic
946623438 2:221584776-221584798 GTACAAAATCTCAGTTAGACAGG - Intergenic
948045687 2:234942039-234942061 GTACAAAGCCTCAGTTAGACAGG - Intergenic
948958117 2:241310301-241310323 GTACAAAACATCAATTAGACAGG + Intronic
1169963238 20:11186643-11186665 GTTCAAAACCTTAATTAAAAGGG - Intergenic
1170482358 20:16779043-16779065 AGGCAAAAGCTCAATTAGAGTGG + Intergenic
1174854075 20:54026299-54026321 GGGTAGAACCTCAATTTGAGTGG - Intronic
1180246295 21:46550235-46550257 GCACAAAGCCTCAATTAGACAGG - Intronic
1183451755 22:37899911-37899933 GTGCAAAATTTCAGTTAGATAGG - Intergenic
1184600595 22:45541110-45541132 TTGCAAAACCACAAATGGAGGGG - Intronic
949587808 3:5459862-5459884 GTGCCAAACCTCAATCTGAGAGG - Intergenic
950989132 3:17413053-17413075 GTGCAAAACCTTAAATGGAATGG + Intronic
951294381 3:20916239-20916261 ATGCCAAACCTCAAATGGAGTGG + Intergenic
953592417 3:44271859-44271881 GTACAAAACCTCAATTAAACAGG - Intronic
954550620 3:51478354-51478376 ATGCAAAGCCTAAAATAGAGGGG - Intronic
955884365 3:63582033-63582055 GTGCATAAACTGAATGAGAGTGG + Intronic
956353463 3:68364485-68364507 GTACAAAAACTTAATTAAAGAGG + Intronic
956598836 3:70997119-70997141 GTGCATCACCTCCTTTAGAGGGG - Intronic
956753019 3:72359874-72359896 GGGCAAAGCCTCACCTAGAGTGG - Intergenic
958184378 3:90101574-90101596 GTACAAAGCCTCAAATAGACAGG - Intergenic
961210913 3:125124988-125125010 TGGGAAAACCTTAATTAGAGAGG + Intronic
961520457 3:127464715-127464737 GGGCACAGCCTCAATCAGAGAGG + Intergenic
962830913 3:139139455-139139477 ATACAAAATCTCAATTAGATAGG - Intronic
964091509 3:152882275-152882297 GTGCAAAGCCTCAGTCAGACAGG - Intergenic
965099957 3:164283597-164283619 ATGCAAAATTTCAGTTAGAGAGG + Intergenic
965908865 3:173746005-173746027 GTACAATGCCTCACTTAGAGAGG - Intronic
966100220 3:176259933-176259955 GTACAAAGCCTCATTTAGAAAGG - Intergenic
967236887 3:187393683-187393705 GAGCAACACCACAATTAGATGGG - Intergenic
970413006 4:15828436-15828458 GTACAAAATCTCAGTTAGAAAGG - Intronic
970800662 4:19969642-19969664 GTGCAATTTCTCAATTAGAGGGG + Intergenic
971651837 4:29286321-29286343 TTGGAAAATGTCAATTAGAGTGG - Intergenic
975175064 4:71279187-71279209 GTACAAAATTTCAATTAGACAGG - Intronic
975217792 4:71776538-71776560 GTGCAAAATTTCAGTTAGACAGG + Intronic
976713992 4:88103678-88103700 GTACAAAACCTCAGTTACACAGG - Intronic
981622452 4:146717854-146717876 GTACAAAGCCTCAATTAGACAGG - Intronic
983929499 4:173437579-173437601 GAGCAAACACCCAATTAGAGTGG + Intergenic
985992156 5:3572156-3572178 GTGCAAAACCTCACTTAGGCAGG + Intergenic
985992163 5:3572200-3572222 GTACAAAACCTCAGTTAGGCAGG + Intergenic
990895216 5:60692215-60692237 GTACAAAGCCTCAACTAGACAGG + Intronic
991325756 5:65430327-65430349 CTGCAAAAACAGAATTAGAGAGG + Intronic
996313805 5:122138337-122138359 ATGCAAACCCACAATAAGAGGGG + Intronic
1001626136 5:173134688-173134710 GTGCAAAACTTTACTTAGACTGG - Exonic
1002369640 5:178741454-178741476 GTGTAAAATCTCATTTGGAGAGG - Intergenic
1003425076 6:5993794-5993816 CTGCAAACCCCCAACTAGAGTGG - Intergenic
1005114595 6:22321658-22321680 GTGCACCAACTCAATTACAGTGG - Intergenic
1007136598 6:39528075-39528097 GTACAAAGCCTCAACTAGATGGG - Intronic
1007284428 6:40737415-40737437 GTGAAAAACATCCTTTAGAGAGG + Intergenic
1007820198 6:44555304-44555326 GTGCAAAAGGTGAATCAGAGAGG + Intergenic
1008184091 6:48369192-48369214 GTACAAAATTTCAATTAGACAGG - Intergenic
1011176613 6:84568393-84568415 GTGCAAAATCTCAACTAGACGGG + Intergenic
1021137718 7:16986185-16986207 GTGTAAAACCTCAGTGAGGGGGG + Intergenic
1021865228 7:24949739-24949761 GTGCACAACCTCAAGCAGAGGGG + Intronic
1023571700 7:41579071-41579093 GGGCAAAGCCTTCATTAGAGAGG + Intergenic
1027580113 7:79982426-79982448 CTGCAAAACATGAATTAAAGGGG - Intergenic
1028288353 7:89033063-89033085 ATACAAAGCCTCAATTAGACAGG - Intronic
1030740542 7:113103867-113103889 CTGAAAAACTTCAATTAAAGCGG + Intergenic
1031278925 7:119770095-119770117 GTACAAAGCCTTAATTAGACAGG + Intergenic
1031803435 7:126277153-126277175 GAGCAAAACCTCACATAGAATGG + Intergenic
1033107957 7:138547274-138547296 CTGCAAAATTTCAATTAGATAGG + Intronic
1035554048 8:551852-551874 GTGAAAAAGCTCAATAAGTGAGG + Intergenic
1036149567 8:6285001-6285023 GTGCAAAACCTGGATTGAAGTGG + Intergenic
1039159868 8:34605595-34605617 ATACAAAGCCTCAATTAGATGGG - Intergenic
1041996593 8:64068366-64068388 GAGCAAAATCTCACTTAGATGGG + Intergenic
1044090809 8:87998044-87998066 TTGAAAAACCTCAATTAGACTGG - Intergenic
1044444431 8:92257936-92257958 GTGAAAAAGATGAATTAGAGGGG + Intergenic
1045139300 8:99262496-99262518 GTGAAAAACCTAAATAAAAGTGG - Intronic
1046186132 8:110722132-110722154 GTGCAAAATTTGAATTAGAGTGG - Intergenic
1047934589 8:129764463-129764485 GTGCAAGTCCTCATTGAGAGTGG - Intronic
1059366286 9:113789021-113789043 GCTCAAAAGCTAAATTAGAGCGG - Intergenic
1061895647 9:133645883-133645905 GTGCAAAACTTCCATGAAAGGGG + Intronic
1185487995 X:497806-497828 CTGCAAAACCACGATGAGAGAGG + Intergenic
1186027458 X:5328409-5328431 GTGCAAAAACCCGATTATAGTGG + Intergenic
1186549985 X:10493531-10493553 GTGCAAAACCTCAATTAGAGAGG + Intronic
1188045758 X:25425025-25425047 GTGCAAAACCTCAAGAAGTCTGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1190949701 X:55131207-55131229 GTACAAAGCCTCAATTAGACAGG + Intronic
1192462832 X:71332109-71332131 GTACAAAGCCTCAATTAGGAGGG + Intergenic
1195980368 X:110570790-110570812 GTACAAAGCCCCAATTAGACAGG + Intergenic
1197847696 X:130820841-130820863 GTGCAAAATTTCAGTTAGAAAGG + Intronic