ID: 1186552737

View in Genome Browser
Species Human (GRCh38)
Location X:10523605-10523627
Sequence GAGGCTAATCCCTTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186552729_1186552737 16 Left 1186552729 X:10523566-10523588 CCATTGGATTTTTCAGATTTATC 0: 1
1: 0
2: 4
3: 38
4: 433
Right 1186552737 X:10523605-10523627 GAGGCTAATCCCTTGGAGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 130
1186552734_1186552737 -6 Left 1186552734 X:10523588-10523610 CCTTTTATGGGCAGGCTGAGGCT 0: 1
1: 0
2: 1
3: 55
4: 672
Right 1186552737 X:10523605-10523627 GAGGCTAATCCCTTGGAGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186552737 Original CRISPR GAGGCTAATCCCTTGGAGGA AGG Intronic
900271206 1:1789899-1789921 AGGGCTAATCTCATGGAGGAAGG + Intronic
903127064 1:21255404-21255426 GAGGCTGAGCCCTTGGACGTTGG + Intronic
904585122 1:31575984-31576006 GCGGCTCATCCCTGGGAGGTGGG - Intergenic
904747891 1:32722196-32722218 TGGGCCATTCCCTTGGAGGATGG + Intergenic
905628013 1:39501189-39501211 CAGACTAATGCCATGGAGGAGGG - Intronic
905651039 1:39657164-39657186 GAGGCTGGTCCCAGGGAGGAAGG - Intergenic
905780086 1:40701206-40701228 CAGGAGAATCCCTTGGAGGCAGG - Intronic
906878000 1:49558843-49558865 GAGGCTCATCCTTTGGAAAAAGG + Intronic
908210067 1:61891094-61891116 GAGGCTGATGTCTGGGAGGATGG + Intronic
913441252 1:118900256-118900278 GAAGCTAATCCATTTCAGGAAGG - Intronic
914986495 1:152461646-152461668 GAGGCTAAGCCCTTTGTGGGAGG - Intergenic
915449776 1:155996557-155996579 GAGGTTATACACTTGGAGGAAGG - Intronic
920207912 1:204306468-204306490 GAGGCCAAAGCCTTGGAAGAGGG - Intronic
922500466 1:226093774-226093796 GAGGCCAAGCCCTTGCAGGGTGG - Intergenic
924231991 1:241970080-241970102 GAAGCTATGCCCTAGGAGGATGG + Intergenic
1063684892 10:8227681-8227703 CAGCCACATCCCTTGGAGGAAGG + Intergenic
1064324374 10:14334790-14334812 CAGGAGAATCCTTTGGAGGAAGG + Intronic
1064517857 10:16169699-16169721 GAGGCTGGTCCCCTTGAGGAAGG - Intergenic
1067315441 10:45156870-45156892 GAGGCTGCACCCTTGGTGGAGGG + Intergenic
1070512450 10:77173852-77173874 GAAGCAACTCCCTTGGGGGAGGG + Intronic
1070636730 10:78134545-78134567 GAGTCTATTCCCTTGGATGGAGG + Intergenic
1071183986 10:83019501-83019523 GAGGCTTAACTCTAGGAGGAAGG + Intergenic
1071435012 10:85640655-85640677 GAAGCTGATCCCTAGAAGGATGG - Intronic
1075898429 10:126018707-126018729 GAGGCTAACCCCATGGTGTAGGG - Intronic
1076032338 10:127170167-127170189 GAGTCTAGTACCTTGCAGGAAGG - Intronic
1077904029 11:6514901-6514923 GAGTCTCATCCCATGGTGGAGGG + Intronic
1085201738 11:74706138-74706160 GAGGCCATTCCCTGGGAAGAAGG + Intronic
1086593548 11:88544117-88544139 GAGGGTCATCCCATGGTGGAAGG - Intronic
1090931356 11:131300611-131300633 GAGACTGAGGCCTTGGAGGAGGG - Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1093278491 12:17159764-17159786 GAGGCTGATCGCTTGGTGGGAGG + Intergenic
1095540199 12:43300948-43300970 CATACTAATCCCTTGGAGGCAGG + Intergenic
1106287890 13:28334110-28334132 CAGGCAAATCACTTGGAAGAGGG - Exonic
1114010388 14:18359918-18359940 GAAGCTGCACCCTTGGAGGAGGG + Intergenic
1115840951 14:37469816-37469838 GAGGGTCATCCCATGGTGGAAGG - Intronic
1116644572 14:47510133-47510155 GATGCTAATCCCATTCAGGAGGG - Intronic
1118594555 14:67425692-67425714 GAGGCTGGTCCCTGGGAGGCAGG - Intergenic
1122921540 14:104882405-104882427 GAGGCTCATCCCCTGGGGCATGG - Intronic
1126072732 15:44879958-44879980 GAGGAGACTCCCATGGAGGATGG - Intergenic
1126085518 15:45007643-45007665 GAGGAGATTCCCATGGAGGATGG + Intergenic
1131058793 15:89391841-89391863 GCGGCTAAACCCTGGGAGGTAGG - Intergenic
1131265077 15:90910948-90910970 GGGGCTCACCACTTGGAGGAAGG - Exonic
1132361206 15:101217478-101217500 GAGGCTCTTCTCTTGGAGAATGG - Intronic
1133231864 16:4370790-4370812 AAGGCTTATCCCTGGGAGGCTGG - Intronic
1135617297 16:23922724-23922746 GTGGCTAAGGCCCTGGAGGAAGG - Intronic
1138834463 16:60416868-60416890 GATGCTAGTGCCTTGGATGAGGG + Intergenic
1139177046 16:64701065-64701087 GAGCCTAAGTCCTTGGAGGCGGG - Intergenic
1144955239 17:19015732-19015754 GAGGCTCATTCCTTGGTTGAGGG - Intronic
1145123830 17:20284150-20284172 GAGACTAATCCCTGGGAGAAGGG + Intronic
1146474249 17:33150199-33150221 GATGCTAATGCCTTAGATGAAGG - Intronic
1149521942 17:57324184-57324206 GAGTCTGAGGCCTTGGAGGAGGG + Intronic
1151999614 17:77637241-77637263 GAGGCCAATCCCCTGGAGCCTGG - Intergenic
1155119347 18:22802661-22802683 GAGGCTCAACACTTAGAGGAGGG - Intronic
1155591508 18:27433021-27433043 GAGCCTCATCCCATGGTGGAAGG - Intergenic
1157781495 18:50443904-50443926 GAGGGTCATCCCATGGTGGAAGG + Intergenic
1162365344 19:10245360-10245382 GCGGCTAAAGCCATGGAGGAAGG + Intergenic
1162467051 19:10848654-10848676 GAGGCTGAGCCCTTGGCAGATGG + Intronic
1165913637 19:39244750-39244772 GAGGCTAGTCCATGGCAGGAGGG + Intronic
1165917325 19:39268874-39268896 GAGGCTAGTCCATGGCAGGAGGG - Intronic
925180305 2:1813225-1813247 GAGGCTGCTCGCTGGGAGGACGG - Intronic
926120326 2:10238138-10238160 GAGGCCAGTCCTTTGGAGGATGG + Intergenic
929114756 2:38434748-38434770 GAGGGTCATCCCATGGTGGAAGG - Intergenic
929617252 2:43321622-43321644 GAGGGTCATCCCATGGTGGAAGG - Intronic
931460808 2:62448616-62448638 AAGGCTAAACCCATGCAGGATGG + Intergenic
932090604 2:68802584-68802606 GAAGCTATTGCCTTTGAGGAAGG + Intronic
932479085 2:72027894-72027916 GAGGGTGAGTCCTTGGAGGAGGG - Intergenic
932748033 2:74350810-74350832 GAGGCAACATCCTTGGAGGATGG - Intronic
932781241 2:74560033-74560055 AAGGCTACTCCCTTGGATGGGGG + Intronic
936083730 2:109452778-109452800 GAGGCTGGTCCCTGGGAGGCTGG + Intronic
936083748 2:109452835-109452857 GAGGCTGGTCCCTGGGAGGCTGG + Intronic
936083790 2:109452948-109452970 GAGGCTGGTCCCTGGGAGGCTGG + Intronic
938689447 2:133774142-133774164 CAGGCTAATCAGCTGGAGGAGGG - Intergenic
943564503 2:189501409-189501431 GAGGCTAAGATCTTTGAGGATGG + Intergenic
947297947 2:228654011-228654033 GAGCCAAAGACCTTGGAGGAAGG - Intergenic
948226092 2:236310278-236310300 GATGCTAAGCATTTGGAGGATGG + Intergenic
1172069263 20:32244542-32244564 AAGCCTAACCCCTTGGAGGTGGG - Intergenic
1174783117 20:53408224-53408246 GAGTCTGAGCCCTTTGAGGAAGG + Intronic
1174945756 20:54983585-54983607 GAGGCTACTCCCTTAGGGCATGG + Intergenic
1175914853 20:62421057-62421079 GAGGCCAATCTGTGGGAGGAGGG - Intronic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1179927224 21:44541742-44541764 AGGGCTACTCCCTAGGAGGAAGG + Intronic
1180434881 22:15290718-15290740 GAAGCTGCACCCTTGGAGGAGGG + Intergenic
1180928324 22:19571432-19571454 GAGACACACCCCTTGGAGGAGGG + Intergenic
1182304240 22:29356843-29356865 GTGGCTAAGCCCTTGGAGCTAGG - Intronic
1183580846 22:38725849-38725871 GAGGTCAAGCCCTTGGAGGCAGG + Intronic
1184149145 22:42628463-42628485 GAGGCTGACTCCTGGGAGGACGG - Intronic
1184975076 22:48055831-48055853 GAGCTTAATCCCCTGGAGGAGGG + Intergenic
950445445 3:13034906-13034928 GAGGCCGATCCCTGGGAGCATGG - Intronic
952669431 3:35948272-35948294 GAGGTCAATTCCTTGGAGAAGGG + Intergenic
953028452 3:39159436-39159458 GAGGGGAATTCCTTTGAGGAGGG - Intergenic
955184178 3:56699311-56699333 GACGCTAATCCCATGCATGAGGG - Intergenic
955514526 3:59713612-59713634 GAGGGTCATCCCTTGGAGGAAGG + Intergenic
964604124 3:158540920-158540942 GAGGGTGATCCTTTGGAGAAGGG + Intronic
971981543 4:33757726-33757748 GAGGGTCATCCCATGGTGGAAGG + Intergenic
975206681 4:71651833-71651855 GAGGCTGATCCCCTTGAAGAAGG + Intergenic
975623316 4:76315896-76315918 AAGGCCCATCCCTTGGGGGAGGG + Intronic
979084781 4:116393758-116393780 GATGCTGTTCCCTGGGAGGAAGG + Intergenic
980957531 4:139444439-139444461 GAGGCCAGTCCCCTTGAGGAAGG + Intergenic
981564946 4:146090552-146090574 GAGGCTAAACTTTTGGAGGTTGG + Intergenic
981599441 4:146469102-146469124 GAGGCTAATGGCTTCTAGGAGGG + Intronic
981921071 4:150085379-150085401 GAGGGTCATCCCATGGTGGAAGG + Intronic
986361941 5:6987283-6987305 GAGGCTAAATGGTTGGAGGAGGG - Intergenic
988680359 5:33479150-33479172 GAGGCTAAAGCCCAGGAGGAGGG - Intergenic
989145377 5:38244535-38244557 CAGGATAATCGCTTGGAGGCAGG - Intergenic
995037611 5:107553026-107553048 AAAGCTAATTCCTTAGAGGAGGG - Intronic
999316224 5:150585805-150585827 GCAGCTTATTCCTTGGAGGAAGG + Intergenic
999410872 5:151348659-151348681 GAAGCTTATCCCATGGAGAAGGG - Intergenic
999481174 5:151949494-151949516 GATGCTAATCCCATGCATGAGGG - Intergenic
1006636686 6:35466346-35466368 GAGGGTGGTCCCTTGGTGGATGG - Exonic
1007482320 6:42158281-42158303 GAGGTTAGTCACTTGGAGGCTGG + Intronic
1008492671 6:52102571-52102593 GAGGGTAATTCTTGGGAGGAGGG - Intergenic
1010258889 6:73792640-73792662 GAGGCTAAGCCATTGATGGAAGG - Exonic
1011546702 6:88489465-88489487 TAGGCCAAAGCCTTGGAGGAAGG - Intergenic
1015510893 6:134037313-134037335 GAGGGTAAGCCTATGGAGGAGGG - Intronic
1017723409 6:157260045-157260067 GAGGATAATCTGGTGGAGGAAGG - Intergenic
1022610956 7:31872628-31872650 GAGGCTCATCCCTTTGATGAGGG + Intronic
1024019526 7:45353226-45353248 GAGAAAGATCCCTTGGAGGAAGG + Intergenic
1024460926 7:49658671-49658693 TAGGAAAATCCCTTTGAGGAGGG + Intergenic
1025875224 7:65475569-65475591 GAGAATACTCCCCTGGAGGAGGG - Intergenic
1026688088 7:72529769-72529791 GTGGCTACTCACATGGAGGAAGG + Intergenic
1026723313 7:72851618-72851640 GTGGCTACTCACATGGAGGAAGG + Intergenic
1026896402 7:74012402-74012424 GAGGCTATGCCCTTGGAGACTGG + Intergenic
1028637769 7:93008966-93008988 GAGTCTAATCCCATTGAGGAAGG - Intergenic
1031997444 7:128241805-128241827 AAGGCCAATGCCTGGGAGGAAGG + Intronic
1032864793 7:135914732-135914754 GAAGCTGTTCACTTGGAGGAGGG + Intergenic
1034899768 7:154900481-154900503 GAGGCTGTGCCCTTGTAGGAAGG + Intergenic
1039304726 8:36249172-36249194 GAGGCTCATTCATTGGAGAAAGG + Intergenic
1041454923 8:58048448-58048470 GACACCAATGCCTTGGAGGAGGG - Intronic
1049361982 8:142216221-142216243 GAGGCTCAGCCCTCAGAGGAGGG - Intronic
1051362441 9:16293233-16293255 GACGCTAATCCCTTTCACGAGGG - Intergenic
1058347671 9:103982921-103982943 TAGTCAAATCCCTTGGAGGAAGG - Intergenic
1060218459 9:121752258-121752280 GTGGTTGTTCCCTTGGAGGAGGG - Intronic
1060726032 9:126006519-126006541 GAGGCTGGTCCCCAGGAGGAAGG - Intergenic
1186552737 X:10523605-10523627 GAGGCTAATCCCTTGGAGGAAGG + Intronic
1192217774 X:69175883-69175905 GAGGGTAATCCCATGGTGGAAGG - Intergenic
1197115962 X:122834121-122834143 GAGGCTGAGCCCATGGATGAAGG + Intergenic
1197413800 X:126150551-126150573 GAGGGAAACCCCTAGGAGGAGGG - Intergenic
1198212465 X:134529059-134529081 GAGGCTTCTCCCTGGGATGAAGG + Intergenic