ID: 1186556026

View in Genome Browser
Species Human (GRCh38)
Location X:10559717-10559739
Sequence CTTTCTCTGTTGATGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 279}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186556026_1186556029 -6 Left 1186556026 X:10559717-10559739 CCTGCCACCATCAACAGAGAAAG 0: 1
1: 0
2: 0
3: 21
4: 279
Right 1186556029 X:10559734-10559756 AGAAAGTATTTAGTAGCTGTTGG 0: 1
1: 0
2: 0
3: 19
4: 281
1186556026_1186556033 30 Left 1186556026 X:10559717-10559739 CCTGCCACCATCAACAGAGAAAG 0: 1
1: 0
2: 0
3: 21
4: 279
Right 1186556033 X:10559770-10559792 ACTATAAGCTCCATGAAGGCAGG 0: 6
1: 38
2: 230
3: 945
4: 2613
1186556026_1186556032 26 Left 1186556026 X:10559717-10559739 CCTGCCACCATCAACAGAGAAAG 0: 1
1: 0
2: 0
3: 21
4: 279
Right 1186556032 X:10559766-10559788 CTAGACTATAAGCTCCATGAAGG 0: 10
1: 78
2: 431
3: 1441
4: 3200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186556026 Original CRISPR CTTTCTCTGTTGATGGTGGC AGG (reversed) Intronic
901807999 1:11749948-11749970 CTGTCTCTGTGCATGGTGTCAGG + Intronic
904094213 1:27965204-27965226 CTTTGTCTGTTGAGGGTTGGGGG + Intronic
904260726 1:29286117-29286139 CTCTCTCTCTTGCTGGTGTCTGG - Intronic
904379837 1:30103249-30103271 CTTTCTCTATTGTGAGTGGCTGG + Intergenic
905035880 1:34918215-34918237 CTGTGTCAGTGGATGGTGGCAGG - Intronic
905635381 1:39547814-39547836 CTGTCCCTTTTGATGGAGGCTGG + Intergenic
905942526 1:41875254-41875276 CTGTCTTTGTAGATGGTGCCTGG + Intronic
907686289 1:56615078-56615100 ATGTCTATTTTGATGGTGGCAGG - Intronic
908793636 1:67809226-67809248 CTTTCTTTTTTGGTGGGGGCAGG - Intronic
909568999 1:77086848-77086870 CTTCCTCAGGGGATGGTGGCTGG + Intergenic
910323534 1:85976976-85976998 CTTGCTCTGGTGGAGGTGGCAGG - Intronic
912032169 1:105262357-105262379 CTTTCTCTGTTGCTTTTGTCAGG + Intergenic
912979685 1:114360017-114360039 CTTTCTGTGTTGATAGTTGTGGG + Intergenic
914869706 1:151462686-151462708 CTTTCTGTATTCTTGGTGGCAGG - Intergenic
916013194 1:160725319-160725341 CTTTCTCTGTTGGACTTGGCTGG + Intergenic
916524820 1:165599582-165599604 CCTTCTCTTTTGAAGGTGCCTGG + Intergenic
916709174 1:167387102-167387124 CGTTCTCTGCATATGGTGGCAGG + Intronic
917290989 1:173471937-173471959 CATCTTATGTTGATGGTGGCAGG - Intergenic
920425602 1:205872685-205872707 CTCTCCCTGTTGATTGTGTCTGG + Intergenic
920690141 1:208140056-208140078 CTATCTCTGCTCATCGTGGCTGG + Intronic
920934459 1:210418219-210418241 CCTTCTTTGCTGGTGGTGGCTGG + Exonic
921610266 1:217205599-217205621 CATTTTATGTGGATGGTGGCAGG - Intergenic
1063434287 10:6018113-6018135 CTCTCTCTATTGACAGTGGCCGG - Exonic
1064741552 10:18439833-18439855 TTTACTCTGTTCCTGGTGGCTGG - Intronic
1064815442 10:19256446-19256468 CTTTCACTCATGATGGTGGTGGG + Intronic
1069335951 10:67350599-67350621 TTTTCTTTGTTGTTGGTGGTGGG - Intronic
1069783070 10:70969114-70969136 TTTTCTTTATTGATAGTGGCTGG + Intergenic
1070183485 10:74037266-74037288 TTTTCTGTTTTGATGGTGACAGG + Intronic
1070812730 10:79306411-79306433 ATTTCTGTGCTGATGGTGGCAGG + Intronic
1072412048 10:95211866-95211888 CTTTCTCTTTAGACGGTGGATGG + Exonic
1072590899 10:96827661-96827683 CTTTCGCAGTTGGTGGTGGTTGG + Intergenic
1072890891 10:99323508-99323530 CTTCCTCAGTTGATGGTTGATGG - Intergenic
1074189447 10:111123248-111123270 CTTTCTCTATTGGAGGTGGGGGG + Intergenic
1075281021 10:121138507-121138529 ATTTCTCTGCTGATGGTGTTTGG - Intergenic
1075948881 10:126460522-126460544 GGTTCTCTGTTCCTGGTGGCTGG - Intronic
1076437291 10:130454855-130454877 CTCTCCCTGCTGCTGGTGGCAGG + Intergenic
1077381072 11:2237901-2237923 GGTTATCTGTGGATGGTGGCAGG - Intergenic
1077396431 11:2325685-2325707 CGTTCTCTTTTGATCGTGGGAGG - Intergenic
1077528119 11:3080851-3080873 ATTTATCTGTTGATGGACGCAGG - Intergenic
1077906540 11:6538996-6539018 TCCTCTCTGCTGATGGTGGCTGG + Intronic
1078176463 11:8975129-8975151 CCCTCTCTGATTATGGTGGCTGG + Intergenic
1079309403 11:19350972-19350994 CTTTCTCTTCTGCTGTTGGCTGG - Intronic
1080926551 11:36763237-36763259 CTTTTTTTTTTGATAGTGGCAGG + Intergenic
1080978717 11:37374837-37374859 CTATTTCTGTTGCTGGTAGCTGG - Intergenic
1081388007 11:42495910-42495932 CTTCCTTTTTTGATTGTGGCAGG - Intergenic
1081630833 11:44688513-44688535 CTTACTCTCTTGATTGTGGTCGG + Intergenic
1082855317 11:57800933-57800955 CTTTCTCTGTTCCTAGTGGCTGG + Intronic
1084399844 11:68937159-68937181 TTCCTTCTGTTGATGGTGGCAGG - Intronic
1086322039 11:85660823-85660845 ATTTGTCTTTTGATGGTGGCAGG - Intronic
1086869306 11:92017829-92017851 CCTGCTCTGGTGAAGGTGGCAGG + Intergenic
1087402054 11:97680082-97680104 CTTTCTCTGGTTTTGGTGACAGG + Intergenic
1087461125 11:98449176-98449198 TTTTCTCTGTTGATGATTACTGG - Intergenic
1089011504 11:115135795-115135817 TTTTCTCTGATGCTGGTGGTTGG - Intergenic
1090241146 11:125182764-125182786 CCTTCTCTGTAGCTGCTGGCAGG - Intronic
1090756765 11:129798546-129798568 CCTTCTCTGGTGGAGGTGGCAGG - Intergenic
1092200962 12:6582492-6582514 TTTTCTCTGTTGAAGTTGGCAGG - Intronic
1092892452 12:12981377-12981399 GTTTCTCTGTAGATGATGCCCGG - Intronic
1095878740 12:47109270-47109292 CTCTCTCTGTAAATGGAGGCAGG + Intronic
1096370803 12:51067519-51067541 CTTACTCTGTTGACGGAGGAGGG + Intronic
1097359734 12:58645727-58645749 CATTCTCTCTTGGGGGTGGCGGG + Intronic
1097605937 12:61754579-61754601 ATTTCTCGGTGGATGGTGGGAGG - Intronic
1097991840 12:65843750-65843772 CTTTCCTTGTTGAAAGTGGCTGG + Intronic
1100000291 12:89826436-89826458 TTTTCTCTGTTTCTGGTGGATGG + Intergenic
1100539812 12:95547946-95547968 CTTTCTTTTTTCATGGGGGCGGG + Intronic
1100934586 12:99648478-99648500 CTTTCTCTTTTCTGGGTGGCAGG - Exonic
1101276839 12:103211559-103211581 GTTTCTCTCTGGATGTTGGCTGG - Intergenic
1101407766 12:104443701-104443723 CATTCTCTGGTCACGGTGGCTGG + Intergenic
1101909765 12:108852668-108852690 CTTTCTCTGTAGTTGGAGGCTGG - Exonic
1102679428 12:114681015-114681037 AATTCTCGGTGGATGGTGGCTGG - Exonic
1102812620 12:115837632-115837654 CTCTCCCTATTAATGGTGGCTGG - Intergenic
1105895768 13:24716496-24716518 CTTCCTCTGTTCATGGTGTAAGG - Intergenic
1106661208 13:31801370-31801392 CTCTCTCTGTTAAAGGGGGCTGG - Intronic
1107377269 13:39817621-39817643 CTTTCTTTGTTGGTGGTAGCAGG + Intergenic
1107999239 13:45891185-45891207 CTGACTCTGTTGATGGAGGGAGG - Intergenic
1108312366 13:49207249-49207271 GTGTCTCTGTTGGTGCTGGCTGG - Exonic
1109109821 13:58302537-58302559 ATTTCTCTATTGATCTTGGCTGG + Intergenic
1109330994 13:60929604-60929626 AATTCTTTGTTGAGGGTGGCAGG + Intergenic
1110785667 13:79522736-79522758 CTTCCTCAGTAGATGGTGGCTGG + Intronic
1112733784 13:102395194-102395216 CTTTCTCTGAAGATGGTAACTGG - Intronic
1112970269 13:105253194-105253216 CTTCCACTGTTGATGGTCACAGG - Intergenic
1113710658 13:112462256-112462278 TTTCCTCTCTTGATGGTGGGTGG - Intergenic
1117792639 14:59357388-59357410 CTCTTTCTTGTGATGGTGGCTGG + Intronic
1117945843 14:61019532-61019554 CTTTTACAGTTGGTGGTGGCAGG + Exonic
1118444765 14:65840963-65840985 CTTTCTGTTTTGATGTTTGCTGG + Intergenic
1118729394 14:68655829-68655851 TTCTCTCTGTTGCTAGTGGCTGG + Intronic
1120738686 14:88083535-88083557 GATTCTCTGTTGATGGTTGATGG - Intergenic
1121130644 14:91443160-91443182 GTTTCTTTGTTGATTGTGTCTGG - Intergenic
1121248733 14:92483845-92483867 CCTTCTCTGCTGCTGGTGTCAGG - Intronic
1121707220 14:96006812-96006834 CTTTCTCAGTTGTTTGTGTCAGG - Intergenic
1122005943 14:98703689-98703711 CTTTCTCTGATGATCATGGCTGG - Intergenic
1122043519 14:99007367-99007389 TTTTCTCTGTTGATCTTGGCTGG - Intergenic
1122111379 14:99505541-99505563 CTTGCTCTGTTAATGCAGGCTGG + Exonic
1124192683 15:27594245-27594267 CTTTCCCTGAGGATGGTGGAAGG + Intergenic
1124691763 15:31829294-31829316 CTTACCATGTTGATGGTGCCAGG - Intronic
1126207418 15:46061020-46061042 CTTTCTCCTTTGATGCCGGCAGG + Intergenic
1128917587 15:71578506-71578528 CTTTCTTTTTTGGTGGTGACAGG + Intronic
1128934929 15:71738126-71738148 ATTTCTCCATGGATGGTGGCGGG + Intronic
1129483681 15:75847108-75847130 ATTTTTCTTTTTATGGTGGCAGG + Intronic
1129769759 15:78195480-78195502 CTTACTCTGTGTATGGTGGGTGG + Intronic
1130332716 15:82934318-82934340 TTATCTCTGTGGATGGTGACAGG - Intronic
1130797064 15:87221029-87221051 GTTTCTCTCTGGATGTTGGCTGG - Intergenic
1131641945 15:94302350-94302372 CTTTCTTTGCTGATGCTGGTGGG - Intronic
1132731795 16:1366498-1366520 CTGTCTCTGTAGCTGGTGGCCGG - Intronic
1133255365 16:4513103-4513125 CTTTGTCTGGTGCAGGTGGCAGG - Intronic
1134555494 16:15160456-15160478 AATTCTCTGGGGATGGTGGCAGG - Intergenic
1137602275 16:49764315-49764337 CTTCCTCTGTTGATGGACACTGG - Intronic
1138394037 16:56690859-56690881 CTTTCTCTATGGAGGGTGGAGGG - Intronic
1140343019 16:74184165-74184187 CTTTCTTTGTTCTTGGTGGCTGG - Intergenic
1140725666 16:77809338-77809360 ATTTCTCTGATGATGGAGGATGG - Intronic
1141640042 16:85335660-85335682 CTGTCACTGTTGGTGGTGCCGGG - Intergenic
1143013274 17:3878166-3878188 GGTTCTCAGTTGATGGGGGCAGG - Intronic
1144440126 17:15273712-15273734 CTTGCTCAGATGATGGTGGAAGG - Intergenic
1149208233 17:54273984-54274006 CTTCCTCTGCTGATGGGGCCGGG - Intergenic
1150708990 17:67513979-67514001 CTTTCCCTGATCATGGAGGCGGG - Intronic
1151380988 17:73725704-73725726 CTTTCTCTGCTCATGTTGTCAGG - Intergenic
1154386912 18:13901897-13901919 CTTTGTCTGTTTTTGGTGTCAGG - Intronic
1156083258 18:33366335-33366357 CTTTCTCTTTTGCTTGTTGCTGG + Intronic
1156948895 18:42869158-42869180 ATTTTTCTGTGGATGGTGGTGGG + Intronic
1157540756 18:48504384-48504406 CTTTTTCTTTTGATGGGTGCTGG + Intergenic
1158452480 18:57579558-57579580 CCTCTTCTGTTGCTGGTGGCTGG - Intronic
1158776260 18:60583784-60583806 CATTCTCTGTAGATGGTGTGTGG + Intergenic
1159035129 18:63269428-63269450 CTTTCTCTGTTGAGGGACGTGGG + Intronic
1161481648 19:4513691-4513713 CTTTCTCAGCAGATGGTGTCCGG - Exonic
1163250047 19:16121406-16121428 CTCTTGCTGTTGAGGGTGGCTGG - Intronic
1164588447 19:29492522-29492544 TTTTCTCTGATGTTGGTGCCTGG + Intergenic
1166051975 19:40265860-40265882 CTTAGTTTGTTGAAGGTGGCAGG - Intronic
1166319418 19:42007046-42007068 CTTTAGCTGTTTATGGTGGGAGG - Intronic
1166706750 19:44912332-44912354 ATGTCTCTGTGGATGGTTGCTGG - Intergenic
1167299986 19:48672642-48672664 CTTTCTCTCTGGATAGTTGCTGG + Intronic
1167500183 19:49841918-49841940 TTTGCTCTGTTGGTGTTGGCTGG - Intergenic
929684331 2:44021286-44021308 CTCTCTCTGCTGATTGTGTCCGG - Intergenic
930886057 2:56328319-56328341 CTTTGTCTATTGAGGGAGGCTGG + Intronic
931949276 2:67343628-67343650 CTTTTTTTTTTGATGGTGGTGGG - Intergenic
933981548 2:87554870-87554892 CATTCTCTGAAGATGGGGGCAGG - Intergenic
935019165 2:99213770-99213792 CATTTTATGTGGATGGTGGCAGG - Intronic
936312288 2:111395946-111395968 CATTCTCTGAAGATGGGGGCAGG + Intergenic
936938737 2:117861309-117861331 CTTTCTCTTTTGAGGGTATCAGG + Intergenic
937458164 2:122062064-122062086 CTTTTTGTGCTGATGGTGTCTGG + Intergenic
937720035 2:125083550-125083572 CTTTCTCTTTTGATATTGTCTGG + Intergenic
937844521 2:126565054-126565076 CTATCTCAGATGATGGTGCCAGG - Intergenic
940737314 2:157467928-157467950 CTTTCTCAGAGTATGGTGGCTGG - Intronic
943448887 2:188023602-188023624 TTTTCTCTATTGTTGGTAGCTGG + Intergenic
945090143 2:206170630-206170652 CATCTTCTGTGGATGGTGGCAGG + Intergenic
947610169 2:231520203-231520225 CTTTTTCTGCTGAAGTTGGCTGG - Intergenic
1169842597 20:9956444-9956466 GTAGCTCTGTTGATGGAGGCTGG + Intergenic
1170179607 20:13515000-13515022 CTAGCTCTGTTCATGATGGCTGG - Intronic
1170858503 20:20080335-20080357 CTTTCTTTTCTGATGGTGCCTGG + Intronic
1170906367 20:20518349-20518371 CTATCTCTGGTCAGGGTGGCCGG - Intronic
1174119570 20:48252566-48252588 CTTTCTTTGTTGTGGATGGCTGG - Intergenic
1174484187 20:50851147-50851169 CTTTATCTGGTGGTGGAGGCTGG + Intronic
1175146195 20:56898006-56898028 CTCTTTCTGGTGATGGTGGAGGG + Intergenic
1177805660 21:25872351-25872373 CTTTCTCAGAGCATGGTGGCTGG - Intergenic
1180199018 21:46213724-46213746 CTATCTCTGGTGAGTGTGGCTGG - Exonic
1181539983 22:23567832-23567854 CCTTCTCTGTGCCTGGTGGCAGG - Intergenic
1182235196 22:28869703-28869725 CCTTCTCTGTTGGTGGATGCAGG - Intergenic
1183467491 22:37986977-37986999 CTTTCCCTGCTGGGGGTGGCAGG + Intronic
1185121699 22:48975221-48975243 CTTGCTCTGTCGCTGGTGGCTGG + Intergenic
949800469 3:7898251-7898273 CTTCTGCTGTTGGTGGTGGCAGG - Intergenic
950126826 3:10514762-10514784 CTTTCCCCGCTGCTGGTGGCAGG - Intronic
951206678 3:19933326-19933348 CTTTCTCTGTTCATGTTGTTGGG + Exonic
951409987 3:22351807-22351829 CCTTCTCTTTTTATGGTGGAGGG - Intronic
952466212 3:33589237-33589259 CTTTTTCTGTTGGTAGTGGCTGG - Intronic
953466208 3:43122091-43122113 CTGGCTCTGTTGATCCTGGCTGG + Intergenic
955391281 3:58524262-58524284 CTCTCTCTGCCCATGGTGGCAGG + Intronic
955981410 3:64531253-64531275 CTTTCTCAGGTGAGGGAGGCAGG + Intronic
956327383 3:68069302-68069324 CATTTTATGTGGATGGTGGCAGG + Intronic
957469370 3:80638517-80638539 ATTTCTCTGAAGCTGGTGGCAGG - Intergenic
957781209 3:84820230-84820252 CATTTTATGTGGATGGTGGCAGG + Intergenic
959824308 3:110774940-110774962 CTTACTCTGTTGATGATGTTAGG + Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961426578 3:126852965-126852987 CTTTTTTTGTTGAATGTGGCTGG + Intronic
962475335 3:135750374-135750396 CTCCCTCTGTTGAGGGAGGCAGG - Intergenic
962733217 3:138301765-138301787 ATTTCTTTGTGGATGGTGGGTGG - Intronic
962941319 3:140127166-140127188 CTATCTGTGTTGATGATGGGGGG - Intronic
963010946 3:140769806-140769828 CTTATGCTGTTGATGGGGGCAGG - Intergenic
963861156 3:150312001-150312023 TTTTCTCTTCTGATTGTGGCAGG + Intergenic
964347905 3:155772901-155772923 CTTTCTTGTTTGATGGTGGTGGG + Intronic
964367393 3:155964874-155964896 GTTTCTTTGTTGATGGTAGTTGG - Intergenic
967074858 3:185992982-185993004 CCTTCTCTTTTGATTTTGGCAGG + Intergenic
967381717 3:188866327-188866349 CATTCACTGTGGATGCTGGCGGG + Exonic
968586199 4:1417200-1417222 CTGTCTCTGGGCATGGTGGCCGG + Intergenic
969465712 4:7355192-7355214 CTCTCTCTGGTGCTGGTGCCTGG - Intronic
969498927 4:7541441-7541463 CATTCTCTGATGATGGTCTCTGG + Intronic
970401863 4:15724924-15724946 CTTTCTCCTTTTATGCTGGCTGG + Intronic
970465255 4:16316047-16316069 CTTTTTCTGTTGATTGGGCCTGG + Intergenic
970704147 4:18779972-18779994 TTTTCCCTGTGGATGATGGCAGG + Intergenic
972048870 4:34702885-34702907 CCTGCTCTGGAGATGGTGGCAGG - Intergenic
973784686 4:54323920-54323942 CTGCCTCTCTTGAGGGTGGCAGG + Intergenic
974204919 4:58689587-58689609 TTTTTCCTGTTGCTGGTGGCTGG + Intergenic
974785024 4:66609108-66609130 CTTTCTCTGATGGAGGTGGCTGG + Intergenic
974904583 4:68039003-68039025 CTGTCTCTGTTGCTGGAAGCTGG - Intergenic
975105142 4:70559431-70559453 CTTTTTCTGCTGATGTTGTCTGG - Intergenic
977758465 4:100701792-100701814 CTTTCATTGTGAATGGTGGCAGG - Intronic
979810319 4:125028555-125028577 CATCCTATGTGGATGGTGGCAGG + Intergenic
983024071 4:162712558-162712580 CTTTCCCTGATGATCGTGTCCGG + Intergenic
983032948 4:162826362-162826384 CTTTTTCTGTTGCTGTTGTCAGG + Intergenic
984355147 4:178648571-178648593 CTTTCTCTGTTTTTGGTATCAGG + Intergenic
985394788 4:189530818-189530840 CTCACTCTGATGAGGGTGGCGGG + Intergenic
986983314 5:13473994-13474016 CTTTTTACGTGGATGGTGGCCGG - Intergenic
987434861 5:17882781-17882803 CCTACTCTGTTGGAGGTGGCAGG + Intergenic
989575742 5:42986559-42986581 CGTTTTCTGTTGAGGGTGTCAGG - Intergenic
991214762 5:64149235-64149257 CCTTCTCTGGTGGAGGTGGCAGG + Intergenic
993743055 5:91563387-91563409 CCTGCTCTGTTGGAGGTGGCAGG - Intergenic
996007422 5:118439542-118439564 CTTTATATGTTGAGGGTGGGTGG - Intergenic
996020762 5:118588541-118588563 CTTTGACTGTTGATGGTGTTTGG - Intergenic
996448292 5:123584592-123584614 CTTTATCTGTTGTTGGTAACAGG + Intronic
997376731 5:133402912-133402934 CTGTCAAGGTTGATGGTGGCGGG + Intronic
997392103 5:133525485-133525507 CTTTCTCATTTGATGGTGAGTGG + Intronic
999122909 5:149223678-149223700 CTCTCTGTACTGATGGTGGCAGG - Intronic
1000173521 5:158727516-158727538 CTTTCTCTCTGGATCCTGGCAGG - Intronic
1000264553 5:159622003-159622025 CCTTCTCTGGTGGAGGTGGCCGG - Intergenic
1000511565 5:162189910-162189932 CCTTTTCTGGTGAAGGTGGCAGG + Intergenic
1001080344 5:168663046-168663068 CTGTCTTGGTTGATGGGGGCTGG + Intronic
1001525148 5:172423561-172423583 CATTCTCTGTTCATGGTGATTGG + Intronic
1002568622 5:180127881-180127903 CTTTCCCGGTTCATGGGGGCAGG + Intronic
1002807868 6:595108-595130 ATTTCTATCTTGATGTTGGCAGG - Intronic
1004461927 6:15845012-15845034 CTGTCTCAGTTCCTGGTGGCAGG - Intergenic
1005259408 6:24042224-24042246 CCTGCTCTGGTGGTGGTGGCAGG + Intergenic
1005601731 6:27432917-27432939 CTTTCTCACGTTATGGTGGCTGG - Intergenic
1005898131 6:30195733-30195755 CTTGCACTGTTTAGGGTGGCTGG - Intronic
1006648350 6:35531019-35531041 ATTTATCTGTTGATGGTGTGAGG + Intergenic
1006893331 6:37448603-37448625 TTGTCTCTGTTGATGCTGGTTGG + Intronic
1008185826 6:48389104-48389126 CTTGCTCTGATGGAGGTGGCAGG + Intergenic
1009312245 6:62169892-62169914 CTTTGTCTGGTGAGGGTGGATGG - Intronic
1009535800 6:64882473-64882495 CTTTTTCTGTTAATGTAGGCAGG - Intronic
1009551846 6:65107011-65107033 CACTCTATGTTGATGCTGGCTGG - Intronic
1010550903 6:77221671-77221693 CATTTTATGTGGATGGTGGCAGG - Intergenic
1011343527 6:86344412-86344434 CTTTGTCTGGTGTTGGTGTCAGG - Intergenic
1011817776 6:91213206-91213228 CCTGCTCTGCTGAAGGTGGCAGG + Intergenic
1014529830 6:122545632-122545654 CCTTCTTTGTGGAGGGTGGCAGG + Intronic
1014750005 6:125245108-125245130 CTTGCTCTGGTGGAGGTGGCAGG + Intronic
1014896900 6:126912399-126912421 ATTCCTCTGTTAATGGTAGCTGG + Intergenic
1016028383 6:139312396-139312418 CTTACTCTGTTGAAGCTGGCTGG + Intergenic
1016636695 6:146300817-146300839 CTTTCTTAGATGGTGGTGGCAGG - Intronic
1017270011 6:152493732-152493754 CTCTCCCTGTTGATCGTGTCCGG + Intronic
1018264067 6:162002133-162002155 CTTTCTCTGTTGTTTGTAGTAGG + Intronic
1019094656 6:169569034-169569056 CGTTCTCTGTTGATGGAAGAGGG - Intronic
1021857093 7:24867582-24867604 CATCATCTGTGGATGGTGGCAGG - Intronic
1023225725 7:37966922-37966944 CTTTGCCTGAAGATGGTGGCAGG + Intronic
1024510792 7:50203251-50203273 CTTACTCCTTTGATGGTAGCAGG + Intergenic
1026444236 7:70470274-70470296 CTTTCTCTGTTGGTTGGGGCTGG - Intronic
1026446708 7:70490982-70491004 CCTTCTCTCTTGATGTTGTCTGG - Intronic
1026866765 7:73828902-73828924 CTTGCTCTGTTGCCCGTGGCTGG + Exonic
1030427585 7:109398644-109398666 CTGACTCTGTTGATGGTGCAGGG + Intergenic
1030998181 7:116383943-116383965 CTTTCACTGTAGAGGTTGGCAGG - Intronic
1031359677 7:120833933-120833955 CTTTCTCTGTTAATGGGAGAAGG + Intronic
1033780057 7:144658388-144658410 ATATATCTGTTGGTGGTGGCTGG - Intronic
1034084628 7:148312302-148312324 CTTTCCCTGCTGATCGTGTCTGG - Intronic
1036930849 8:12953672-12953694 CTTTCTCTGTCTTTGATGGCTGG + Intronic
1037085545 8:14844766-14844788 ATTTCTCTGTTGATTGTTTCAGG - Intronic
1039429825 8:37517092-37517114 CATTCTCTGGGGGTGGTGGCAGG - Intergenic
1040030987 8:42823460-42823482 ATTTATCTGTGGATGATGGCAGG + Intergenic
1040667044 8:49646314-49646336 CTTCCTCTTTTGCTGATGGCAGG - Intergenic
1042608047 8:70566066-70566088 CTTGCTCTGATGGAGGTGGCAGG - Intergenic
1043537748 8:81225383-81225405 CTTGCTCTGGTGGAGGTGGCAGG + Intergenic
1043616428 8:82130722-82130744 CCTTCTCTGATGGAGGTGGCAGG - Intergenic
1044451105 8:92336334-92336356 TTTACCCTGTTGCTGGTGGCTGG + Intergenic
1046861793 8:119101102-119101124 TTTTCTCTGTTGCTGGTGAACGG + Intronic
1046974465 8:120258468-120258490 CTGTATCTGGTGGTGGTGGCTGG + Intronic
1047231336 8:123000629-123000651 CTTTCTTTTTTGATGGAGTCTGG - Intergenic
1048532774 8:135265428-135265450 CTTCCTCTGTTTATTCTGGCTGG + Intergenic
1049733063 8:144188977-144188999 CTTTCTGTGTGTATGTTGGCTGG - Intronic
1050133554 9:2438924-2438946 CTTGCTCTGGTGGAGGTGGCAGG + Intergenic
1050330403 9:4540093-4540115 CTTTCTCTGCTGTTGGAGACTGG - Intronic
1050808464 9:9714718-9714740 AGTTCTCTGCTGATGGTGGGAGG + Intronic
1051062392 9:13059360-13059382 GTTTCTATGTTGAAGGAGGCTGG - Intergenic
1051197666 9:14580823-14580845 CTTTCTCTGGTTTTGGTGTCAGG - Intergenic
1051934033 9:22422594-22422616 CTTTCACTTTTGGTGGGGGCAGG - Intergenic
1052205017 9:25828434-25828456 CTTTCTCTGTTCATGGGTGCTGG + Intergenic
1052801609 9:32973274-32973296 TATTCTCTGGTGAGGGTGGCTGG - Exonic
1052946932 9:34176147-34176169 TTTTCTCTATTGCTGTTGGCAGG + Intergenic
1054877817 9:70114832-70114854 CTTTCTTTTTTGATGGAGGAAGG - Intronic
1055797488 9:79990766-79990788 CTTTATTTGTTGAGGGTGGGTGG + Intergenic
1055957675 9:81789723-81789745 CTTTCCCTATTTATGGAGGCAGG - Intergenic
1057441072 9:95083883-95083905 CTTCCTCTGTTAATTGTGCCTGG + Intronic
1058144114 9:101391777-101391799 CTTTCTTTGTTGATTTTGTCTGG - Intronic
1061276175 9:129570373-129570395 CCTTCTCTGTGCCTGGTGGCAGG - Intergenic
1061667384 9:132168508-132168530 CTGTCACTGTGGGTGGTGGCTGG + Intronic
1062457208 9:136645428-136645450 CTTTTTCTGTTGGCCGTGGCTGG - Intergenic
1186224713 X:7386381-7386403 TTTCCTCTGCTGATGGGGGCAGG + Intergenic
1186344261 X:8675333-8675355 CTTTCTCTGCTGAGCGTGGCAGG - Intronic
1186556026 X:10559717-10559739 CTTTCTCTGTTGATGGTGGCAGG - Intronic
1186963122 X:14758477-14758499 CTTGCTCTGGTGGAGGTGGCAGG - Intergenic
1190151527 X:47954052-47954074 CTCTCTCTGCAGATGGTGGCAGG + Intronic
1190161206 X:48032672-48032694 CTCTCTCCGCAGATGGTGGCAGG - Intronic
1190259574 X:48789644-48789666 CTTCCTCTGAAGAGGGTGGCAGG - Intronic
1190455954 X:50628063-50628085 CTTTCTCTGTTGGAAGAGGCAGG - Intronic
1191209770 X:57872269-57872291 CCTTCCCTGTTGTTGGTGGCTGG + Intergenic
1191923044 X:66278133-66278155 CATTCCATGTGGATGGTGGCAGG + Intergenic
1192002699 X:67172261-67172283 CTTTTTTTGTTGATGGTGGTAGG + Intergenic
1192508502 X:71706940-71706962 TTTTGTCTGCTTATGGTGGCAGG + Intergenic
1192512145 X:71727776-71727798 TTTTGTCTGCTTATGGTGGCAGG - Intergenic
1192514552 X:71753729-71753751 TTTTGTCTGCTTATGGTGGCAGG + Intergenic
1192518195 X:71774613-71774635 TTTTGTCTGCTTATGGTGGCAGG - Intergenic
1194306865 X:92258514-92258536 CATTCTCTGGGCATGGTGGCGGG - Intronic
1194468676 X:94265147-94265169 TTTTCTCTTTTGATGGTTGTTGG - Intergenic
1196193167 X:112814743-112814765 CTTTCTCTGTTGTATGTGGGGGG - Intronic
1197521993 X:127510339-127510361 AGTTATCTGTAGATGGTGGCAGG - Intergenic
1197572105 X:128162862-128162884 CTGTCTCTGGTGAAAGTGGCAGG + Intergenic
1197603792 X:128561073-128561095 CTTGCTCTGATGGAGGTGGCAGG - Intergenic
1199490688 X:148397223-148397245 CTTTGTCTGTTCAAGGTGGGAGG - Intergenic