ID: 1186556790

View in Genome Browser
Species Human (GRCh38)
Location X:10568554-10568576
Sequence AACAGTGACAAGCCCGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186556790_1186556794 -6 Left 1186556790 X:10568554-10568576 CCCACCACGGGCTTGTCACTGTT 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1186556794 X:10568571-10568593 ACTGTTGCCAGCAACAGGCCAGG 0: 1
1: 0
2: 1
3: 13
4: 160
1186556790_1186556795 -2 Left 1186556790 X:10568554-10568576 CCCACCACGGGCTTGTCACTGTT 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1186556795 X:10568575-10568597 TTGCCAGCAACAGGCCAGGCTGG 0: 1
1: 0
2: 0
3: 30
4: 239
1186556790_1186556797 2 Left 1186556790 X:10568554-10568576 CCCACCACGGGCTTGTCACTGTT 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1186556797 X:10568579-10568601 CAGCAACAGGCCAGGCTGGCAGG 0: 1
1: 0
2: 5
3: 53
4: 553
1186556790_1186556798 5 Left 1186556790 X:10568554-10568576 CCCACCACGGGCTTGTCACTGTT 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1186556798 X:10568582-10568604 CAACAGGCCAGGCTGGCAGGAGG 0: 1
1: 1
2: 2
3: 46
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186556790 Original CRISPR AACAGTGACAAGCCCGTGGT GGG (reversed) Intronic
902439305 1:16418936-16418958 AACAATGCCCAGCACGTGGTAGG - Intronic
903378167 1:22879386-22879408 ACCACTGACAAGCCCGTGATGGG + Intronic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
913109564 1:115645399-115645421 AACAGTGCCTAGCACGTGGTAGG - Intronic
913435535 1:118843520-118843542 AACAGTGCCCAGCACATGGTAGG + Intergenic
917828648 1:178852361-178852383 AACAGTGCCTGGCACGTGGTAGG + Intronic
917966300 1:180180848-180180870 AACAGTGACTAGCACATAGTAGG - Intronic
919645449 1:200090133-200090155 AACAGTGACAAGAAAGAGGTTGG - Intronic
922190641 1:223315837-223315859 TAAAGTGACAAGCCCTTGGGAGG + Intronic
1063354306 10:5383464-5383486 AACTGTGACGAGCACGTGATGGG + Intergenic
1063906440 10:10784580-10784602 AACATTGACAAGACTTTGGTTGG - Intergenic
1071810814 10:89178892-89178914 AACAGTGTCTGGCCCATGGTAGG + Intergenic
1076023363 10:127092372-127092394 GCCAGTGCCAGGCCCGTGGTGGG - Intronic
1076503111 10:130952419-130952441 AACAGGGCCAGGCCCCTGGTAGG + Intergenic
1078666362 11:13329027-13329049 AACAGTGACCAGCTCTTAGTAGG - Intronic
1079295628 11:19230938-19230960 AACAGTGACAGGCACATGGTCGG - Intronic
1083006457 11:59351270-59351292 AACAGGGACAAGTCATTGGTGGG + Intergenic
1083959613 11:66007315-66007337 AACAGTCACAAGCACCTGCTGGG - Intergenic
1085788075 11:79472651-79472673 CACAGTGCCAAGCACGTCGTAGG - Intergenic
1086480684 11:87234374-87234396 AACAGTGCCTGGCACGTGGTAGG + Intronic
1088688854 11:112307513-112307535 AACAGTGCCTAGGCCATGGTAGG - Intergenic
1091298804 11:134491896-134491918 AACAGTGACCAGCATGTAGTGGG + Intergenic
1095577518 12:43757631-43757653 AACAGTGTCAAGCACATGGTAGG + Intronic
1097519269 12:60647228-60647250 AACCCTGTCTAGCCCGTGGTGGG - Intergenic
1098308566 12:69125341-69125363 AACTGTGCCTGGCCCGTGGTAGG + Intergenic
1102180346 12:110907743-110907765 AACAGGGACTAGCCCGGGGGAGG + Intergenic
1104119244 12:125783213-125783235 AACAGTGACTAGCATGTAGTAGG + Intergenic
1104878928 12:132055856-132055878 CACAGTGACAAGCACATGGGGGG - Intronic
1106074151 13:26442902-26442924 AACAGTGACAAGAACGTTATAGG + Intergenic
1109757580 13:66780818-66780840 AACAGTATCTAGCACGTGGTAGG + Intronic
1114620343 14:24092672-24092694 ACCAGTAGCAAGCCCGTGGCTGG + Intronic
1115147526 14:30242380-30242402 AACAATGACCAGCATGTGGTAGG + Intergenic
1118277013 14:64394309-64394331 GCCAATGACAAGCCCATGGTAGG - Intronic
1120010178 14:79404929-79404951 AACAGAGAGAAGCCAGTGGGTGG + Intronic
1126339768 15:47626366-47626388 AGCAGTGACATGCCCATGGAAGG - Intronic
1130879377 15:88042112-88042134 AACACTGACATGTCCCTGGTGGG + Intronic
1132411099 15:101578759-101578781 AACAGTGTCATGCCTGTGGGAGG - Intergenic
1135663282 16:24315065-24315087 AACAATGACCAGCCAGTGGCTGG + Intronic
1137243727 16:46684356-46684378 AACAGTGACCAGCCCCTCCTTGG + Intronic
1140808861 16:78558014-78558036 AACAGTGCCAAGCACATAGTCGG + Intronic
1146955225 17:36933355-36933377 AAGAGTGACAAGGCCGTGAAAGG - Intergenic
1151264714 17:72945848-72945870 AACATTGGCAAGCCCTTGGATGG - Intronic
1157447013 18:47753764-47753786 CACAGTGTCAAGCACATGGTGGG + Intergenic
1164471919 19:28543503-28543525 CACAGTGACTACCCCGGGGTTGG + Intergenic
927411858 2:22835056-22835078 AACAATGTCAAGCCCCTAGTAGG + Intergenic
929419963 2:41780565-41780587 AGCAGTGACAAGCCACAGGTGGG - Intergenic
929918405 2:46154945-46154967 AACAGTGCCAAGCACATTGTAGG + Intronic
931440416 2:62286576-62286598 AACAGTGACAGGCACATCGTGGG - Intergenic
932077732 2:68680838-68680860 AATAGTGAGAAGGCCGGGGTAGG + Intronic
932471823 2:71964199-71964221 AACAGTGCCTGGCCCATGGTAGG - Intergenic
934772271 2:96914598-96914620 CACAGTGCCCAGCCCTTGGTGGG - Intronic
948526702 2:238575124-238575146 GACAGAGACAAGCACGTGGAGGG - Intergenic
948640325 2:239371889-239371911 AACAGTGAAGAGCCCGTGGAGGG + Intronic
1170740020 20:19047911-19047933 ACCAATGAGAAGCCTGTGGTGGG - Intergenic
1172405657 20:34687035-34687057 AACAGTAACAACCACGTGGGTGG + Intergenic
1172808781 20:37632408-37632430 AACAGTGCCCAGCACGTAGTAGG + Intergenic
1173339725 20:42142307-42142329 AACAGTGCCCAGCCCATGTTAGG - Intronic
1173619318 20:44424453-44424475 AACAGTGACTGGCACGTGCTAGG - Intronic
1178821660 21:35981075-35981097 ATCAGTGAGAAGCACATGGTGGG + Intronic
1179475620 21:41641659-41641681 GACAGGGACAAGCCCATGTTAGG + Intergenic
1181112010 22:20607736-20607758 AACTGCGACCAGCTCGTGGTAGG + Intergenic
1182669028 22:31980441-31980463 AACAGTGTCAAGCCCACAGTAGG - Intergenic
1184285441 22:43468494-43468516 AACAATGACCAGCCTCTGGTAGG - Intronic
949917198 3:8974319-8974341 AACAATGAGAAGCCCTTGGAAGG - Intergenic
950109784 3:10411678-10411700 AACAGTGCCAGGCACTTGGTAGG - Intronic
950566151 3:13770827-13770849 CACAGTGCCAGGCACGTGGTGGG - Intergenic
951459322 3:22932388-22932410 CACAGTGTCTAGCCCATGGTAGG - Intergenic
954879627 3:53824444-53824466 AACAGTGCCTAGCACATGGTAGG - Intronic
958645796 3:96872256-96872278 AACAGGGACAAGCCCCTGAAAGG - Intronic
961362826 3:126378801-126378823 AAGAGTGACATCCCAGTGGTAGG - Intergenic
970363516 4:15334469-15334491 CACAGTGACAAGCACATGGTGGG + Intergenic
972838810 4:42907338-42907360 AACTGTGACAAGGCTGTGCTTGG - Intronic
976083262 4:81379973-81379995 AACAGTGACAAAGCCCTGTTTGG - Intergenic
978412841 4:108443907-108443929 CACAGGGACAAGCCAGTGGTGGG - Intergenic
979289597 4:118965291-118965313 GACAGTGAGAAGGCCCTGGTTGG - Intronic
981609680 4:146579896-146579918 AGCAGTGACAAGGCAGTGGAGGG + Intergenic
982109353 4:152039706-152039728 AACTGTGAGAAGCCCTTGGAAGG - Intergenic
986697792 5:10373988-10374010 AAGAGTGACAGGGCCATGGTGGG - Intronic
987436161 5:17896382-17896404 CACAGTGACAAGACCAGGGTGGG - Intergenic
990795804 5:59539183-59539205 TATAGTGATAAGCCCATGGTAGG + Intronic
995001395 5:107135018-107135040 CACAGTGCCTACCCCGTGGTAGG + Intergenic
995043489 5:107617365-107617387 AACAGTGACCAGCATCTGGTTGG - Intronic
997251375 5:132391259-132391281 CACAGTGCCCAGCCCATGGTAGG - Intronic
1001813696 5:174650034-174650056 AGCCCTGACAAGCCGGTGGTGGG - Intergenic
1002330401 5:178436780-178436802 CACAGTGCCAAGCCCCTGGCAGG + Intronic
1003315356 6:5006622-5006644 CACAGTGAGAAGCCAGTGGTAGG - Intergenic
1006715955 6:36120731-36120753 AACAGTGACAACACTGTCGTCGG - Intergenic
1007374520 6:41447226-41447248 AACAGTGCCCAGCCCATAGTAGG + Intergenic
1007869118 6:45012804-45012826 AACAATGACAAGCCCCAGGGAGG - Intronic
1008059537 6:46982920-46982942 AACAGTGCCTGGCCCTTGGTAGG + Intergenic
1013581729 6:111541805-111541827 AACAGTGCCTGGCACGTGGTAGG - Intergenic
1014507550 6:122278575-122278597 AACAGTGCCAGGCTCGTAGTAGG + Intergenic
1024352127 7:48377076-48377098 AACAGTGAAAGCCCTGTGGTTGG - Intronic
1025079005 7:55966007-55966029 AACAGTGCCTGGCACGTGGTAGG - Intronic
1029995203 7:105001021-105001043 ACCAGGGACAAGCCCCTAGTAGG + Intergenic
1035566563 8:644991-645013 AGCAGTGACCAGCCCGTGGGAGG - Intronic
1047919279 8:129617180-129617202 ATCAGTGAAAAGAGCGTGGTAGG + Intergenic
1048502721 8:134993513-134993535 AACAGTGCCTGGCACGTGGTAGG - Intergenic
1049381824 8:142319997-142320019 CACAGTGTTAAGCCAGTGGTTGG - Intronic
1049474640 8:142791006-142791028 AACTGTGTCCAGCCTGTGGTAGG + Intergenic
1056245730 9:84693181-84693203 CACAGTCAAAAGCACGTGGTCGG - Intronic
1062497374 9:136838112-136838134 AACAGTGACCAGCCGGCGGGGGG - Intronic
1185576702 X:1180318-1180340 AACAGTGGCCAGGCCGAGGTAGG + Intergenic
1186556790 X:10568554-10568576 AACAGTGACAAGCCCGTGGTGGG - Intronic
1186848863 X:13559481-13559503 CACAGTGACCAGCACATGGTAGG + Intergenic
1196776818 X:119345699-119345721 AACAGTGCCCAGCACCTGGTAGG + Intergenic
1198565239 X:137897359-137897381 AACAGTGTCTGGCCCATGGTAGG - Intergenic
1200161215 X:154010759-154010781 GACAGTGAGAAGCCCCTGGAAGG - Exonic