ID: 1186557300

View in Genome Browser
Species Human (GRCh38)
Location X:10573426-10573448
Sequence GAGACTAGATTGGTTCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 2, 2: 3, 3: 32, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186557300_1186557306 30 Left 1186557300 X:10573426-10573448 CCTGTGAGAACCAATCTAGTCTC 0: 1
1: 2
2: 3
3: 32
4: 181
Right 1186557306 X:10573479-10573501 GGGCATCAAGCGATTTGTGAAGG 0: 1
1: 0
2: 6
3: 62
4: 401
1186557300_1186557303 9 Left 1186557300 X:10573426-10573448 CCTGTGAGAACCAATCTAGTCTC 0: 1
1: 2
2: 3
3: 32
4: 181
Right 1186557303 X:10573458-10573480 AAGAACTGACTACCTCAAGAAGG 0: 1
1: 0
2: 1
3: 22
4: 183
1186557300_1186557304 10 Left 1186557300 X:10573426-10573448 CCTGTGAGAACCAATCTAGTCTC 0: 1
1: 2
2: 3
3: 32
4: 181
Right 1186557304 X:10573459-10573481 AGAACTGACTACCTCAAGAAGGG 0: 1
1: 2
2: 4
3: 41
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186557300 Original CRISPR GAGACTAGATTGGTTCTCAC AGG (reversed) Intronic
906155530 1:43611952-43611974 GAGAATAGATGGGCTCTCCCAGG + Intronic
906366420 1:45213928-45213950 GAGAGTAGGTTAGTTATCACAGG - Intronic
906971222 1:50516343-50516365 GAGACCAGATTGGTTCAAAACGG - Intronic
909690615 1:78403344-78403366 GAGACTTGATTAGTTATCACAGG - Intronic
910011658 1:82471424-82471446 GAGACTGCATTAGATCTCACAGG + Intergenic
910219406 1:84875445-84875467 GAGAGTGGATTTGTTATCACAGG + Intronic
910271004 1:85394240-85394262 AAGACTGGATTAGTTCTCAAAGG + Intronic
912200521 1:107452605-107452627 GAGACTGGATTAATTCTCATGGG + Intronic
912526004 1:110283167-110283189 GAGACTGAACTAGTTCTCACAGG - Intergenic
916692951 1:167208709-167208731 GAGACTGGTTTAGTTCTCACAGG - Intergenic
916937881 1:169648964-169648986 GAGACTCGTTTAGTTCTCACAGG - Intergenic
917171439 1:172180116-172180138 TAGACTAGATTTGTTCCTACAGG - Intronic
917286538 1:173427030-173427052 GAGTCCAGATTGGGTTTCACAGG - Intergenic
918675404 1:187278677-187278699 GAGATGAGAATGGCTCTCACTGG + Intergenic
919026090 1:192172290-192172312 AAGACTGGATTAGTTCTCAGGGG + Intronic
920570255 1:207010995-207011017 GATACTGGAGTGGTTCTCACAGG + Intronic
921418319 1:214916536-214916558 GGGAGTAGAATGGGTCTCACTGG - Intergenic
923237868 1:232051905-232051927 TAGATGAGATTGGTACTCACAGG - Intergenic
923758912 1:236821290-236821312 GAGACTGAATTAGTTCTCAAGGG - Intronic
1064334036 10:14422439-14422461 GAGACTAGATTTATTTTCAAGGG + Intronic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1064920313 10:20509486-20509508 AAGACTAGGTTAGTTCTCATGGG + Intergenic
1065692330 10:28347398-28347420 GAGACTGGATTAGTTCTCGAGGG - Intergenic
1067246508 10:44551371-44551393 GAGACAGGATTTGTTCTCAGGGG - Intergenic
1067339217 10:45387640-45387662 GAGCCAGGCTTGGTTCTCACTGG - Intronic
1068617777 10:59138421-59138443 GAGACTGGAATCTTTCTCACAGG - Intergenic
1070681960 10:78454952-78454974 GAGGCTAGATTTGTTCTTATAGG + Intergenic
1071833611 10:89396523-89396545 GAGACTGGATTGGTTCTTGGGGG - Intronic
1075290497 10:121226197-121226219 GAGACCTGATTGGATCTTACTGG - Intergenic
1075865067 10:125711401-125711423 AAGACTGGATTAGTTCTCTCAGG + Intergenic
1077765670 11:5157192-5157214 GAGAGTAGATTGGTAGTTACCGG - Intronic
1078372253 11:10758272-10758294 GAGACTAGAGTGGGGCTCAAGGG + Intronic
1079476079 11:20830794-20830816 GAGACTGGAAAAGTTCTCACAGG - Intronic
1080876225 11:36276976-36276998 GAGACTAGAATGGTTCACTTTGG + Intronic
1086483606 11:87272408-87272430 GAGACTAGAAAGGTTCACAGAGG - Intronic
1086603621 11:88666442-88666464 GAGACTCGATTGATTCTCATGGG - Intronic
1087801484 11:102509362-102509384 GAGACTGGATTGGTTCACAGGGG + Intergenic
1088438756 11:109844647-109844669 GAGACAAGATTGATTCTGACTGG + Intergenic
1088572497 11:111236684-111236706 GAGCCCAGCTTGGGTCTCACTGG + Intergenic
1088971187 11:114775930-114775952 CAGACTGGATTAGTTCCCACAGG - Intergenic
1090169042 11:124582122-124582144 GAGACTGGATTAGTTCTCAAAGG + Intergenic
1096490600 12:52010670-52010692 GAGGCTGGATTGGTTCTCTGTGG + Intronic
1097718892 12:62999251-62999273 GAGACTGGATGGGATCACACAGG + Intergenic
1097931918 12:65196625-65196647 GAGACTATATTGGGTCTAGCAGG - Intronic
1099280017 12:80631957-80631979 GAGGCTAGATGGGCTCACACTGG + Intronic
1100608925 12:96174676-96174698 GAGAGTAGATTGGTGGTTACTGG - Intergenic
1100864578 12:98843294-98843316 AAGACTGGATTAGTTGTCACAGG + Intronic
1102786649 12:115610629-115610651 GAGACTGGATTAGTTCTCTTGGG - Intergenic
1105995499 13:25667434-25667456 GAGAAAGGATTAGTTCTCACGGG + Intronic
1106199785 13:27526740-27526762 GAGACTGGGTTAGTTATCACAGG + Intergenic
1106734055 13:32571369-32571391 AAGACTAGATTGGTTCTCTGGGG - Intergenic
1106830446 13:33575613-33575635 GAGACTGGATTAGTTCTTAGGGG + Intergenic
1107122411 13:36809972-36809994 GAGACTGGAATAGTTCTCTCAGG + Intergenic
1108259023 13:48638632-48638654 GAGACTGGATTGGGTCTTAGGGG - Intergenic
1108984630 13:56570027-56570049 GAGACTAAATTAGTTCCCATGGG + Intergenic
1111473681 13:88718927-88718949 GTGACTAGATTGATTTTGACTGG + Intergenic
1111820794 13:93212439-93212461 GAGAGTAGATTGGTGGTTACTGG + Intergenic
1116417849 14:44699702-44699724 GAGACTGGATTAGTTCCCATAGG + Intergenic
1116987417 14:51236316-51236338 GAGACTGGATTAGTTCTCTTGGG - Intergenic
1117004010 14:51400293-51400315 GAGAGTAGAATGGTTCCCAGAGG - Intergenic
1119207977 14:72809021-72809043 AAGACTGGATTTGTTCTCACAGG + Intronic
1119364173 14:74077600-74077622 GAGACTGGATTAGTTCCCATGGG - Intronic
1120133429 14:80835045-80835067 GAGGCTGGACTGGTTCTCAAGGG + Intronic
1120955949 14:90081862-90081884 CAGACTGGGTTGGTTCTCTCAGG + Intronic
1122777596 14:104128406-104128428 GAGACCAAAGTGGTTCTCAAAGG - Intergenic
1124624009 15:31297838-31297860 GAGACTGGAGTGGTGCACACAGG - Intergenic
1126497184 15:49304729-49304751 GAAAGTAAATTGGTTCTCATTGG - Intronic
1126811812 15:52414112-52414134 GAGACTGGATTAGTTCTCTCGGG + Intronic
1128359877 15:66954504-66954526 GAGACTAGATTCAGACTCACAGG - Intergenic
1131146866 15:90019931-90019953 GAGACTAGGTTGGTGCTTATTGG + Intronic
1134886180 16:17794371-17794393 GAGACTAGCCTGGTTAACACAGG + Intergenic
1138223190 16:55270428-55270450 GTGATTAGATTGGGTCTCACTGG - Intergenic
1143035567 17:3994260-3994282 GAGACCGGATTTGTTCTCATGGG - Intergenic
1144324956 17:14169942-14169964 GAGACTGGATTAGTTCTCATGGG + Intronic
1146570015 17:33944442-33944464 GAGAGGAGACTGGTGCTCACAGG + Intronic
1148152291 17:45404009-45404031 GAGTGTAGATGGGCTCTCACCGG + Exonic
1148642739 17:49200608-49200630 GAGTCTAGATTTGGTCTCACAGG + Intergenic
1150179264 17:63098312-63098334 GAAACTTGACTGGTTCTCACAGG - Intronic
1153612192 18:6897729-6897751 GAGACTAGATTAGTTGCCAGAGG + Intronic
1154068618 18:11132126-11132148 GAGGAGAGATTTGTTCTCACTGG + Intronic
1156118179 18:33812409-33812431 GAGGCTGGATTAGTTCTCACAGG - Intergenic
1156170754 18:34482230-34482252 GAGACTGGATTAATTCTCACAGG + Intergenic
1156646643 18:39170447-39170469 AAGACTGGATTAGTTCTCATGGG + Intergenic
1157448592 18:47767797-47767819 CAGACTGTATTGGTTTTCACAGG - Intergenic
1157751629 18:50183842-50183864 GAGACTGGATTCGTTCTCCTGGG + Intronic
1158839345 18:61367455-61367477 AAGTCTAAAATGGTTCTCACTGG + Intronic
1158969818 18:62656094-62656116 GAGACTGAATTGGTTCTCAGCGG - Intergenic
1159255117 18:65934906-65934928 GAGACTTGATGAGTTCTCATGGG + Intergenic
1159427412 18:68308038-68308060 CAGACTAGATTAGGTCCCACTGG + Intergenic
1159729646 18:72009451-72009473 GAGACTGGATGGTTTCTCATGGG - Intergenic
1162702348 19:12526262-12526284 ATGACTAGTTTGGTTTTCACCGG - Exonic
1167160855 19:47766316-47766338 GAGACTTGAGTGGCTCACACTGG + Intergenic
925038916 2:715076-715098 GAGACTGGACTGGCTCCCACTGG - Intergenic
927168960 2:20352107-20352129 GAGACAAGGATGGTTCTCAGAGG - Intronic
928116637 2:28549872-28549894 GAGAATGGTTTGGTCCTCACTGG + Intronic
930235261 2:48883210-48883232 GAGAATAGAGTGGATCACACTGG + Intergenic
933103935 2:78297340-78297362 GAGACTAGATTAGTTCTCACTGG + Intergenic
937973268 2:127565982-127566004 GTGGCTAGCTTGGTTCTGACTGG + Intronic
939810563 2:146826588-146826610 GAGACTGGATTAGTTCTTGCTGG - Intergenic
939885369 2:147675722-147675744 GAGACTAGATTGGTTCTTGTGGG - Intergenic
940305065 2:152216696-152216718 GGAAATAGATTAGTTCTCACAGG + Intergenic
940542498 2:155039264-155039286 GAAAGTAGATTGGTTCCCAGAGG + Intergenic
940941066 2:159561246-159561268 AAGACTTGATTGGTTCTCTAGGG + Intronic
943099189 2:183467658-183467680 TAGACTAGATTCCTTCTGACTGG - Intergenic
944761075 2:202814304-202814326 GAGATTGGATTAGTTCTCTCAGG + Intronic
944906716 2:204269224-204269246 TAGAATGGATTGGTACTCACAGG - Intergenic
946899971 2:224362873-224362895 GAGACTGGGTTAGTTCTCAAGGG - Intergenic
947260500 2:228216571-228216593 GAGATTAGATTAGTTCTGTCAGG + Intergenic
947289249 2:228553874-228553896 GAGACCACAATGGTTCACACTGG - Intergenic
1170882990 20:20313944-20313966 GAAACTGAATTGGTTCTCACGGG - Intronic
1172837307 20:37881363-37881385 GAGACTAGACTGTTCCCCACTGG + Intergenic
1177289324 21:19090715-19090737 GAGACTAGATTTATTCTCACAGG + Intergenic
1180899557 22:19360522-19360544 GAGCCCAGGTTGGTCCTCACAGG - Intronic
1181362289 22:22347254-22347276 GAGAGTAGATGGGGCCTCACAGG - Intergenic
1181897492 22:26123376-26123398 GAGACTAGATTAGTTCTCTTGGG + Intergenic
1182065773 22:27430602-27430624 GATTCTAGTTTGGTTCTAACAGG + Intergenic
1182721391 22:32403860-32403882 GAGAGTAGAATGGTGCTAACAGG - Intronic
950412905 3:12850612-12850634 AAGCCCAGAGTGGTTCTCACAGG + Intronic
955316235 3:57941472-57941494 GAAACTGGATTAGTTCTCACAGG - Intergenic
955808566 3:62762058-62762080 GTGACTAGCTTGGTTCAGACTGG + Intronic
956339154 3:68201973-68201995 GAGACTGGATTAATTCTCACAGG - Intronic
958017025 3:87950113-87950135 AAGAGTACATTGGTTCTCAAGGG - Intergenic
959058990 3:101598779-101598801 GAGAGTAGATTGATTATCAGAGG - Intergenic
960660237 3:120050166-120050188 GGTACTAGATTAGTTCTCATGGG - Intronic
960890291 3:122440947-122440969 GAGATTAGATTTGTTCTCTCAGG - Intronic
961698409 3:128722821-128722843 GAGGCTGGATGAGTTCTCACAGG + Intergenic
963689072 3:148475339-148475361 GGGAATAGATTGGTTATCACAGG + Intergenic
963987264 3:151610852-151610874 GAGAGTAGATTAGTTATCTCAGG - Intergenic
969121543 4:4914940-4914962 GAGAGAAGATTTGTTATCACTGG + Intergenic
969658212 4:8510141-8510163 GACACGTGATCGGTTCTCACTGG + Intergenic
974006402 4:56561578-56561600 GAGACTGGATTAGTTTTAACAGG - Intronic
974604347 4:64131118-64131140 GAGACTAGATATGTTCATACTGG - Intergenic
974726246 4:65802319-65802341 GAGACTGCAGTTGTTCTCACAGG + Intergenic
976508756 4:85882702-85882724 GAGAATAGAGAGGTTCTCATAGG + Intronic
978014762 4:103729328-103729350 GAAACTGGATTAGTTCTCATAGG - Intergenic
981488092 4:145308913-145308935 GAGACTAGATTAGTTCTCACAGG - Intergenic
981572043 4:146162187-146162209 GAGAGTGGGTTGGTTATCACAGG + Intergenic
982986015 4:162207265-162207287 GAGACTGGATTAGTTCTTACAGG - Intergenic
984563943 4:181305190-181305212 GAAACTAGGTTAGTTCTCAAGGG + Intergenic
986405250 5:7419080-7419102 TAGAATAGAATGGTTCCCACTGG + Intronic
987550128 5:19368897-19368919 GTGGCTAGGTTGCTTCTCACAGG - Intergenic
988356668 5:30185252-30185274 GAGACTGGATTAGTTCTTGCAGG + Intergenic
991567170 5:68017263-68017285 GAGACTGTGTTAGTTCTCACAGG - Intergenic
992323132 5:75633884-75633906 GGGACTAGATTCATTCTCATAGG + Intronic
992434985 5:76747595-76747617 CAGACTAGATTAGTTCTCCTGGG + Intergenic
993318293 5:86439608-86439630 GAGCCTAGATTTGATCACACAGG + Intergenic
994859025 5:105163872-105163894 GAGCTTGGATTGGTTCTCAGGGG - Intergenic
1000689219 5:164294019-164294041 GAGGCTGGATTCGTTCTCATAGG + Intergenic
1000805693 5:165788669-165788691 GAGAGTAGAATGGTTATCAGAGG - Intergenic
1001712806 5:173791738-173791760 GAGACTAAATTGGTTGACTCTGG - Intergenic
1004842715 6:19605739-19605761 GAAACTAGATTAGTTCTCCTGGG - Intergenic
1005415587 6:25597211-25597233 GAGACTGTATTAGTTCTCATGGG - Intronic
1011362142 6:86538870-86538892 TAAACTAGGTTTGTTCTCACTGG - Intergenic
1011626827 6:89289984-89290006 GAGACTGGATCAGTTCTCTCAGG - Intronic
1015589829 6:134812526-134812548 AAGACTGGATTAGTTCTCATGGG + Intergenic
1015705016 6:136078433-136078455 GAGACTAGAATGGATCTAGCAGG - Intronic
1015877082 6:137833740-137833762 GAGACTGGATTGGTTCTGCGGGG - Intergenic
1016068092 6:139704675-139704697 GAGACTGCATTAGTTCTTACAGG + Intergenic
1016256489 6:142111653-142111675 GAGATGAGATTGGTTTTTACTGG + Intergenic
1018035178 6:159875528-159875550 GAGACTAGATGAGTTCTCTTGGG + Intergenic
1020029613 7:4923786-4923808 GAGCAGAGACTGGTTCTCACTGG - Intronic
1024583135 7:50817017-50817039 GAGACTAGAATGGTGGTTACGGG + Intergenic
1025189236 7:56884084-56884106 GAGACTGGTGAGGTTCTCACCGG + Intergenic
1025682704 7:63692833-63692855 GAGACTGGTGAGGTTCTCACCGG - Intergenic
1028090263 7:86691676-86691698 GGGAGTAGATTTGTTATCACAGG + Intronic
1030263542 7:107591834-107591856 CAGACTTGATTGGTTCTGCCAGG - Intronic
1031611307 7:123831167-123831189 AAGACTGGATTAGTTCTCATGGG + Intronic
1035317633 7:158006745-158006767 GAGACTTGTTTGGGTCTGACTGG + Intronic
1035707332 8:1686703-1686725 GAGAGTAGATTGGTGGTTACCGG + Intronic
1037127360 8:15367225-15367247 GAGAGTAGAATGGTGGTCACGGG + Intergenic
1038391573 8:27206911-27206933 CAGATTAGATTGCTCCTCACTGG + Intergenic
1039491917 8:37954130-37954152 GAGACTGGATTAGTTCTTGCAGG + Intergenic
1039508473 8:38069940-38069962 GAGACTGGGTTAGTTCACACAGG - Intergenic
1040029754 8:42813724-42813746 GAGACTGGATTAGTTCACATGGG + Intergenic
1040571903 8:48618968-48618990 GAAACAACATTTGTTCTCACTGG - Intergenic
1040626717 8:49158102-49158124 GAGACTGGGTTGGTTCTCAAGGG - Intergenic
1040885775 8:52262165-52262187 AAGAGTGGATTAGTTCTCACTGG - Intronic
1041986980 8:63933397-63933419 GAGCCTAGAGTGGTGGTCACAGG - Intergenic
1043106010 8:76111059-76111081 GAGACTGGATTAGTTCTTGCGGG - Intergenic
1043836735 8:85056223-85056245 CTGACTAGAATGGTTCCCACAGG - Intergenic
1048008664 8:130439304-130439326 AAGTCTAGAATGGATCTCACTGG - Intronic
1048094833 8:131280567-131280589 GAGGCTAGATTGGTTTGCATTGG + Intergenic
1048190824 8:132286820-132286842 AAGACTGGATTAGTTTTCACAGG + Intronic
1048237645 8:132707517-132707539 GAGAATAGATTAGTTATCTCGGG + Intronic
1050927341 9:11281061-11281083 GAGACTAGATTGCGTGTCAGGGG + Intergenic
1051971561 9:22893890-22893912 GAGACTACATTGGATCTACCTGG + Intergenic
1056374106 9:85990228-85990250 GAGACTGGATTAGTTCTCACAGG - Intronic
1056497520 9:87173863-87173885 GAGACTAGATTAGATCTCATGGG - Intergenic
1056556845 9:87696671-87696693 GAGAGTGGATTAGTTCTCATGGG - Intronic
1058532135 9:105916552-105916574 GAGACTGGATTGGCTCTTAGGGG - Intergenic
1186444727 X:9617555-9617577 GAGAGTATATTTGTTCTCAATGG + Intronic
1186539292 X:10383735-10383757 AAGGCTAGATTAGTTCTCATGGG - Intergenic
1186557300 X:10573426-10573448 GAGACTAGATTGGTTCTCACAGG - Intronic
1186629949 X:11338020-11338042 GACACTAGATTGGTTCTCAGGGG - Intronic
1187598042 X:20796543-20796565 AAGACTGGATTGGTTTTCATGGG + Intergenic
1188164262 X:26842761-26842783 CAGACTAGATTAATTCTCACAGG - Intergenic
1189030717 X:37446880-37446902 GAGACTGGACTAGTTCTCACAGG - Intronic
1189161568 X:38814347-38814369 AAGTCTAGAATGGGTCTCACTGG - Intergenic
1189253416 X:39619118-39619140 GAGACTAGAGAGGTTTACACTGG + Intergenic
1190785361 X:53642585-53642607 GAGTGTAGACTGGTTCTCATGGG - Intronic
1190800370 X:53782980-53783002 AAGACTGGGTTAGTTCTCACAGG + Intergenic
1192463494 X:71338218-71338240 GAGACTGGATTAGTTCTTGCTGG + Intergenic
1192565177 X:72157610-72157632 GAGACTGGATGAGTTCTCTCAGG - Intergenic
1192565577 X:72160786-72160808 AAGACTGGATTAGTTCTCTCAGG - Intergenic
1192634573 X:72805399-72805421 GAGACTGGATTAGTGCTCGCAGG - Intronic
1192647140 X:72915402-72915424 GAGACTGGATTAGTGCTCGCAGG + Intronic
1192823215 X:74666373-74666395 GAGGATATATTGGTGCTCACAGG - Intergenic
1192890276 X:75383369-75383391 GGGACTAGATGGGAACTCACTGG - Intronic
1193365539 X:80627958-80627980 GAGACTGGATTGGTTTTTACAGG + Intergenic
1193366925 X:80645573-80645595 AAGACTATATTGGCTCTCATGGG - Intergenic
1194494149 X:94589156-94589178 CAGATTAGATTTGTTCTCTCTGG + Intergenic
1195158624 X:102149073-102149095 GAGACTGGATTAGTTATCACTGG + Intergenic
1195466740 X:105187698-105187720 GAGACTAGAATGGTGGTTACAGG + Intronic
1195731287 X:107970383-107970405 GTGACTAGATGGGTGCTAACAGG - Intergenic
1198684034 X:139208874-139208896 GTGACAAGACTGCTTCTCACTGG + Intronic
1200493170 Y:3852692-3852714 GAGGCTGGATAAGTTCTCACTGG + Intergenic
1201192184 Y:11453986-11454008 GAGATTAGATTGGTTCACCAAGG - Intergenic
1202187228 Y:22197885-22197907 GAGACTAGGTTGGGTACCACGGG + Intergenic
1202204132 Y:22388511-22388533 GAGACTAGGTTGGGTACCACGGG - Intronic