ID: 1186559008

View in Genome Browser
Species Human (GRCh38)
Location X:10590418-10590440
Sequence CACTGTGGAAGAGTGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 166}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186559008_1186559021 27 Left 1186559008 X:10590418-10590440 CCCTGTGCCACTCTTCCACAGTG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1186559021 X:10590468-10590490 GGTCGCAGCATTCCAGGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 151
1186559008_1186559018 22 Left 1186559008 X:10590418-10590440 CCCTGTGCCACTCTTCCACAGTG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1186559018 X:10590463-10590485 GACAGGGTCGCAGCATTCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 92
1186559008_1186559022 28 Left 1186559008 X:10590418-10590440 CCCTGTGCCACTCTTCCACAGTG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1186559022 X:10590469-10590491 GTCGCAGCATTCCAGGGGAGGGG 0: 1
1: 0
2: 1
3: 15
4: 145
1186559008_1186559013 -4 Left 1186559008 X:10590418-10590440 CCCTGTGCCACTCTTCCACAGTG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1186559013 X:10590437-10590459 AGTGAAGCAAATAAGGTTTGTGG 0: 1
1: 0
2: 2
3: 14
4: 238
1186559008_1186559014 -3 Left 1186559008 X:10590418-10590440 CCCTGTGCCACTCTTCCACAGTG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1186559014 X:10590438-10590460 GTGAAGCAAATAAGGTTTGTGGG 0: 1
1: 0
2: 1
3: 22
4: 175
1186559008_1186559020 26 Left 1186559008 X:10590418-10590440 CCCTGTGCCACTCTTCCACAGTG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1186559020 X:10590467-10590489 GGGTCGCAGCATTCCAGGGGAGG 0: 1
1: 0
2: 1
3: 7
4: 122
1186559008_1186559016 6 Left 1186559008 X:10590418-10590440 CCCTGTGCCACTCTTCCACAGTG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1186559016 X:10590447-10590469 ATAAGGTTTGTGGGAAGACAGGG 0: 1
1: 0
2: 4
3: 21
4: 261
1186559008_1186559017 21 Left 1186559008 X:10590418-10590440 CCCTGTGCCACTCTTCCACAGTG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1186559017 X:10590462-10590484 AGACAGGGTCGCAGCATTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 150
1186559008_1186559015 5 Left 1186559008 X:10590418-10590440 CCCTGTGCCACTCTTCCACAGTG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1186559015 X:10590446-10590468 AATAAGGTTTGTGGGAAGACAGG 0: 1
1: 0
2: 2
3: 13
4: 230
1186559008_1186559019 23 Left 1186559008 X:10590418-10590440 CCCTGTGCCACTCTTCCACAGTG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1186559019 X:10590464-10590486 ACAGGGTCGCAGCATTCCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186559008 Original CRISPR CACTGTGGAAGAGTGGCACA GGG (reversed) Intronic
903382921 1:22909243-22909265 CACTCTGGGAGACTGGCACAAGG - Intronic
903484603 1:23680321-23680343 CACCTGGGAAGAGTGGCTCAAGG + Intergenic
904789204 1:33005809-33005831 GAGAGAGGAAGAGTGGCACATGG + Intergenic
912079707 1:105919986-105920008 CACTGTAGAAGAGTGTCCAAAGG + Intergenic
912084556 1:105982421-105982443 CACAGTGGAAGAGCTGCCCAGGG + Intergenic
918778640 1:188668710-188668732 CCCTGGGGAAGACTGGCAAATGG + Intergenic
918863306 1:189860712-189860734 CACTGTGGTAGAGAGGGAGAGGG - Intergenic
920312404 1:205056420-205056442 CAGTGAGGGAGAATGGCACAAGG + Intronic
921087971 1:211814323-211814345 CAGTGTGGAAGGGTGTCACAAGG + Intronic
923266499 1:232319485-232319507 CACTGTGTTGGAGTGGCACCAGG - Intergenic
924179100 1:241423911-241423933 CACAGGGGACGCGTGGCACAGGG - Intergenic
924541718 1:244986776-244986798 CACTGTGGAAGGGTGGAGCACGG + Intronic
924697737 1:246418305-246418327 CTCTGTGGCAGAGGGGGACAAGG - Intronic
1064140038 10:12782759-12782781 CAATTTGGAAGAGTTGCACATGG - Intronic
1067207665 10:44233550-44233572 CACTGAGGAAGAATGGGTCAGGG + Intergenic
1067370062 10:45674301-45674323 CAATGTGGAATAATGGAACAAGG - Intergenic
1070519915 10:77243757-77243779 CACTGTGGAAGGGTAACACAGGG - Intronic
1070569141 10:77627849-77627871 CACTGGGGAGGAATCGCACAGGG + Intronic
1074122997 10:110507090-110507112 CCCTGTGGAAGACAGCCACACGG + Exonic
1077729312 11:4712197-4712219 CACTGTGGAAGGGAGGTACTAGG + Intronic
1078405845 11:11069308-11069330 GGATGTGGAGGAGTGGCACATGG - Intergenic
1078450039 11:11433921-11433943 CACTCTGGAGCAGTGGAACATGG - Intronic
1081069436 11:38592934-38592956 CACTGTGGTATACTGGCAAAGGG - Intergenic
1084531687 11:69731269-69731291 CACAGTGGACGTGTGGCCCAAGG - Intergenic
1085157599 11:74311053-74311075 CACTGTGGAAGAGCGGGGCGGGG - Intronic
1086643957 11:89195915-89195937 CACTGTTGGAGAATGGGACATGG + Intronic
1086983443 11:93223642-93223664 CACCCTGGAGGAGTGGCACGGGG + Intergenic
1087639447 11:100740779-100740801 CACTGTTAAAGTTTGGCACAGGG + Intronic
1089592272 11:119550527-119550549 TACAGTGGAAGAGTTGCATAAGG - Intergenic
1091848246 12:3674218-3674240 CACTGTGGCCTAGTGGCACTAGG + Intronic
1092244834 12:6858028-6858050 CACTGTGAAAGAGAGGCGGAGGG + Intronic
1092753253 12:11738606-11738628 AGCTGTGGAAAAGTGGCACAGGG - Intronic
1097348035 12:58516965-58516987 CAGTGTGGAAGCTTGGGACATGG + Intergenic
1100879267 12:98998071-98998093 CACATTGGAAAAGTGGCACAAGG - Intronic
1106395840 13:29380134-29380156 CAGTGTGGAACAGAGGGACAAGG - Intronic
1108086622 13:46799804-46799826 CAAGATGGAACAGTGGCACAGGG - Intergenic
1110519927 13:76463695-76463717 CAGTGAGGCTGAGTGGCACATGG - Intergenic
1111221376 13:85208880-85208902 CACAGAGGCAGAGTTGCACAAGG + Intergenic
1114601614 14:23959982-23960004 CACTGAGGAGGTGTGGGACAAGG + Exonic
1116068264 14:40010382-40010404 AACTATGGAAGTGTGGCACTGGG + Intergenic
1119315860 14:73694030-73694052 CACTGAGGAAGAGAGGTACTGGG + Intronic
1125252895 15:37726505-37726527 TAATCTGGGAGAGTGGCACAGGG - Intergenic
1125983972 15:44031229-44031251 CCCTGTGGAAGAGGGGCCCTGGG - Intronic
1126260569 15:46684594-46684616 CACTGTGGAAGCATGGGAAAAGG + Intergenic
1126548053 15:49894672-49894694 CACTGTGGCAAAGGGGCTCAGGG - Intronic
1128092114 15:64926218-64926240 CAGTGTGCAAGAGTGGCCCCAGG - Intronic
1128563225 15:68682226-68682248 GATTCTGGAAGAGTTGCACAAGG + Intronic
1130311411 15:82758783-82758805 TACTGTGTAGGAGTGGAACAGGG + Exonic
1130580491 15:85133476-85133498 CACTGGGGAAGTGTGGTGCAAGG + Intronic
1132074209 15:98806220-98806242 ACAAGTGGAAGAGTGGCACAGGG + Intronic
1132407636 15:101553731-101553753 GACTGTGGACGAGAGGCACAGGG - Intergenic
1133207957 16:4245253-4245275 CAGAGTGGAAGAGTTGCAGATGG - Intergenic
1136956792 16:34796847-34796869 CAGTGAGGAAGACTGGTACATGG + Intergenic
1137468241 16:48730700-48730722 CACTGTGCAAGAGCTGCATAAGG - Intergenic
1137688097 16:50400886-50400908 CACTATGGGAGAATGGCACCTGG - Intergenic
1138550812 16:57747388-57747410 CACTGTGCATGTGTGGCTCATGG - Intronic
1140912486 16:79466899-79466921 CAGTGTGGAAGAGGGGACCACGG + Intergenic
1141975466 16:87513035-87513057 CACTGTGGCAGAGTGAATCACGG - Intergenic
1142495583 17:304907-304929 CAGAGTGCAAGAGAGGCACAGGG + Intronic
1142911581 17:3097937-3097959 CAGTGAGGAAGAGTGGGTCAGGG - Intergenic
1143684853 17:8505367-8505389 CCCTATGGAAGAGAGGCACCTGG - Intronic
1144357858 17:14462825-14462847 CCCTGTAGAAGAATGCCACAGGG - Intergenic
1146432404 17:32810107-32810129 CACTGGGGAGAAGTGGCAAAGGG + Intronic
1147712174 17:42476372-42476394 CACTCTTAAAAAGTGGCACAGGG - Intronic
1148092271 17:45029792-45029814 CACTGAGTAACAGTGGCCCAGGG + Intronic
1151424853 17:74024393-74024415 GGCTGTGGAACAGAGGCACAGGG - Intergenic
1153497066 18:5710394-5710416 CACTGTAGAAGGGTCGCCCAGGG - Intergenic
1153989155 18:10380022-10380044 CACTATGGGAGAGTGCCACTGGG - Intergenic
1158776853 18:60593319-60593341 CCCTGAGGAAAAGTGACACAAGG + Intergenic
1158900473 18:61957556-61957578 CCCTGGGGATCAGTGGCACAAGG - Intergenic
1160187281 18:76685608-76685630 CCCTGTGGGAGAGTTGCAAAAGG + Intergenic
1161722170 19:5909082-5909104 CACTGGGGAAGAGGCGGACAGGG + Exonic
1165317681 19:35066413-35066435 CACTGTGGAAGAGAGGACCCTGG - Exonic
1165381078 19:35480792-35480814 CACTGTAGAAGAGTCGGGCACGG - Intergenic
1165631853 19:37307913-37307935 CACTGTGAAGGATTGGCCCATGG + Intergenic
925250930 2:2436668-2436690 CACTGTGGAGGTGTTGCAAATGG + Intergenic
931004834 2:57837179-57837201 CAGTGTGAAAGAGTTCCACATGG + Intergenic
931047259 2:58369253-58369275 AACTGTGGAAGAGGGGCACAAGG - Intergenic
932911395 2:75809815-75809837 CACTGACTAAGAGTTGCACACGG + Intergenic
934016620 2:87892885-87892907 TGCTCTGGAGGAGTGGCACATGG - Intergenic
935861298 2:107332961-107332983 CACTGTGGGAGGATGGAACACGG + Intergenic
935979168 2:108609586-108609608 CATTGTGAAAGAATGGCACCAGG - Intronic
937906770 2:127056323-127056345 CTCTGTGGGATAGTGGCAGAGGG - Intronic
938937097 2:136136665-136136687 CAGTTTGGAAGGTTGGCACAAGG + Intergenic
939309717 2:140460207-140460229 CATGGTGGAAGAGTATCACATGG - Intronic
940648455 2:156416271-156416293 AACTGTGGAAGAGTAGAAGAAGG + Intergenic
940906481 2:159174391-159174413 CACTGTGGAGGAGTTCTACAGGG - Intronic
941345462 2:164363050-164363072 CTTTATGGAAGAGTGGTACAAGG + Intergenic
947537669 2:230951000-230951022 CACTGATGAAGAGATGCACAGGG - Intronic
948526329 2:238573195-238573217 CCCTGTGGAGGAGTGACAGAGGG + Intergenic
948647639 2:239417457-239417479 CACTGTGGAAGGTGGGCACTGGG - Intergenic
1171469241 20:25356687-25356709 CACTGTGGCAGAGTGGCAGGTGG + Intronic
1172074324 20:32282421-32282443 CCCTGTAGAGGAGAGGCACAAGG + Intronic
1173201727 20:40959824-40959846 CACTGTTGAAGAGAGCCCCAAGG + Intergenic
1174132370 20:48355022-48355044 CACTGTGGAGGGATGGCTCAGGG - Intergenic
1174904975 20:54540754-54540776 CACTGTGGAAGAATTGCAGGAGG - Intronic
1174922225 20:54716362-54716384 AACTGGGGAAAAGTGGCAGAAGG - Intergenic
1175064772 20:56275444-56275466 CCCAGCGGAAGAGTGGCAGATGG + Intergenic
1175765313 20:61588371-61588393 CACAGCGGGAGAGAGGCACAAGG + Intronic
1176056069 20:63149972-63149994 AAGTGTGTAAGAGGGGCACAGGG + Intergenic
1176512909 21:7762117-7762139 CACTGTAGAAGATGGGCAGAGGG + Intronic
1177379780 21:20325362-20325384 CACAGAAGAAGAGTGTCACACGG + Intergenic
1178621646 21:34182566-34182588 CACTGTGTCAGAGAGGCCCAGGG - Intergenic
1178647022 21:34392641-34392663 CACTGTAGAAGATGGGCAGAGGG + Intronic
1183265393 22:36822080-36822102 CAGTTTGAGAGAGTGGCACAAGG - Intergenic
949303079 3:2606995-2607017 GACTGTGGAAGCGAAGCACAAGG - Intronic
949900739 3:8812876-8812898 CCCTGTGGTAGAGCTGCACAGGG + Intronic
950159619 3:10750300-10750322 CACTGAAGAAGAGAGACACAAGG - Intergenic
951858117 3:27220793-27220815 CACTGTGTGAGACTGGCATAAGG + Intronic
952240838 3:31530359-31530381 CACTGTGGAGGACAGGCACATGG - Intergenic
954546219 3:51437568-51437590 CACTTTGGGAGGGTGGCAGATGG + Intronic
959307241 3:104683942-104683964 CACTGGGCCACAGTGGCACAGGG - Intergenic
960730054 3:120717353-120717375 TATTGTGGAAGAATGGGACATGG - Intronic
961147017 3:124602622-124602644 CCTTGTGGAAAAGTGACACAGGG + Intronic
961546799 3:127639958-127639980 CTCTGTTGAAGATTGCCACAAGG + Intronic
961679634 3:128590841-128590863 CACTGTGGAGAAGTTGCAGAGGG + Intergenic
962376126 3:134860194-134860216 CACTCTGGGAAAGGGGCACAGGG + Intronic
963005503 3:140723200-140723222 CAGTGTGGAGGGGTGGAACATGG - Intergenic
964147573 3:153483836-153483858 CACTGTGGGAGAGATGGACAAGG - Intergenic
965321636 3:167259020-167259042 TCTTGTGGAAGAGTGGCAAAAGG + Intronic
967187725 3:186959863-186959885 CAATGTGGAAGAATGGCTCCAGG + Intronic
969110368 4:4840569-4840591 CACTGTGGACCAGCGACACAGGG - Intergenic
969293410 4:6254915-6254937 CCCAGTGGAGGAGTGGCAGAGGG + Intergenic
970240916 4:14007960-14007982 AACTGTGGCAGAGAGGGACAGGG - Intergenic
970725611 4:19040809-19040831 CAGTGATGAAGAGTGGCAAAAGG - Intergenic
971291094 4:25340363-25340385 GACTGTGTAAGAGTGGCATAGGG - Intronic
973004795 4:44993384-44993406 CCCTGGGGAGGAGTGGCAGATGG + Intergenic
973545648 4:51978990-51979012 CACCAAGCAAGAGTGGCACAAGG - Intergenic
973719543 4:53709203-53709225 CAATGTGGCAGAGTGGCTGAAGG + Intronic
974505600 4:62767084-62767106 CACTGTGACTGAGTGGTACATGG + Intergenic
980839000 4:138234013-138234035 CACTGTGGAAGACAGGCCAAGGG - Intronic
981047419 4:140278264-140278286 CACAGTGGAAAAGTGGAAGAGGG + Intronic
983820305 4:172184789-172184811 CATTGTTGAAGAATGGCAAAAGG + Intronic
986453952 5:7896518-7896540 TACTATGGAAAAGTGGCTCAGGG - Intronic
988465197 5:31483764-31483786 CACTGAGGAGGAGTGGCAGGAGG - Intronic
990141185 5:52706362-52706384 GGCTGTGGAAGAGTGGAACCAGG + Intergenic
990325156 5:54667966-54667988 CACTGTAGAGTAGTGGCAAAAGG + Intergenic
992084166 5:73263077-73263099 CAGTTTAGAAGAGTGGCCCAGGG + Intergenic
994875602 5:105417006-105417028 TATTGTGGAAGAGTGTCAAAAGG - Intergenic
996328929 5:122308799-122308821 CACTGTACAACAGTTGCACATGG - Intergenic
998106370 5:139471680-139471702 GACAGAGGAAGACTGGCACAGGG + Intergenic
1000722912 5:164730573-164730595 AACTGTGGAAGACTTGCAAATGG + Intergenic
1001190764 5:169628872-169628894 TACTGTGGGAGAGTGGAAAAGGG - Intergenic
1002399765 5:178985118-178985140 CAGTGTGGATGAGAGGCACAGGG - Intronic
1005451219 6:25974572-25974594 CACTGTGGAAGACAGACTCAAGG - Intronic
1007058234 6:38910332-38910354 CACTGTGTAAGATTGACAAATGG + Intronic
1007134321 6:39506959-39506981 CCAAGTGGAAGAGAGGCACAGGG - Intronic
1007271018 6:40637190-40637212 CTCTGAGTTAGAGTGGCACATGG - Intergenic
1007317746 6:41003063-41003085 AACTTTGGAAGAGTCCCACAGGG - Intergenic
1014485047 6:121988248-121988270 CACAGTGTAATATTGGCACAAGG - Intergenic
1016882155 6:148921852-148921874 CAGGGTGGAAGAGTGGGGCATGG - Intronic
1019043254 6:169123411-169123433 CCCAGTGGAAGACTGGCAGATGG + Intergenic
1021478013 7:21084855-21084877 AACTGGGGGAGAATGGCACAGGG + Intergenic
1024329985 7:48146055-48146077 GACTGGGGATGACTGGCACAAGG + Intergenic
1028179090 7:87696649-87696671 CACTTTGGAAGTGATGCACATGG + Intronic
1028704873 7:93829987-93830009 CACTGAGGAAGACTGGCTTAAGG + Intronic
1030397530 7:109006258-109006280 CACTGTGTAAATGGGGCACATGG + Intergenic
1036590996 8:10167923-10167945 GACCGCGGAAGAGAGGCACATGG + Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038010803 8:23474544-23474566 CACTGAGGAAGACAGGCATATGG - Intergenic
1039521060 8:38172228-38172250 CAGTGTGGCAGAGTGGGAAAAGG + Intronic
1039820151 8:41127697-41127719 CACTGACGAAGAGATGCACAGGG - Intergenic
1041731652 8:61068937-61068959 CACTGTGGAAGAGGGACAAATGG - Intronic
1042505076 8:69550900-69550922 CACTGTGGAAGAGTAGGGAAAGG - Intronic
1046670047 8:117047062-117047084 CACTGTGGATGAGTGGGAGACGG + Intronic
1049313718 8:141947715-141947737 CACGGTGGAAGAGCAGAACAAGG + Intergenic
1053097274 9:35339491-35339513 CCCTGTAGAACAGTGGCAGAAGG + Intronic
1060102165 9:120850123-120850145 CACTATGGAACAGTGGCAGGTGG - Intergenic
1060796805 9:126517353-126517375 CACTGGGGAGGAGTGGGACCAGG + Intergenic
1061034065 9:128103722-128103744 CACAGTGGAGGAGAGGCAGACGG + Exonic
1061163860 9:128911344-128911366 CACAGTGGGAGAGTGGACCAGGG + Intronic
1062183339 9:135202882-135202904 CCCTGAGACAGAGTGGCACACGG - Intergenic
1185842482 X:3405323-3405345 CAAAGTGGAAGATTGGCACATGG - Intergenic
1186559008 X:10590418-10590440 CACTGTGGAAGAGTGGCACAGGG - Intronic
1187112475 X:16315704-16315726 CACTGTGGCACTGTGGCAAAAGG - Intergenic
1192608623 X:72545525-72545547 CACAGGTGAAGTGTGGCACAGGG - Intronic
1193264229 X:79449440-79449462 AACAGTGGAAGATGGGCACAGGG + Intergenic
1197874080 X:131085634-131085656 CACTGTGGCAGGGTGGCATCAGG - Exonic
1198197673 X:134381142-134381164 CACTGAGGAATAGTGGCAGAAGG + Intronic
1199127866 X:144145655-144145677 TGCTCTGGAGGAGTGGCACATGG + Intergenic
1200182320 X:154158254-154158276 CACTGTGGATGAGTGTCATGGGG + Intronic
1200187974 X:154195368-154195390 CACTGTGGATGAGTGTCATGGGG + Intergenic
1200193624 X:154232508-154232530 CACTGTGGATGAGTGTCATGGGG + Intronic
1200199379 X:154270312-154270334 CACTGTGGATGAGTGTCATGGGG + Intronic
1201232956 Y:11882954-11882976 CAAAGTGGAAGACTGGCACATGG + Intergenic