ID: 1186559021

View in Genome Browser
Species Human (GRCh38)
Location X:10590468-10590490
Sequence GGTCGCAGCATTCCAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186559009_1186559021 26 Left 1186559009 X:10590419-10590441 CCTGTGCCACTCTTCCACAGTGA 0: 1
1: 0
2: 2
3: 13
4: 159
Right 1186559021 X:10590468-10590490 GGTCGCAGCATTCCAGGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 151
1186559010_1186559021 20 Left 1186559010 X:10590425-10590447 CCACTCTTCCACAGTGAAGCAAA 0: 1
1: 0
2: 0
3: 21
4: 198
Right 1186559021 X:10590468-10590490 GGTCGCAGCATTCCAGGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 151
1186559012_1186559021 12 Left 1186559012 X:10590433-10590455 CCACAGTGAAGCAAATAAGGTTT 0: 1
1: 0
2: 2
3: 14
4: 201
Right 1186559021 X:10590468-10590490 GGTCGCAGCATTCCAGGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 151
1186559008_1186559021 27 Left 1186559008 X:10590418-10590440 CCCTGTGCCACTCTTCCACAGTG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1186559021 X:10590468-10590490 GGTCGCAGCATTCCAGGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186559021 Original CRISPR GGTCGCAGCATTCCAGGGGA GGG Intronic
900161631 1:1226869-1226891 GCTCGCGGCATCACAGGGGAAGG - Intronic
901532833 1:9864208-9864230 GGTGGCAGCAGACCAGGGCATGG + Intronic
903290955 1:22313928-22313950 GGTTGCAGCCTTCCAGGGATGGG + Intergenic
904198231 1:28801992-28802014 GGTCTTAGGATTCCAGTGGAGGG + Intergenic
904789271 1:33006360-33006382 GGTGGCAGCATTCCAGCTGAGGG - Intergenic
905232503 1:36522990-36523012 AGTCACAGCCGTCCAGGGGAGGG + Intergenic
905363691 1:37437286-37437308 TGTCTAAGCATACCAGGGGAGGG + Intergenic
906283901 1:44573338-44573360 GGATGCAGCATTCCATGGGCAGG - Intronic
910659216 1:89652783-89652805 GGTCGCAGTATCACAGGAGAAGG + Intronic
913017922 1:114757874-114757896 GGTAGCAGAAACCCAGGGGAAGG - Intronic
913546160 1:119871213-119871235 GGTCACACCATTCCAGGGAGCGG + Intergenic
916592571 1:166206585-166206607 GGAGGCAGAACTCCAGGGGAGGG - Intergenic
918465063 1:184812619-184812641 GGTCTCTGCCTTCCAGGGAATGG + Intronic
920668343 1:207983175-207983197 GGTCCCAGCATGCCCAGGGATGG - Intergenic
922719165 1:227891587-227891609 GATCCCAGCATTCCAGGGCTGGG - Intergenic
924101501 1:240607574-240607596 GGTCTCTGCAGGCCAGGGGATGG + Intronic
1063810315 10:9697467-9697489 GTTAGCAGCATTTCAAGGGAAGG - Intergenic
1067203951 10:44197981-44198003 GGTCCCAGCCTCCCAGGGGCAGG - Intergenic
1067294246 10:44965722-44965744 GGGCACACCATCCCAGGGGAGGG - Intronic
1069868951 10:71521542-71521564 GATGGCAGCATCTCAGGGGAGGG - Intronic
1072715518 10:97749899-97749921 GGTGGCTGCACCCCAGGGGATGG - Intronic
1073871497 10:107870125-107870147 GGTAGCAGAATTCCAAGAGAAGG + Intergenic
1074908613 10:117886982-117887004 GCTTGCTGCATTCCAGGAGACGG + Intergenic
1076224337 10:128762015-128762037 GGAAGCAGCAGCCCAGGGGAAGG - Intergenic
1076861723 10:133141077-133141099 GGCCCCAGCCTTGCAGGGGAGGG - Intergenic
1077035394 11:491934-491956 GGACACAGGATTCCTGGGGAGGG + Intergenic
1077390695 11:2299490-2299512 GGACACAGCTTTCCAGAGGAGGG + Exonic
1078396918 11:10989343-10989365 GGTTGGAGAATTGCAGGGGACGG + Intergenic
1080789537 11:35509755-35509777 GTTCACAGAATTCCAGGGGTAGG + Intronic
1082274601 11:50207815-50207837 AGTGGCAGCATTCCAGCAGAGGG - Intergenic
1083142647 11:60734466-60734488 GGTGGCAGCACTGCAGGGAAGGG - Intronic
1084043378 11:66555451-66555473 GGTCGGAGCATCCCAGGAGGAGG - Intronic
1084310374 11:68313004-68313026 GGACGCAGCGTCCCCGGGGAGGG - Intronic
1085443097 11:76580578-76580600 AGTCGCAGCATCCCAGAGGAGGG + Intergenic
1085647965 11:78240233-78240255 GTTCCCTGCATTCCAGGGAAAGG + Intronic
1087885803 11:103481116-103481138 GGCCGTGGGATTCCAGGGGAAGG + Intergenic
1088195534 11:107269698-107269720 GGTCTTAGCATTTCAGTGGAGGG - Intergenic
1088332086 11:108664912-108664934 GGGCGCAGCACTCCACGGAAGGG - Intergenic
1091440309 12:507725-507747 GGTAGCAGCATTCCAGCTGTAGG + Intronic
1094042503 12:26132732-26132754 GGTGGGAGAATCCCAGGGGAGGG - Intronic
1098701443 12:73632853-73632875 GGTCAAATCCTTCCAGGGGATGG + Intergenic
1100790833 12:98128091-98128113 GGTCTCAGGAGTCCAGGGGAGGG + Intergenic
1101036642 12:100714137-100714159 GGTTCCTGCTTTCCAGGGGAGGG + Intergenic
1102487980 12:113271002-113271024 TGTCGCAGCATTCTAGGAGGAGG + Intronic
1102945525 12:116984389-116984411 GGTAGCAGCATTCCAGGTGCTGG + Intronic
1104721553 12:131047402-131047424 GGTGGGAGCATTCCAGGAGCAGG + Intronic
1115273633 14:31582340-31582362 GGTGGCACCTATCCAGGGGAAGG + Intronic
1117117267 14:52526979-52527001 GAGGGCAGCATGCCAGGGGAGGG + Intronic
1118279464 14:64415205-64415227 GCTCTCAGGATTCAAGGGGAAGG + Intronic
1121633725 14:95439757-95439779 GGTGGCAGAATTCCCGGAGAAGG - Exonic
1121677418 14:95765327-95765349 GGCTGCAGCATTCCAGGGGAGGG - Intergenic
1121988429 14:98530430-98530452 TGTCACAGCATAACAGGGGATGG + Intergenic
1128551316 15:68599750-68599772 TGTGGCAGCCTCCCAGGGGAGGG - Intronic
1132905252 16:2279135-2279157 GGTCGGAGCATAGCCGGGGAGGG + Intronic
1133051125 16:3118196-3118218 GGACTCAGCATTCCAGGTGGTGG + Intronic
1134505819 16:14806041-14806063 GGGAGCAGCATTCCAGGTGGAGG - Intronic
1134574761 16:15322898-15322920 GGGAGCAGCATTCCAGGTGGAGG + Intergenic
1134727683 16:16433568-16433590 GGGAGCAGCATTCCAGGTGGAGG - Intergenic
1134939753 16:18278259-18278281 GGGAGCAGCATTCCAGGTGGAGG + Intergenic
1136628781 16:31477300-31477322 GCGCGAAGCATTCCTGGGGAAGG - Exonic
1137471077 16:48759118-48759140 GGTGGCAGCCTTGCTGGGGAGGG + Intergenic
1138555833 16:57770764-57770786 AGACGCAGCAGGCCAGGGGAAGG + Intronic
1139671371 16:68494022-68494044 GCTCCCAGCATCCCAGGGGATGG + Intergenic
1141890622 16:86924439-86924461 GCACGCAGGATCCCAGGGGAAGG - Intergenic
1142220441 16:88851787-88851809 GGTGGCAGCCTGCCTGGGGAGGG + Intronic
1142571911 17:880208-880230 GGGCGAATCATTCCTGGGGACGG + Intronic
1146505103 17:33398011-33398033 GGTGGGAGCAGTGCAGGGGATGG + Intronic
1148567539 17:48642447-48642469 AGTCCCAGCAGTCCAGAGGAGGG - Intergenic
1148782184 17:50128694-50128716 GGGCGCACAATTCCTGGGGAGGG + Intronic
1151328275 17:73391972-73391994 GGTCCCAGGATTCCAGAGCAAGG - Intronic
1152024629 17:77800878-77800900 GTTCGCAAACTTCCAGGGGAAGG + Intergenic
1152636644 17:81432916-81432938 GAGCGCAGCCTTCCTGGGGATGG - Intronic
1155844958 18:30694840-30694862 GGTCACAACACTCCAGTGGATGG + Intergenic
1156297570 18:35806849-35806871 GGTCCCAGAATTCCAAGTGATGG - Intergenic
1159098777 18:63936549-63936571 GGTCGCAGGATGCCACGGGTAGG - Intergenic
1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG + Intergenic
1162551640 19:11361436-11361458 GGCCGCATCCTTGCAGGGGAAGG - Exonic
1163693585 19:18750969-18750991 GGTTACAGTGTTCCAGGGGATGG - Intronic
1165382921 19:35493973-35493995 GGTCCCAGCAGTTCAGGTGATGG + Intronic
1165902063 19:39173681-39173703 GGTCCCAGCACTCCAGGGCTGGG - Exonic
1167517072 19:49929626-49929648 GGCCTGAGCACTCCAGGGGAGGG + Intronic
928242822 2:29601448-29601470 TGTGGCATGATTCCAGGGGAGGG + Intronic
930805956 2:55490776-55490798 TGTGGCAGAATTCCAAGGGAAGG + Intergenic
932801834 2:74747980-74748002 GGCCGGAGGATTCCAGAGGATGG - Intergenic
933698542 2:85237982-85238004 GGTGGTGGCATTCCAGGCGAAGG + Intronic
936976918 2:118229819-118229841 GGTCTCAGCATCTCAGGGAAAGG - Intergenic
938200575 2:129369320-129369342 GGGCGCAGCATGCCAGGGAGAGG - Intergenic
941891141 2:170583013-170583035 TGTGGCAGCACTCCAGGGCAGGG - Intronic
942664250 2:178300237-178300259 AGTGGCAGCGTTCCAAGGGATGG + Intronic
943710803 2:191092974-191092996 GGCAGCAGCATGGCAGGGGAAGG + Intronic
946195748 2:218032356-218032378 GGAGGCAGCATGACAGGGGAAGG + Intergenic
946361293 2:219220670-219220692 GGTAACAGCTTTTCAGGGGAAGG - Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947380051 2:229536586-229536608 GGTATAAGCATTCCAGGGGGAGG + Intronic
1169912651 20:10659905-10659927 GGTGCCAGCAGTTCAGGGGAGGG + Intronic
1170282678 20:14668408-14668430 GGTAGCAGCCTTGCAGGAGAAGG + Intronic
1174343046 20:49909917-49909939 GGTAACAGCACTCCAGGGGCCGG - Intronic
1174458439 20:50666002-50666024 GGACTCAGCATTACAAGGGATGG - Intronic
1174795398 20:53518127-53518149 GGTCCCAGCATTCCAAGGCCAGG - Intergenic
1174798448 20:53541987-53542009 GGTCCCAGCATTCCAAGGCCAGG - Intergenic
1175898217 20:62349628-62349650 GGAAGCAGCAACCCAGGGGATGG + Intronic
1178765491 21:35447022-35447044 GATCGCAGCACTGCAGTGGATGG - Intronic
1179531470 21:42022369-42022391 GGGCGCAGCATTCCTGGGGCAGG + Intergenic
1180568667 22:16696765-16696787 GGTGCCAGCATACCAGGGGCAGG + Intergenic
1180636222 22:17264888-17264910 GCTCTCAGCATTCCTGGGGAAGG - Intergenic
1180785743 22:18546700-18546722 GGGCAGAGCATTCCAGGGAAGGG - Intergenic
1181131023 22:20732425-20732447 GGGCAAAGCATTCCAGGGAAGGG - Intronic
1181242668 22:21486254-21486276 GGGCAAAGCATTCCAGGGAAGGG - Intergenic
1181575462 22:23791702-23791724 GGTCGCAGCACCACAGGGAAGGG - Intronic
1184286995 22:43477469-43477491 GGACCCAGCCTCCCAGGGGAGGG - Intronic
1184528191 22:45037898-45037920 GGTAGCAGCATTCCATTGGTGGG + Intergenic
1184528294 22:45038591-45038613 GGTGACAGCATTCCATGGGAAGG + Intergenic
949938767 3:9137347-9137369 GCTTGCAGCTTTCTAGGGGATGG + Intronic
950422325 3:12906389-12906411 GCTGGCAGCCTTCCTGGGGAGGG - Intronic
950605762 3:14078669-14078691 GGTCTCCGCCTTCCAGGGAATGG - Intronic
961180107 3:124869674-124869696 GGAAGCTGCATTCCAGGGCAGGG + Intronic
961487801 3:127229397-127229419 GGTCACAGCTGTCCTGGGGAGGG - Intergenic
963046843 3:141108847-141108869 GAAAGCAGCATTTCAGGGGAGGG + Intronic
966991469 3:185235349-185235371 GGTGGCAGCAATCCAAGGCATGG - Exonic
969223929 4:5781965-5781987 GGTCACTGCATTCATGGGGATGG + Intronic
969415396 4:7054475-7054497 GGTGCCAGCCTTCCTGGGGAAGG + Exonic
970512372 4:16794046-16794068 GTTTGCATCCTTCCAGGGGAAGG + Intronic
971884927 4:32432232-32432254 GGTCACAACATTCCAAGGGGTGG - Intergenic
982104199 4:151997566-151997588 GATTGGAGCACTCCAGGGGAGGG - Intergenic
986533756 5:8765199-8765221 TGCCTCAGCATTCCAGGGCAGGG - Intergenic
988493192 5:31722381-31722403 GGTGGGAGGGTTCCAGGGGAGGG - Intronic
994636586 5:102351718-102351740 GGTAGCAGCCTGGCAGGGGAAGG + Intergenic
1001067757 5:168552569-168552591 GGCCACAGTATTCCAGGGAACGG + Exonic
1002576591 5:180177436-180177458 GGCCGCAGCAGTCCACGGGCAGG + Intronic
1006491547 6:34392392-34392414 GGTCGCAGGAGTCGAGGGGTGGG + Exonic
1010003884 6:70974572-70974594 GGTAGCAGCCTGGCAGGGGAGGG + Intergenic
1013090975 6:106900651-106900673 GGTCTCAGCTCTCCAGGGGGAGG - Intergenic
1014476955 6:121885648-121885670 GGTAGCAGCTTTCCAGGAAAGGG + Intergenic
1017935651 6:159002570-159002592 TGTCACAGCATTCCAGGTCAAGG + Intergenic
1018312495 6:162525402-162525424 GGGCCCAGCATTTCAGGGGGAGG - Intronic
1019956685 7:4420639-4420661 GGGAGCAGTATTCCATGGGATGG + Intergenic
1020410517 7:7886975-7886997 GGTCAGGGCATTCCAGGGAAAGG - Intronic
1023362046 7:39426894-39426916 TGGTGCTGCATTCCAGGGGAGGG - Intronic
1025215630 7:57053666-57053688 GGTGGCAGCATTCCAGCAAAGGG - Intergenic
1025626374 7:63226091-63226113 GGTGGCAGCATTCCAGCAAAGGG - Intergenic
1025655747 7:63517035-63517057 GGTGGCAGCATTCCAGCAAAGGG + Intergenic
1026079085 7:67201114-67201136 TCTGGCAGCATTACAGGGGATGG + Intronic
1026190194 7:68118626-68118648 GGTGGCAGCATTCCAGAAGGGGG - Intergenic
1026697739 7:72610824-72610846 TCTGGCAGCATTACAGGGGATGG - Intronic
1029549661 7:101231008-101231030 GATCTCTCCATTCCAGGGGAGGG + Intergenic
1038404485 8:27311337-27311359 TCTCTCAGCGTTCCAGGGGAAGG - Intergenic
1038670711 8:29580793-29580815 GGTCCGTTCATTCCAGGGGATGG + Intergenic
1044019638 8:87089107-87089129 GATCACAGCATTTCAGGGAAAGG + Intronic
1046607918 8:116391130-116391152 GGCAGCAGCATGGCAGGGGAAGG + Intergenic
1052104438 9:24495196-24495218 GAACACAGCATTCCAGGGTAAGG - Intergenic
1052347730 9:27427072-27427094 GATCCCAGAATTCCAGGGCAGGG + Intronic
1059465800 9:114468069-114468091 AGTCCCAGCTTCCCAGGGGAGGG + Intronic
1059756179 9:117295851-117295873 GGTAGGAGCATTGCAGAGGATGG + Intronic
1061752726 9:132791997-132792019 GGTGACAGCATTCTAGTGGAAGG - Intronic
1186559021 X:10590468-10590490 GGTCGCAGCATTCCAGGGGAGGG + Intronic
1191817772 X:65266865-65266887 GGTCACAGCACACCAGGGCAAGG + Intergenic
1194157944 X:90416142-90416164 GATCCCAGGATCCCAGGGGATGG - Intergenic
1194353840 X:92856175-92856197 GGATGCCCCATTCCAGGGGAAGG + Intergenic
1198235801 X:134734872-134734894 GGCCCCAGCAGTCCAGGGGGTGG - Intronic
1200090226 X:153632590-153632612 GGTCACAGAATTCCAGGGAGAGG + Intergenic
1200504268 Y:3993111-3993133 GATCCCAGGATCCCAGGGGATGG - Intergenic
1200662200 Y:5973247-5973269 GGATGCCCCATTCCAGGGGAAGG + Intergenic