ID: 1186564912

View in Genome Browser
Species Human (GRCh38)
Location X:10652189-10652211
Sequence TATTATAATTCAGCTAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186564912_1186564913 5 Left 1186564912 X:10652189-10652211 CCATCACTAGCTGAATTATAATA 0: 1
1: 0
2: 0
3: 13
4: 198
Right 1186564913 X:10652217-10652239 GCTCGTGTCTGTCCCATCTCTGG 0: 1
1: 0
2: 0
3: 14
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186564912 Original CRISPR TATTATAATTCAGCTAGTGA TGG (reversed) Intronic
901367326 1:8763961-8763983 TCCTATAATTCAGGAAGTGAAGG + Intronic
904385791 1:30141168-30141190 AATTATAAAGCAGCCAGTGAAGG - Intergenic
904493359 1:30873545-30873567 GATTAGAATGCAGCCAGTGAAGG - Intronic
904841648 1:33375825-33375847 TATTATAAGTAATCTAGAGATGG + Intronic
908931399 1:69320105-69320127 TATTATGATACATCCAGTGATGG + Intergenic
909267531 1:73579731-73579753 TATTAGAATTCAGCTGGTCTGGG - Intergenic
909716947 1:78719937-78719959 TATTATAACTCAGGTAGACAGGG + Intergenic
909959842 1:81826267-81826289 TATTATAAGTTAGCAATTGAAGG + Intronic
910120208 1:83779828-83779850 TAGTATATTTCAGCAAGAGAGGG + Intergenic
910223999 1:84917811-84917833 TATTATAAGTCATCTAGAGATGG + Intergenic
911402793 1:97397746-97397768 GTTTATAATTCACCTACTGAAGG + Intronic
912685476 1:111759107-111759129 TATTATAAATAATCTAGAGATGG + Intronic
913446385 1:118954937-118954959 TATTGTAATTCTGCTAGCCAAGG - Intronic
915030474 1:152876228-152876250 TGTTAAAATTAAGCTAATGAAGG - Intergenic
916094047 1:161332481-161332503 AATGTTAATTCAGCTAGTAAAGG - Intronic
921107916 1:212001523-212001545 TATTATAAGTAATCTAGAGAAGG + Intronic
921618567 1:217300673-217300695 TCTTATAATTGTGCTAGTCAGGG - Intergenic
922755143 1:228092290-228092312 TATTAAAAATCAGCTAGGCATGG + Intronic
924095217 1:240544080-240544102 TATTATAAGTAATCTAGAGATGG + Intronic
924373691 1:243383926-243383948 GATTATAATAGAGCTAGAGAAGG - Intronic
1063040866 10:2336138-2336160 TAGAGTAAGTCAGCTAGTGATGG + Intergenic
1063298559 10:4831074-4831096 TATCAAAATTCAGTTAGTGATGG + Intronic
1064276072 10:13906115-13906137 TATTAGAATGCAGCTACTTATGG + Intronic
1064782822 10:18861167-18861189 TATTATAATCCAAGAAGTGAAGG + Intergenic
1066098281 10:32094048-32094070 AAATATAATTCAGCTAGGTAAGG + Intergenic
1066558326 10:36640191-36640213 TAATATCATCAAGCTAGTGATGG + Intergenic
1070021008 10:72585890-72585912 TATTATAAGTTATCTAGGGATGG - Intronic
1071945281 10:90637041-90637063 TCTTATAATTCAGATACTGAAGG + Intergenic
1072561351 10:96578384-96578406 TATTATAATTAAGGTAATAAAGG + Intronic
1078109868 11:8383603-8383625 AATTATGATTTAGCTATTGAGGG + Intergenic
1078322302 11:10347186-10347208 GATTATGATTCTGCTAGGGATGG - Intronic
1080023352 11:27587624-27587646 TATTATTATTTTGGTAGTGATGG + Intergenic
1080144137 11:28959153-28959175 TATAATAATTCATTTAGTCAAGG + Intergenic
1081398459 11:42614696-42614718 TATTTTAATCCAGTTACTGAAGG - Intergenic
1087730555 11:101773762-101773784 TATTATGTTTCAGCTTCTGAAGG + Intronic
1089369671 11:117946520-117946542 TTTTACCATTCAGCTAGTGGGGG + Intergenic
1090779395 11:129993783-129993805 TATAATAATTAAGATAGTGTTGG - Intronic
1093507514 12:19885727-19885749 TATTATAATTCAGCAAGACCGGG + Intergenic
1094100773 12:26760071-26760093 TATTATAAGTAATCTAGAGATGG - Intronic
1095330751 12:40959726-40959748 TAATATAATTGAGATTGTGATGG + Intronic
1095454645 12:42370214-42370236 GATTCTGATTCAGCTGGTGAGGG + Intronic
1095639894 12:44475859-44475881 TTTTATAGTTCAGCTTGAGAAGG - Intergenic
1097509830 12:60524538-60524560 TAATATAATTAAGATATTGAAGG + Intergenic
1098373792 12:69790382-69790404 AATTATAATACAGTTAATGAAGG + Intronic
1098937015 12:76491583-76491605 TATTATAATACATGTAGTCAAGG - Intronic
1100219815 12:92492918-92492940 TTTTATATTTCATCTAGTGGAGG - Intergenic
1100642553 12:96496147-96496169 TATTATTAATCAGTTTGTGAAGG + Intronic
1101537766 12:105635118-105635140 TATTATAAGTAATCTAGAGATGG - Intergenic
1101570884 12:105952696-105952718 TATTATAAGTAATCTAGAGATGG + Intergenic
1102106852 12:110332405-110332427 TAATATAATTAAGCTAGTTAGGG + Intronic
1103424573 12:120821541-120821563 AATTATAATACAGCTTTTGAAGG + Intronic
1104296327 12:127517935-127517957 TAATATAATTCAGATAGTGTTGG + Intergenic
1105590240 13:21785854-21785876 TATTATAATTCAGCATGTTGAGG + Intergenic
1106980772 13:35277091-35277113 TGTAAAAATTCAGCTAGTTATGG + Intronic
1110986255 13:81973683-81973705 TATTATAATTCTCAAAGTGATGG + Intergenic
1111946319 13:94669310-94669332 TATTATAATTCAGCTATCTGGGG - Intergenic
1117429071 14:55634231-55634253 TATTAAAAATCAGCCAGTCAGGG - Intronic
1118463158 14:66004955-66004977 TATTATAAGTAATCTAGAGATGG + Intergenic
1119136306 14:72224067-72224089 TATTGTATTTCAGCTGTTGACGG - Intronic
1119487943 14:75004011-75004033 TATAAAAATTCAGATAGTGAAGG - Intronic
1120051840 14:79876262-79876284 TATTATAAGTAATCTAGAGATGG - Intergenic
1120803272 14:88717271-88717293 TATTCAAGTTCAGCTTGTGACGG + Intronic
1122336527 14:100992102-100992124 TATTATAATTCAATCAATGAAGG + Intergenic
1123962460 15:25418993-25419015 TATTATAAGTAATCTAGAGATGG - Intronic
1126548851 15:49904658-49904680 TATTATACATCAGGGAGTGATGG - Intronic
1131244694 15:90780844-90780866 TATTATAAGTAATCTAGAGATGG + Intronic
1131561814 15:93450312-93450334 TATTATAAGTAATCTAGAGATGG - Intergenic
1133143528 16:3766252-3766274 TACCAAAATTCAGCCAGTGAAGG - Intronic
1134041205 16:11069853-11069875 TATTATAAGTAATCTAGAGATGG + Intronic
1135690280 16:24531233-24531255 TATAATAATTCAGCTGGGTATGG - Intergenic
1139096789 16:63714336-63714358 TAGTATAATACAGCTGGTGAAGG + Intergenic
1140536820 16:75717493-75717515 TATTGTAAGTCATCTAGAGATGG - Intronic
1143442011 17:6982314-6982336 TATTATAAGTAATCTAGAGATGG - Intronic
1143881344 17:10032365-10032387 TATTTTTATTCTGCTAGGGAAGG - Intronic
1144174821 17:12694992-12695014 TAATAAAAATCAGCTAATGAAGG + Intronic
1144424240 17:15126460-15126482 TTTTGTCATTCACCTAGTGAGGG - Intergenic
1146776957 17:35628137-35628159 TATTATAAATAATCTAGAGATGG + Intronic
1146829928 17:36059683-36059705 TCTTACAATCCAGATAGTGAAGG - Intergenic
1156650549 18:39221329-39221351 TACTATAATTAAGATAATGAAGG + Intergenic
1158812638 18:61055635-61055657 TATTATAACTCAGCTAAATATGG - Intergenic
1160214696 18:76918379-76918401 TATTATAAGTGATCTAGAGATGG - Intronic
1163864414 19:19760681-19760703 TGTTGTAATTCAGCCAGTTATGG - Intergenic
925460717 2:4060366-4060388 TGCTATAATTCACCTAGTGGGGG - Intergenic
925638268 2:5963359-5963381 TATTATAATACAGCTAAAAAGGG - Intergenic
930243549 2:48960196-48960218 TATTATAATACAGGAAGTGTAGG + Intergenic
930721016 2:54638134-54638156 ACTTAAAATACAGCTAGTGATGG - Intronic
932357626 2:71079296-71079318 TACCATAGTTCAGCCAGTGAAGG + Intronic
932370084 2:71179548-71179570 TACCATAGTTCAGCCAGTGAAGG + Intergenic
933267814 2:80201085-80201107 TATTTTAATTAATCTAGAGATGG - Intronic
933818573 2:86089060-86089082 TATTATAATTGAGAAACTGAAGG - Intronic
934147125 2:89106203-89106225 TATTATAAGTAGGCTAGAGATGG - Intergenic
934222144 2:90094391-90094413 TATTATAAGTAGGCTAGAGATGG + Intergenic
934911608 2:98261840-98261862 CATTATAATTAAACTATTGAAGG - Intronic
936981832 2:118271962-118271984 TAGTAGAATTCAACCAGTGAAGG + Intergenic
940331884 2:152484146-152484168 TGTTATAATTCAGCATGGGAGGG - Intronic
942827703 2:180199936-180199958 TGTTATAAATCAGTGAGTGATGG - Intergenic
942898004 2:181081113-181081135 GATTCTAATTCAGCAGGTGAGGG + Intergenic
942919326 2:181352149-181352171 TATAATAATTCACCTAATCATGG + Intergenic
945410563 2:209501399-209501421 TATTATAAATCATATTGTGATGG - Intronic
946502429 2:220263675-220263697 TATTAGAAGTCATCTAGTTAGGG + Intergenic
948318433 2:237048594-237048616 TATTATAATTTTTCTATTGATGG - Intergenic
948360427 2:237416398-237416420 TATTATAAGTAATCTAGAGATGG + Intergenic
1168850991 20:977010-977032 TATTGTATTTCAGATACTGAGGG + Intronic
1169778356 20:9280881-9280903 TATTATAGTTCAGCAAAGGAAGG + Intronic
1170336776 20:15278748-15278770 TATTATAATATTGCTATTGAAGG - Intronic
1171196894 20:23206844-23206866 GCTTCTAATTCAGCTAGTGTTGG + Intergenic
1173136173 20:40441134-40441156 TATTATACTTCAGCCAGTCTGGG - Intergenic
1174193255 20:48755040-48755062 AATTATAAATCAGATATTGAAGG - Intronic
1174571208 20:51503039-51503061 CATTATAATTCTGATAATGACGG + Intronic
1174732538 20:52931645-52931667 TATTATAAACCATCTAGAGATGG - Intergenic
1176961236 21:15161353-15161375 TTTTAGAATTCAGCAGGTGAGGG + Intergenic
1179584957 21:42368592-42368614 TATTATAACTAACCTAGAGATGG - Intergenic
1179768188 21:43590583-43590605 TGTATTCATTCAGCTAGTGATGG - Intronic
949157326 3:845120-845142 TATTATATTTCATATAGTAAAGG - Intergenic
949619274 3:5792003-5792025 TATTATCATTCAGTTTCTGAGGG + Intergenic
949629061 3:5902512-5902534 TTTTGTAAATCAGCTTGTGAAGG - Intergenic
952521755 3:34167399-34167421 TATTTTTATGCAGCTATTGATGG - Intergenic
953124765 3:40080209-40080231 TAATATAATTCACCAAGTTAAGG - Intronic
955635486 3:61024201-61024223 TCTTAAAAATCTGCTAGTGAGGG + Intronic
957281542 3:78156327-78156349 TATTATTATTAAGCTACTCAAGG + Intergenic
957977906 3:87470820-87470842 TATTATTTTTCTTCTAGTGAAGG + Intergenic
958146019 3:89625930-89625952 TATGATTATTCAGCAAGTGAAGG - Intergenic
959663783 3:108898992-108899014 TATTATCATCCAGCTGCTGATGG - Intergenic
960393614 3:117109240-117109262 TATTTTGATTAAGGTAGTGAGGG - Intronic
960631948 3:119741299-119741321 TATTGTATTTCAGTTAGTGAGGG + Intronic
963129364 3:141843994-141844016 TATTATAACATAGCTAGTCAGGG + Intergenic
963444813 3:145391242-145391264 TATTATAAGTGATCTAGAGATGG + Intergenic
964275735 3:155007019-155007041 TATTATAAGTAATCTAGAGATGG + Intergenic
965375610 3:167919779-167919801 TATGCTAAGTCAGCTAATGATGG - Intergenic
965902251 3:173656654-173656676 GATTTTAATTCAGATAGTGGTGG - Intronic
971752846 4:30673577-30673599 TATTATAACTCAGGTATTAAGGG + Intergenic
972020882 4:34311909-34311931 GGTTATAATTCAGATAGTCAAGG - Intergenic
975894196 4:79066965-79066987 TATTATAAGTAATCTAGAGATGG - Intergenic
976992682 4:91387509-91387531 TATTATACTTTAGCTTATGAAGG + Intronic
978065401 4:104393334-104393356 TATTATAGTTAAGGTAGTGTAGG + Intergenic
979228127 4:118313888-118313910 TATTATAATTCTGATTTTGATGG - Intronic
983758069 4:171366993-171367015 TAGTAAAATTCAGTTGGTGATGG - Intergenic
984202781 4:176746532-176746554 TATTATTATTCAGCAAATAATGG - Intronic
984806117 4:183753456-183753478 TATTATAACTCATTTAGAGAGGG + Intergenic
984868043 4:184299945-184299967 TTTTGTAATTCTGCTAGAGACGG + Intergenic
986082901 5:4412726-4412748 TATTATAATGCAGGTACTGAAGG + Intergenic
986218607 5:5745494-5745516 TAGAATAATTCAGATAGTAATGG - Intergenic
986390146 5:7277945-7277967 AATTATAATTCAGCCAGGCACGG + Intergenic
986775827 5:11012958-11012980 TATTAGAATTCAGCATGTGATGG + Intronic
987515348 5:18900371-18900393 TTTTATAATTCAGAAAATGAAGG - Intergenic
987549108 5:19355575-19355597 TATTATAATTCCCCTAGAGTTGG - Intergenic
988072742 5:26315261-26315283 TATTAAAATTCAACTAAAGATGG - Intergenic
989039606 5:37213857-37213879 TATTATAATTCAGCTTGTATTGG - Intronic
990763808 5:59160470-59160492 TTTTTTAATGCAGCTAATGAAGG - Intronic
993528331 5:88994106-88994128 TATTATACTTTAACTAGTCAAGG - Intergenic
996512105 5:124328303-124328325 CTTAATAACTCAGCTAGTGAGGG - Intergenic
1000780804 5:165478440-165478462 AACTATAACTCAGCAAGTGAAGG + Intergenic
1004808385 6:19229923-19229945 TATGATAATTGATGTAGTGATGG - Intergenic
1006238226 6:32654527-32654549 TATTATAAGTAATCTAGAGATGG - Intergenic
1009801313 6:68540151-68540173 TTTTATAATTCACCTTTTGATGG - Intergenic
1010284351 6:74058128-74058150 TATTATAATGGAGCTAGTTCAGG - Intergenic
1010859661 6:80892980-80893002 TATTTTAATTCCCCTTGTGAGGG - Intergenic
1011176512 6:84567171-84567193 TATTATAATGAAGACAGTGATGG - Intergenic
1012270719 6:97206946-97206968 TATTTTATTTCAGTTAATGATGG - Intronic
1012582264 6:100883283-100883305 TATTATAAGTAACCTAGAGATGG + Intergenic
1012914230 6:105151337-105151359 TATTATAAGTAATCTAGAGATGG - Intergenic
1014521710 6:122451481-122451503 TCTTATAATTTTGTTAGTGATGG + Intronic
1015061046 6:128966956-128966978 CCTCATAATACAGCTAGTGAAGG + Intronic
1015782780 6:136887227-136887249 AATTATAATATAGCTAGTAATGG - Intronic
1015931155 6:138361109-138361131 TTTTATAATTCAGTGAATGAGGG + Intergenic
1020394796 7:7702022-7702044 TATTGAAATTCAGATAGAGAAGG + Intronic
1024467964 7:49733437-49733459 TGTTAGAATTCAGTTTGTGATGG - Intergenic
1026348647 7:69496584-69496606 TTTTATAATTAAGCTAGTTTAGG + Intergenic
1028809595 7:95069029-95069051 TATTATAAGTAATCTAGAGATGG - Intronic
1034788450 7:153946456-153946478 CATTATAATTCAAGCAGTGAGGG + Intronic
1037110302 8:15157778-15157800 TAGCATAGTTCAGCTAGTGGAGG - Intronic
1037172648 8:15911730-15911752 TATGATGTTTCAGTTAGTGATGG + Intergenic
1037400374 8:18489806-18489828 TGTTAAAATTCAGCTATTGCAGG - Intergenic
1038090570 8:24248477-24248499 TATTAGAATTCAGGTAGGGGAGG - Intergenic
1039393407 8:37201657-37201679 TATTATAAGTAATCTAGAGATGG + Intergenic
1040731389 8:50451633-50451655 TATTCTAATTCAGCCAGTTTGGG + Intronic
1042302104 8:67295232-67295254 TATTAAAACTGAGCAAGTGAGGG + Intronic
1042383615 8:68148498-68148520 TATGATTATTCAGCTATTTATGG - Intronic
1043075130 8:75689393-75689415 TATGATTATTAATCTAGTGATGG - Intergenic
1044620702 8:94188204-94188226 TATTATAAATAATCTAGAGATGG - Intronic
1044732740 8:95243908-95243930 TATTATAATTCATACAGTTAAGG + Intergenic
1047212729 8:122853187-122853209 CTTTATAACTCACCTAGTGATGG - Intronic
1048716335 8:137274571-137274593 TATTAAAATTCACCAACTGATGG + Intergenic
1049921669 9:370392-370414 TTTTATAATTCAGGGACTGAGGG + Intronic
1050786340 9:9407118-9407140 TATTATAAATCAGGTAATGAGGG - Intronic
1051102569 9:13538184-13538206 TATCATAATTAAGCTACTAAAGG - Intergenic
1055403721 9:75951823-75951845 TATTATAAGTAATCTAGAGATGG + Intronic
1055739842 9:79375854-79375876 TATTATAAGTAATCTAGAGATGG + Intergenic
1055880779 9:81000817-81000839 TGTTAGAATTCAGTTAATGATGG + Intergenic
1056241742 9:84654676-84654698 AAATATAATTCAGCTTCTGAGGG - Intergenic
1057638049 9:96789407-96789429 TGTTATGTTCCAGCTAGTGAGGG - Intergenic
1058852786 9:109028614-109028636 TTTTTTAAGTCAGCTAATGAGGG - Intronic
1059368931 9:113809234-113809256 TATCATCATTCAGCCAGTAAAGG - Intergenic
1061526963 9:131173739-131173761 TATTATTATTATACTAGTGAGGG + Intronic
1185717599 X:2355074-2355096 TGCTATAATTGAGATAGTGAAGG - Intronic
1186491486 X:9976955-9976977 TATTATAAGTAATCTAGAGATGG + Intergenic
1186564912 X:10652189-10652211 TATTATAATTCAGCTAGTGATGG - Intronic
1186990524 X:15062187-15062209 TATTATAAATTAGCAAGTCAAGG + Intergenic
1187799354 X:23043100-23043122 TATTTTCATTCAGCTCTTGATGG + Intergenic
1187994230 X:24908045-24908067 TATTATAATTTAGCTATTATTGG - Intronic
1188527090 X:31098517-31098539 TATTATAATTCCCCTATTGTTGG + Intronic
1188594536 X:31882206-31882228 TATTATAATTAAGCCTGTGTGGG + Intronic
1188843725 X:35047513-35047535 TGCTATAATTAAGTTAGTGAAGG - Intergenic
1190101417 X:47525254-47525276 TATTATAAGTTATCTAGAGATGG - Intergenic
1192293392 X:69821577-69821599 TATTAAAGTTAAGCTAATGAAGG - Intronic
1195162597 X:102185236-102185258 GATTCTCATTCAGCTAGTTAGGG - Intergenic
1196178286 X:112664090-112664112 TATTATAAGTAATCTAGAGATGG - Intronic
1196199758 X:112872180-112872202 TATTATACTCCAACTAGTAATGG + Intergenic
1198257725 X:134939407-134939429 TATTATAAGTAATCTAGAGATGG - Intergenic
1198746101 X:139892206-139892228 TTTCATAATTAAGCTACTGAAGG + Intronic
1199370241 X:147039484-147039506 TGTTATAATTAACCAAGTGATGG + Intergenic
1200329546 X:155282064-155282086 TGTCATAATTGAGCGAGTGAGGG - Intronic