ID: 1186565015

View in Genome Browser
Species Human (GRCh38)
Location X:10653016-10653038
Sequence TTCAGTTTATATTCTAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 7, 3: 69, 4: 462}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186565015_1186565021 11 Left 1186565015 X:10653016-10653038 CCTCCATTAGAATATAAACTGAA 0: 1
1: 0
2: 7
3: 69
4: 462
Right 1186565021 X:10653050-10653072 ACTCATTTAATTGACTTTTGTGG 0: 1
1: 0
2: 0
3: 26
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186565015 Original CRISPR TTCAGTTTATATTCTAATGG AGG (reversed) Intronic
902228664 1:15013308-15013330 TTTCGTTTATATTCGAGTGGGGG + Intronic
903488248 1:23707557-23707579 TGGAGCTTACATTCTAATGGAGG + Intergenic
903726248 1:25447950-25447972 TTCGGCTTATGTTCTATTGGCGG + Intronic
904220708 1:28966507-28966529 TGGAGTTTACATTCTAGTGGGGG + Intronic
904626219 1:31805305-31805327 CTCAGTTTATATTTTTTTGGTGG - Intronic
905139038 1:35826438-35826460 TGAAGTTTATATTCTAGTGAGGG - Intronic
906874740 1:49525191-49525213 TGGAGTTTATATTGTATTGGAGG + Intronic
907063981 1:51461188-51461210 TTCAGTTCATGTTCTACTCGAGG + Intronic
907785949 1:57612793-57612815 TACAGTTTACATTCTAGTTGGGG - Intronic
908218899 1:61983748-61983770 TGGAGTTTATATTCTAGGGGAGG + Intronic
908497842 1:64712867-64712889 TGGAGCTTATATTCTAGTGGGGG + Intergenic
908625768 1:66040023-66040045 TCCAGTTTGGATGCTAATGGAGG - Intronic
909219049 1:72930932-72930954 TGAAGCTTATGTTCTAATGGAGG - Intergenic
909250912 1:73355069-73355091 GTCAGTTTATATTCTAAGCCTGG - Intergenic
909501931 1:76344498-76344520 TAGAGTTTACATTCTAGTGGTGG - Intronic
909571990 1:77124204-77124226 TTTAGTTTATTTTTTAATTGAGG - Intronic
909714134 1:78686972-78686994 TTCATTTTATACTATAATGAGGG - Intergenic
909856093 1:80533960-80533982 TTCAGTTGCAATTCTAAAGGAGG + Intergenic
909929088 1:81474278-81474300 TGGAGCTTAAATTCTAATGGGGG - Intronic
909936844 1:81561245-81561267 TTGAGCTTAAATTCTAGTGGGGG - Intronic
910200788 1:84696347-84696369 CTGAGTTTATATTCTAGTGGAGG - Intergenic
910269320 1:85376347-85376369 TTCAGTTAATATCTAAATGGGGG - Intronic
910306284 1:85767948-85767970 TGAAGTTTACATTCTAGTGGAGG + Intronic
910973801 1:92884535-92884557 TTCAGTTAAGATTCTGATGCTGG - Intronic
911152353 1:94607893-94607915 AGGAGTTTATATTCTAATGGAGG - Intergenic
911274474 1:95844282-95844304 TGGAGTTTATATCCTAATTGGGG - Intergenic
911669311 1:100590640-100590662 TGGAGTTTATAATTTAATGGAGG + Intergenic
911687111 1:100790238-100790260 TGAAGTTTGTATTCTAATAGAGG + Intergenic
912236601 1:107858145-107858167 TTTAGTTTAAATTCTGGTGGTGG - Intronic
913312218 1:117511839-117511861 TGTAGTTTATATTCTAATTGGGG - Intronic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914280623 1:146168260-146168282 TGGAGTTTACATTCTAATAGCGG + Intronic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914541666 1:148619200-148619222 TGGAGTTTACATTCTAATAGCGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
914624972 1:149452047-149452069 TGGAGTTTACATTCTAATAGCGG - Intergenic
915865941 1:159499345-159499367 ATCTGCTTATAGTCTAATGGTGG + Intergenic
915921148 1:159976387-159976409 TTCTTTTTATATACAAATGGAGG - Intergenic
916127433 1:161583783-161583805 TTGAATTTATATTCTACTGAGGG + Intronic
916137351 1:161665587-161665609 TTGAATTTATATTCTACTGAGGG + Intronic
916143333 1:161718817-161718839 TGGAGCTTACATTCTAATGGGGG + Intergenic
917155887 1:171998610-171998632 TAGAGCTTGTATTCTAATGGGGG + Intronic
917341383 1:173982004-173982026 TTCAGTTTATATGGTAATGCTGG - Intronic
917454160 1:175171322-175171344 TGGAGCTTATGTTCTAATGGAGG - Intronic
917844398 1:179008369-179008391 TACAGCTTATATTCCAATGGGGG + Intergenic
917866118 1:179197455-179197477 TTGAGTTTATAGTCTTTTGGTGG - Intronic
918045992 1:180941334-180941356 TTCACTTTTCATTCTGATGGTGG - Intronic
918278023 1:182973361-182973383 TGGGGTTTATGTTCTAATGGAGG + Intergenic
918479260 1:184960570-184960592 TACAGCTTACATTCTAGTGGTGG + Intronic
918933545 1:190890035-190890057 TTCAGTTTATTTTCCATGGGAGG - Intergenic
919232190 1:194788055-194788077 TTCAGGTTTTATTATTATGGTGG - Intergenic
919472904 1:198000798-198000820 TTTAGTTTATTTGCTAATGCAGG - Intergenic
919834627 1:201565391-201565413 GTCAGTTTCTCTTCTGATGGCGG - Intergenic
920065330 1:203265593-203265615 TTCAGCTTTTATTCTATTAGCGG + Intronic
921391017 1:214613709-214613731 TTCAGTTTATTTACAAATGTTGG + Exonic
922987089 1:229874254-229874276 TTCTGGATATATTCTAAAGGTGG + Intergenic
923122939 1:231010387-231010409 CTCTATTTGTATTCTAATGGTGG + Intergenic
923336116 1:232971645-232971667 TGGAGCTTACATTCTAATGGAGG + Intronic
923424919 1:233859230-233859252 ATCAGCTGATAGTCTAATGGGGG + Intergenic
1064047240 10:12028169-12028191 TTCATTTAAAATTCTAAAGGAGG - Intronic
1065097849 10:22299589-22299611 TTAAGTTCATATTCTAATGTGGG + Intergenic
1065742312 10:28808129-28808151 TCAAGTTTACATTTTAATGGAGG - Intergenic
1067150596 10:43729456-43729478 CTCAGGTTCTATTCTAGTGGTGG + Intergenic
1067163759 10:43848666-43848688 TTGAGCTTACGTTCTAATGGGGG + Intergenic
1068016003 10:51516848-51516870 TTGAGCTTATATTTTAGTGGGGG + Intronic
1068851130 10:61742303-61742325 TTGAGTTTATAGTCTAATGTGGG - Intronic
1069055718 10:63842763-63842785 TTCAGCTTATATTCTAGTGAAGG + Intergenic
1069123976 10:64606222-64606244 GTCAGTTCATATTCAAAGGGTGG + Intergenic
1069404023 10:68078996-68079018 ATGAGTTTTCATTCTAATGGAGG - Intergenic
1069806351 10:71127375-71127397 TGCAATTTTTATTCTAGTGGGGG + Intergenic
1069893267 10:71665144-71665166 TAAAGCTTATATTCTAGTGGTGG + Intronic
1070036149 10:72726467-72726489 TTCAGCTGATATTTTACTGGTGG + Intronic
1070391687 10:75976493-75976515 TGGAGTTTATACTCTACTGGGGG - Intronic
1071047805 10:81404426-81404448 TATAGTTTATATTATAATGAGGG + Intergenic
1071712935 10:88067542-88067564 TAGAGCTTATATTCCAATGGAGG + Intergenic
1072152447 10:92694404-92694426 TTCAGTTTATAATCTTATTCAGG - Intronic
1072338440 10:94422066-94422088 TTTAGTTTGTATTTTAATAGGGG + Intronic
1073689480 10:105791970-105791992 TTATGATTATATTCTGATGGTGG - Intergenic
1073791508 10:106944744-106944766 GCGAGTTTATATTTTAATGGTGG + Intronic
1074622103 10:115136534-115136556 TTCTGTTGATACTATAATGGTGG - Intronic
1074848992 10:117423687-117423709 TGCAGCTGACATTCTAATGGGGG + Intergenic
1076236294 10:128865700-128865722 TTGAGTTTGTATGCTAAAGGAGG - Intergenic
1077127322 11:946837-946859 TTCAGTATGTATTATAAGGGAGG - Intronic
1078216470 11:9315901-9315923 TAAAGCTTATATTCTAAAGGTGG - Intergenic
1078663147 11:13303331-13303353 TTCAGCTTATATTCTAACTTGGG + Intronic
1078836769 11:15037715-15037737 TGAAATTTATATTCTAATAGAGG + Intronic
1079867117 11:25750264-25750286 TTCATATCATACTCTAATGGTGG - Intergenic
1079978307 11:27120923-27120945 TATAGCTTATACTCTAATGGGGG + Intronic
1080145177 11:28973722-28973744 TTCATTTTATAATCTACTGCTGG + Intergenic
1080165810 11:29234854-29234876 TGGAGTTTATATTCTAATTGTGG - Intergenic
1080932851 11:36830811-36830833 TTGAGCTTACATTCTAGTGGAGG + Intergenic
1081075031 11:38661543-38661565 TTCAGTTTATGATGGAATGGGGG - Intergenic
1081335441 11:41859982-41860004 TTCAGGTGATATTGAAATGGAGG + Intergenic
1081632375 11:44698604-44698626 TTCAGTATATATTCAAAGTGTGG + Intergenic
1081736021 11:45404861-45404883 CTCAGTTTATATTCTAGTAGGGG - Intergenic
1081757651 11:45556128-45556150 TGGAGTTTACATTCTAATGCAGG + Intergenic
1081764582 11:45600735-45600757 TGGAGCTTATATTCTAGTGGGGG - Intergenic
1082115203 11:48320590-48320612 TGGAGTTTATATTCTAAAAGGGG - Intergenic
1082555621 11:54559705-54559727 TTGATTTTATATTAAAATGGAGG + Intergenic
1084435973 11:69140076-69140098 TTCAATTTCTGTTCTTATGGTGG + Intergenic
1085422927 11:76379760-76379782 TGAAGATTACATTCTAATGGGGG - Intronic
1085438239 11:76530466-76530488 TTCAGTTTTTATTCTAAGAATGG + Intronic
1086097898 11:83068924-83068946 TGGAGCTTATATTCTAATAGGGG - Intronic
1086613923 11:88791649-88791671 TTCAGTATATATTGTAATGTTGG - Intronic
1086901112 11:92368688-92368710 CTCAGGTTATATTCATATGGTGG + Intronic
1087291544 11:96326100-96326122 TGGAGTTTACATTTTAATGGGGG - Intronic
1087586939 11:100133715-100133737 TTCAGATTATATGGTAAAGGGGG - Intronic
1087946530 11:104166145-104166167 TTGAGTTTACATTATAATAGAGG + Intergenic
1088041160 11:105383517-105383539 TTGAGTTTACATTCTAGTGAAGG + Intergenic
1088536821 11:110870530-110870552 TGGAATTTATATTCTGATGGAGG + Intergenic
1088677844 11:112213482-112213504 TATAATTTATATTCTAGTGGAGG - Intronic
1089316595 11:117595459-117595481 TTCATTTTATATTCCAATGAGGG + Intronic
1089608942 11:119658713-119658735 CTCAGTTTATATCCCACTGGGGG + Intronic
1090698336 11:129271309-129271331 TTCGGTTTATATTATAAAGGTGG + Intronic
1090746798 11:129712126-129712148 ATCAATTTATATTCACATGGTGG - Intergenic
1091874488 12:3922460-3922482 ATTAGTTTAGATTCTACTGGAGG - Intergenic
1092149964 12:6241101-6241123 TTCATTTTATATAGGAATGGAGG + Intergenic
1092667981 12:10827088-10827110 TGGAGTGTATATTCTAATGAGGG + Intronic
1092792745 12:12083992-12084014 GTCACCTTATATTCTAAAGGTGG + Intronic
1092894343 12:12998645-12998667 TTCAGATTAGAGTCTAATTGAGG + Intronic
1092972348 12:13708921-13708943 TAAAGCTTAAATTCTAATGGTGG + Intronic
1093074661 12:14745541-14745563 TTCTGTGTATTTTATAATGGAGG - Intergenic
1093149119 12:15601157-15601179 TCTAGTTTACATTCTAATAGGGG + Intergenic
1093403362 12:18775292-18775314 TAAAGTTTAAATTCTAGTGGAGG - Intergenic
1094724067 12:33094349-33094371 TTCAGTTTATTTTCTGGTTGTGG + Intergenic
1095214439 12:39531143-39531165 TTGAGCTTACATTCTAGTGGGGG + Intergenic
1095232712 12:39760699-39760721 TGGAGTTTACATTCTAGTGGAGG - Intronic
1095577978 12:43760839-43760861 TGGAGTTTATATTCTAATGGAGG - Intronic
1096350407 12:50894313-50894335 GTGAGGTTATATTCTCATGGTGG - Intergenic
1096804708 12:54133524-54133546 TTCATGTTTTATGCTAATGGAGG - Intergenic
1097473119 12:60020886-60020908 TTCAGTTTTTTTTCTTATGTGGG - Intergenic
1098267713 12:68739310-68739332 TGAAGGTTATATTCTAATGAGGG - Intronic
1098762693 12:74445395-74445417 TTAAGCTTATATTCTGGTGGAGG + Intergenic
1098823590 12:75265155-75265177 TGGAGCTTACATTCTAATGGGGG - Intergenic
1099006152 12:77236815-77236837 TTCAGTACATATACTAGTGGAGG - Intergenic
1100118792 12:91343681-91343703 TACATTTTATATTCTTATGTTGG - Intergenic
1100316888 12:93452854-93452876 TTGAGCTTACATTCTAATAGGGG + Intergenic
1101494320 12:105239200-105239222 TGGAGTTTATATTCTAATGGAGG + Intronic
1101749795 12:107574140-107574162 TTCAGTTTTTATCATAAAGGTGG - Intronic
1102836556 12:116067451-116067473 TTCATCCTATATTCTGATGGGGG - Intronic
1105407465 13:20144111-20144133 TTCTGTTTCTATCCTAATAGTGG - Intronic
1106211849 13:27656501-27656523 TGGAATTTATAATCTAATGGGGG + Intronic
1106955173 13:34929628-34929650 TGTAGCTTATATTCTAATAGAGG - Intergenic
1107532554 13:41297919-41297941 TGCAGTTTATATTGTCATAGAGG - Intergenic
1107881667 13:44837463-44837485 TGGAGCTTATATTCTACTGGAGG - Intergenic
1108115037 13:47118305-47118327 TGGAGCTTACATTCTAATGGGGG + Intergenic
1108254003 13:48593521-48593543 TTCACTTTATATTCTTCTGGAGG - Intergenic
1108272346 13:48773887-48773909 TGGAGTATTTATTCTAATGGAGG + Intergenic
1109037927 13:57289683-57289705 TTCAGTTTAGAGTGTGATGGAGG - Intergenic
1109375948 13:61493441-61493463 AGCAGCTTATATTCTAATGCGGG - Intergenic
1110481778 13:75986580-75986602 TCAAGTTTACATTCTAATAGGGG - Intergenic
1110558914 13:76888876-76888898 TGGAGTTTATATTCTGATGTAGG - Intergenic
1110865315 13:80387870-80387892 TTCAGTTTTTTTCCTCATGGAGG + Intergenic
1111270457 13:85875410-85875432 TTCATTTTATCTTCTAAGTGAGG + Intergenic
1114564600 14:23620971-23620993 ATCAGCTTATAGTCTAATGGAGG - Intergenic
1115457955 14:33626727-33626749 TGGAGTTTATATTCCAGTGGAGG + Intronic
1116122003 14:40732451-40732473 ATTAATTTATAATCTAATGGAGG + Intergenic
1116459104 14:45150815-45150837 TATAGTTTACATTCCAATGGAGG - Intronic
1116823766 14:49651609-49651631 TACAGTTTACATTCTAGTAGGGG + Intronic
1117047916 14:51831316-51831338 TGCAGATTATATACTACTGGGGG - Intronic
1117331925 14:54721151-54721173 TAGAATTTATATTCTAGTGGGGG - Intronic
1117428427 14:55625563-55625585 TTAATTTTATAGTTTAATGGTGG + Intronic
1117950346 14:61076524-61076546 TTCAGTTTCTATTCTTAGGATGG - Intronic
1118058579 14:62109638-62109660 TTCTGTTTAGATTCCAATGGAGG - Exonic
1118683852 14:68271184-68271206 TGTAGTTTACATTCTAGTGGTGG - Intronic
1118858170 14:69640055-69640077 TTTAGTTTATAGTTTAGTGGGGG + Intronic
1120138724 14:80902204-80902226 ATAAGTTTATATTCTAGAGGAGG - Intronic
1120338956 14:83194318-83194340 TACAACTTATATTCTATTGGTGG + Intergenic
1120502537 14:85314434-85314456 TAAAGTTAATATTCTAATGGCGG + Intergenic
1120536943 14:85708065-85708087 TCGAGCTTATATTCTAGTGGAGG + Intergenic
1120617664 14:86727758-86727780 TTAACTTTACATTCTAATTGAGG - Intergenic
1120761430 14:88289017-88289039 GGAAGTTTATATTCTAATGAGGG - Intronic
1121457207 14:94046101-94046123 TTTAGTATTTATTTTAATGGAGG + Exonic
1122581336 14:102773584-102773606 TTCTGTTTATTTTTTAATGGTGG - Intergenic
1123958023 15:25360909-25360931 TTGAGTTTCTATTCTAATAAAGG - Intronic
1124814040 15:32970393-32970415 TGGAGTTTATAATCTCATGGGGG - Intronic
1125148249 15:36498820-36498842 TTCAGTTATTATTATAATGTAGG + Intergenic
1125225746 15:37393964-37393986 TACAGCTTATATTCTTTTGGGGG + Intergenic
1126713435 15:51486423-51486445 TACCATTTATATCCTAATGGTGG + Intronic
1128035134 15:64518084-64518106 TGGAGTTTATATTCTAATGTGGG + Intronic
1128462640 15:67882823-67882845 TGGAATTTACATTCTAATGGGGG + Intergenic
1128477483 15:68009648-68009670 TTCAGTATAGAGTCTATTGGAGG - Intergenic
1129656989 15:77530907-77530929 TAGAGTTTATATTCTAATGCAGG - Intergenic
1130203872 15:81857958-81857980 TTCAGTTTTTTTTCTAATTGTGG - Intergenic
1130343194 15:83016794-83016816 TTCACTTTATATTGTAAAGAAGG - Exonic
1130644182 15:85709321-85709343 TGGAGCTTATATTCTAGTGGGGG - Intronic
1131492897 15:92878281-92878303 TGGAGTTTATATTCTAGAGGGGG - Intergenic
1133635412 16:7660572-7660594 CCTAGGTTATATTCTAATGGAGG - Intronic
1134560983 16:15209306-15209328 TTCAGAATATATTCTAATGAAGG - Intergenic
1134614680 16:15642275-15642297 TGGAGTTTATAGCCTAATGGGGG - Intronic
1134788546 16:16967081-16967103 TGGAGTTTATGTTCTAGTGGGGG + Intergenic
1134848058 16:17457824-17457846 TTCTGTTTATTTTTTAATGGAGG - Intronic
1134921520 16:18120926-18120948 TTCAGAATATATTCTAATGAAGG - Intergenic
1135189040 16:20339769-20339791 CACAGCTTATATTCTAAAGGGGG - Intronic
1137706868 16:50541579-50541601 TGAAGTTTATATTCTCATAGAGG - Intergenic
1137905798 16:52320658-52320680 TGGAGCTTACATTCTAATGGAGG - Intergenic
1138712350 16:58983561-58983583 TTCAATTTATATTTTCTTGGAGG - Intergenic
1138885276 16:61069558-61069580 TTGAATTTATATTCTAATGAAGG + Intergenic
1139376738 16:66503446-66503468 TGGAGCTTATCTTCTAATGGGGG - Intronic
1140023162 16:71259052-71259074 TGGAGTTTACTTTCTAATGGAGG + Intergenic
1140055735 16:71523986-71524008 TTGAGTTTCTTTTCTTATGGGGG - Intronic
1141057415 16:80831523-80831545 TTGAGCTTATATTCTAGTAGAGG + Intergenic
1143011178 17:3867025-3867047 TACAGCTTATATTCTAGTTGGGG + Intronic
1144607610 17:16681511-16681533 TTAAGCTTAAATTCTAATGAGGG + Intergenic
1144933156 17:18876596-18876618 TGGAGTTTATATTCCAGTGGAGG + Intronic
1145098347 17:20051695-20051717 TTGAGTTTATAATCTAGTGGGGG + Intronic
1145197224 17:20904601-20904623 TTAAGCTTAAATTCTAATGAGGG - Intergenic
1146410553 17:32580067-32580089 GTCATTTTATATTATCATGGTGG - Intronic
1146414869 17:32622419-32622441 TGGAGTCTATGTTCTAATGGGGG + Intronic
1147345259 17:39788158-39788180 TGGAGTTTATATTTTACTGGGGG - Intronic
1148290428 17:46443351-46443373 TTCAGTAAAAATTCTTATGGCGG - Intergenic
1148312596 17:46660924-46660946 TTCAGTAAAAATTCTTATGGCGG - Intronic
1148515007 17:48208549-48208571 TTCATTTTATATACAAATTGAGG - Intronic
1149337553 17:55652012-55652034 TTCATTTTAAATACTAATAGAGG + Intergenic
1151084088 17:71361044-71361066 TAGAGTTTTTATTCTAGTGGTGG - Intergenic
1151288894 17:73134244-73134266 TAGAGTTTATCTTCTAAGGGAGG - Intergenic
1151313143 17:73306540-73306562 ATCAGATTATATTTTATTGGGGG - Intronic
1153099369 18:1448634-1448656 TCCAATTAATATTCTACTGGGGG - Intergenic
1154292482 18:13121918-13121940 TTCAGTTTCTTTGATAATGGTGG + Intronic
1156168061 18:34448188-34448210 TTAAGCTTTTATTCTAATGAAGG + Intergenic
1156923534 18:42552332-42552354 ATAAGTTTATAATCTAATGGTGG - Intergenic
1157160179 18:45306925-45306947 TCCAGTTTGTCTTCTGATGGTGG - Intronic
1157428641 18:47604957-47604979 CTCAGTTCATCTTCTACTGGGGG - Intergenic
1157756925 18:50226863-50226885 TTGAGCTTATATACTAGTGGAGG - Intergenic
1158189410 18:54809325-54809347 TTCAGTGCATACTCTACTGGTGG - Intronic
1158799212 18:60886522-60886544 TTCATTTTTTATTATAATCGAGG + Intergenic
1159003173 18:62991203-62991225 TCCAGTTTATATCCTCATAGAGG - Intergenic
1163230757 19:16000282-16000304 TTCAGTTTAACTACTACTGGTGG + Intergenic
1165800891 19:38549090-38549112 ATGGGTTTATAGTCTAATGGGGG + Intronic
1165929565 19:39347909-39347931 TGGAATTTATATTCTGATGGGGG + Intronic
1167060009 19:47138647-47138669 TGGAGTTTACATTCTAATGGAGG + Intronic
1167294488 19:48641467-48641489 TGGAGTTTATGTTCTAATGAAGG + Intronic
925322161 2:2981187-2981209 TTCAGATTATATTATTAGGGTGG + Intergenic
925513230 2:4650821-4650843 TTCTGTATATTTTCTAATGAAGG - Intergenic
926056436 2:9776711-9776733 ATAAGTGAATATTCTAATGGGGG + Intergenic
926262023 2:11273037-11273059 TTCAGTTCATTTTCTTATAGTGG - Intronic
926436950 2:12848072-12848094 TTCACTTTATAATCAAATGTAGG + Intergenic
926437024 2:12848806-12848828 TTCACTTTATAATCAAATGTAGG - Intergenic
926803174 2:16680433-16680455 TTCAGTTCATTTTCTATTTGAGG + Intergenic
927312058 2:21642278-21642300 CACATTTTATATTCTCATGGCGG + Intergenic
927374023 2:22392413-22392435 TAGAGCTGATATTCTAATGGAGG - Intergenic
929311602 2:40432285-40432307 CAGAGCTTATATTCTAATGGTGG + Intronic
929515537 2:42603210-42603232 TTTAGTTTTTACCCTAATGGTGG + Intronic
932010003 2:67966208-67966230 TGGAGTTTACATTCTAGTGGTGG - Intergenic
932227239 2:70052076-70052098 TGGAGCTTATATTCTAATGGAGG + Intergenic
932899171 2:75678420-75678442 TTGAGTTTTTATCCTATTGGAGG + Intronic
933853831 2:86394516-86394538 TTCAGTATATATTATAATGTGGG - Intergenic
935417638 2:102835545-102835567 TTCCGTTTGTACTATAATGGTGG - Intronic
935498766 2:103812464-103812486 TTCAGTTTATTTTCTGATGAGGG - Intergenic
935589482 2:104832858-104832880 CTAAGTTTATATGCTAAAGGTGG - Intergenic
936584046 2:113736527-113736549 ATCTGTATATATTCTAATGTTGG - Intronic
937140962 2:119599791-119599813 CACAGTTTACATTCTAGTGGGGG - Intronic
937141013 2:119600127-119600149 TCCAGTTTACATTCTAGTTGGGG + Intronic
939000994 2:136734324-136734346 TGGAGCTTACATTCTAATGGTGG - Intergenic
939283578 2:140098915-140098937 TTCATTTTATCCTCTAATGGCGG - Intergenic
939892188 2:147749665-147749687 TTCAGGATATATTCTAAAGGTGG + Intergenic
940193672 2:151069404-151069426 TGGAGTTTACATTCTAATAGGGG + Intergenic
940564017 2:155337659-155337681 TTTGGCTTATATTATAATGGAGG - Intergenic
940732623 2:157411147-157411169 TACAGCTAATATTATAATGGTGG - Intergenic
941028833 2:160488969-160488991 TTGAGTTTAAATTCAAATGTGGG - Intronic
941260635 2:163292416-163292438 AAGAGTTTATAATCTAATGGGGG + Intergenic
941293940 2:163712271-163712293 TTCACTTTATATTCTTTTAGAGG - Intronic
941824835 2:169883596-169883618 TTCAGTTGATAATCCAATAGTGG + Intronic
941908570 2:170740637-170740659 TTCTGTTTGTATTCTCCTGGTGG + Intergenic
944353112 2:198753750-198753772 TTCATTTTATATCGTATTGGGGG + Intergenic
944639533 2:201709351-201709373 TGGAGCTTACATTCTAATGGGGG - Intronic
945475189 2:210273787-210273809 ATCAATTTATATTCTGTTGGTGG - Intergenic
947175374 2:227361513-227361535 TGGAGCTTATAGTCTAATGGGGG + Intergenic
947288469 2:228544797-228544819 TTAAGTTTATCTCCTAATGAAGG - Intergenic
948085170 2:235241363-235241385 TTCAGTTCACACTCAAATGGCGG + Intergenic
948538016 2:238661513-238661535 TTCAGGAGATATTCTAATGGGGG - Intergenic
1168966841 20:1903901-1903923 TGCAGCTTATATCCTAGTGGAGG - Intronic
1169850263 20:10041046-10041068 TTTATTTTTTATTTTAATGGTGG + Intronic
1170137599 20:13091969-13091991 TGTAGTTTAGAGTCTAATGGGGG + Intronic
1170317466 20:15058160-15058182 TTCAGTTTTCAAGCTAATGGAGG - Intronic
1171765739 20:29272362-29272384 TTCTGTTTATATTTTATTTGTGG + Intergenic
1173175045 20:40758355-40758377 TTGCGCTTATATTCTAATGGAGG - Intergenic
1174736575 20:52971626-52971648 TGGTATTTATATTCTAATGGGGG - Intergenic
1175098529 20:56561319-56561341 TTCAATTTATATCATAATTGGGG + Intergenic
1178140665 21:29679866-29679888 TTAAGTTTATTTTTAAATGGAGG - Intronic
1178550795 21:33537475-33537497 TAGAGATTATATTCTAGTGGAGG + Intronic
1180822631 22:18841470-18841492 TAGAGTTTATTTTCCAATGGAGG - Intergenic
1181190332 22:21134557-21134579 TAGAGTTTATTTTCCAATGGAGG + Intergenic
1181208870 22:21275966-21275988 TAGAGTTTATTTTCCAATGGAGG - Intergenic
1181503029 22:23330230-23330252 TAGAGTTTATTTTCCAATGGAGG + Intergenic
1181653834 22:24278606-24278628 TAGAGTTTATTTTCCAATGGAGG + Intronic
1182233303 22:28855452-28855474 AATAGTTTATATTCTAACGGAGG + Intergenic
1182307713 22:29382497-29382519 TGGAGTTTATGTCCTAATGGGGG + Intronic
1183764870 22:39863667-39863689 TTCAGTTTATTTTTGAAAGGTGG - Intronic
1185350129 22:50331347-50331369 GTAAGTTTATATTCAAATGTTGG + Intergenic
1203218069 22_KI270731v1_random:19480-19502 TAGAGTTTATTTTCCAATGGAGG + Intergenic
1203272769 22_KI270734v1_random:67375-67397 TAGAGTTTATTTTCCAATGGAGG - Intergenic
949978049 3:9478517-9478539 TGGAGTTTACATTCTAGTGGAGG + Intronic
950008761 3:9707477-9707499 TTCAGGATATATTTTAAAGGTGG + Intronic
950961107 3:17108957-17108979 TGGAGGTTACATTCTAATGGGGG + Intergenic
951030936 3:17881138-17881160 TGGAGTTTACATTCTACTGGTGG + Intronic
951088379 3:18542014-18542036 TAAATTTTATATGCTAATGGAGG + Intergenic
951480629 3:23158840-23158862 TTCAGTTTACTTTGTAATGTTGG - Intergenic
951781290 3:26365428-26365450 TGAAGTTTATATTCAAATGTAGG - Intergenic
951969032 3:28422312-28422334 TTCTGTATATACTATAATGGTGG - Intronic
952461893 3:33536225-33536247 TGGAGTTTATATTTTAGTGGAGG + Intronic
952623842 3:35379883-35379905 TGAAGCTTATATTCTCATGGGGG - Intergenic
953097144 3:39789299-39789321 TTCAGCTTTTATTCTATTTGTGG + Intergenic
953399710 3:42601904-42601926 TATAGTTTATATTCTATTGGGGG + Intronic
953436011 3:42877741-42877763 TGCAGTTTATGGTCTAATGGAGG + Intronic
955027603 3:55184934-55184956 TTTAGTTTATTTTCTAAAAGTGG - Intergenic
955638519 3:61056418-61056440 TGCAGCTTACATTCTAATTGTGG + Intronic
956135074 3:66090256-66090278 TACAGTTTACATGGTAATGGGGG - Intergenic
956204212 3:66739040-66739062 TTAAGTTTATTTTTAAATGGTGG - Intergenic
956714414 3:72065760-72065782 TAGAGTTTATATTCTAGTGGTGG + Intergenic
956859380 3:73307425-73307447 TGAAGTTCAGATTCTAATGGGGG - Intergenic
956883425 3:73534357-73534379 TTCAGTCAAGATTCCAATGGAGG + Intronic
957710226 3:83847744-83847766 TTCAGTTTATTTTCTCTTGTTGG - Intergenic
957733837 3:84180367-84180389 TTCAGTTAATAATCTAAATGGGG - Intergenic
957775276 3:84750912-84750934 TTCTGCTTATATTCTTATAGTGG - Intergenic
957862470 3:85972878-85972900 TTTTCTTTATATTCTAATGAAGG - Intronic
958816090 3:98917597-98917619 TTCATGTGATAGTCTAATGGAGG + Intergenic
959426305 3:106193139-106193161 CGGAGTTTATATTCTAATGGAGG - Intergenic
959496711 3:107060245-107060267 TTGAGCTGATATTCTAAAGGGGG + Intergenic
960325728 3:116293277-116293299 TTCATTTTAAATTCTAATGGTGG + Intronic
960622603 3:119651445-119651467 TGCAATTTACATTCTAATGGGGG - Intronic
961478284 3:127162624-127162646 TGGAGTTTATATTCTACTAGGGG - Intergenic
961619734 3:128214328-128214350 TTCAGCTAATTTTGTAATGGTGG + Intronic
962051384 3:131819295-131819317 TTCCTTTTACATGCTAATGGTGG - Intronic
962288649 3:134110222-134110244 TTTTGTTTTTATTCTAAGGGAGG - Intronic
962323873 3:134416346-134416368 TTAAATTTATATTTTAATGATGG - Intergenic
962649742 3:137476537-137476559 TTAAGTTTATATTCTACTGGGGG - Intergenic
963458050 3:145572516-145572538 TCAAGCTTACATTCTAATGGGGG + Intergenic
963872510 3:150433370-150433392 TTCAGTATCAATGCTAATGGTGG + Intronic
964774955 3:160265102-160265124 TGAAGTTTATATTCAAATGGAGG - Intronic
966174272 3:177118725-177118747 TGAAGTTTGTATTTTAATGGGGG + Intronic
968158911 3:196408458-196408480 TTCAGTTTATATTGAAAAGTTGG + Intronic
970332288 4:14999610-14999632 TTCAGTTCATAATCTGATAGAGG + Intergenic
970831218 4:20342180-20342202 TTAAGTTTATATTCCACTGTGGG + Intronic
971065651 4:23029401-23029423 TTCATTTCATGTTCTACTGGGGG + Intergenic
971219622 4:24692883-24692905 TGGAGTTTATAGTCTAATGAAGG + Intergenic
972921163 4:43943498-43943520 TAGAGTGTACATTCTAATGGTGG + Intergenic
974188282 4:58468117-58468139 TTCTGTATATTTTGTAATGGGGG + Intergenic
974355759 4:60810569-60810591 TTCAGTTCATATTTTCATGGTGG + Intergenic
974405014 4:61455647-61455669 TTCATTGTATATTCTGATAGTGG + Intronic
974489734 4:62549317-62549339 TGCGGTTTATATTCTAGTGACGG - Intergenic
974702311 4:65467415-65467437 ATCAGTTCAGATTCAAATGGTGG - Intronic
975073200 4:70169832-70169854 ATCACTTCATATTCTAATGCAGG + Intronic
975221473 4:71817286-71817308 TTCAGTTTATTTTCCTCTGGAGG - Intergenic
975631233 4:76404698-76404720 TTTATTTTTTATTCTCATGGTGG - Intronic
976163116 4:82224895-82224917 CTCATTTTATAGTCTAATGCTGG - Intergenic
976548004 4:86359933-86359955 TTCACTTTTTATTTTTATGGGGG - Exonic
976647777 4:87403094-87403116 TTCAGTATATTTACTAATGTGGG - Intergenic
977158177 4:93600484-93600506 TTCAATTTATATTTTCTTGGTGG - Intronic
977166273 4:93702822-93702844 TGCAGTTTGCATTCTAATGTGGG + Intronic
977870668 4:102086728-102086750 TTGAGTTTTTATTCTAGTGAGGG - Intergenic
978775514 4:112502475-112502497 TGGAGTTTACATTCTAATGAGGG + Intergenic
979912718 4:126389794-126389816 CTCAGTTTATATTCCCATAGTGG + Intergenic
979926770 4:126577382-126577404 TTGATATGATATTCTAATGGTGG - Intergenic
980061638 4:128136679-128136701 TTCACTTTATATACCAGTGGAGG - Intronic
980145403 4:128977452-128977474 TAAAGTTCATATTGTAATGGAGG + Intronic
980553679 4:134373734-134373756 TTCAGTTTATAATATAAAGTTGG + Intergenic
980715845 4:136627740-136627762 TTGGATTTATATTCTAATTGGGG - Intergenic
980899316 4:138889289-138889311 TTCAGTTTTTATTGTATTTGGGG - Intergenic
981301928 4:143196935-143196957 TTCTGGATATATTCTAAAGGTGG - Intronic
981837916 4:149076894-149076916 TGGAGCTTATATTCTAATGGAGG - Intergenic
981908977 4:149955725-149955747 TTTATTTTATTTTCTAATGCAGG - Intergenic
983563685 4:169127296-169127318 TTCATTTTTTATTCTACTGGTGG + Intronic
984162096 4:176265426-176265448 TTAAGTTTACATTCTAATTGAGG - Intronic
984909858 4:184664349-184664371 TACACTTTGTAGTCTAATGGAGG + Intronic
986713645 5:10506375-10506397 TTCAGCTTACATTTCAATGGGGG + Intronic
987246911 5:16058440-16058462 TGAAGTTTATGTTCTAGTGGAGG + Intergenic
988037563 5:25848091-25848113 ATCAGTTTATATTATAATGGAGG - Intergenic
988326500 5:29775474-29775496 GTCATGTTATATTCAAATGGAGG - Intergenic
988456916 5:31394855-31394877 TTCAGTAGATTTACTAATGGGGG - Intergenic
989309157 5:39993551-39993573 TAGAGTTTACTTTCTAATGGGGG + Intergenic
989679074 5:44008073-44008095 TTCAGTTTATATTATGACAGAGG + Intergenic
990081879 5:51927074-51927096 TTCAGGTTATATTTTAGTGTAGG + Intergenic
991406704 5:66306898-66306920 CTCAAATTATATTCTAATGTGGG + Intergenic
992065645 5:73105057-73105079 TTCAGTTTTTCTTTTAATTGTGG + Intergenic
992164642 5:74037563-74037585 TTCAGCTTATTTTCTACTGGAGG - Intergenic
992342706 5:75841880-75841902 TTAACTTTATCTTCTAATTGTGG + Intergenic
992983649 5:82203981-82204003 TGGAGCTTATATTCTAGTGGGGG + Intronic
993394701 5:87370738-87370760 TTCTGCTTATATTCTAACGAAGG + Intronic
993481046 5:88424823-88424845 TTCAGTTTATATTCTGCTTTAGG + Intergenic
993774370 5:91972654-91972676 TCTGGTTTATATACTAATGGAGG + Intergenic
994351803 5:98754401-98754423 TTCACTTTATTTTCTATTTGTGG - Intergenic
994445529 5:99868547-99868569 TACAATTTATATTCTTATGCTGG + Intergenic
994501071 5:100579163-100579185 TTTATTTTATATTATAATGGTGG + Intronic
994801031 5:104376161-104376183 TAAAGTTAATATGCTAATGGAGG + Intergenic
995230184 5:109752487-109752509 TGGAGCTTACATTCTAATGGTGG + Intronic
996569899 5:124921946-124921968 TTCATTATCTATTTTAATGGTGG - Intergenic
996613905 5:125416449-125416471 TTTAATTTTTATACTAATGGTGG - Intergenic
996764049 5:127018017-127018039 TGGAGTTTATATTCTAGTAGGGG + Intronic
998602985 5:143604030-143604052 AAGAGTTTACATTCTAATGGAGG + Intergenic
998804082 5:145901532-145901554 TGGAGCTTATATTCTAGTGGAGG + Intergenic
998891551 5:146751649-146751671 TGGAGTTTACATTCTAATGGAGG + Intronic
999216435 5:149939413-149939435 TTCAGTTTAGATTCTGTTTGTGG - Intronic
999844795 5:155467570-155467592 CGAAGCTTATATTCTAATGGGGG - Intergenic
1002616665 5:180460521-180460543 TGGAGCTTATATTCTAGTGGAGG - Intergenic
1002818514 6:700509-700531 TTAAGTTTACATTCTAGTGAGGG - Intergenic
1003775687 6:9360412-9360434 TTCAGTTTTTATTCTGTTGTTGG + Intergenic
1003976094 6:11346113-11346135 TGGAGCTTATATGCTAATGGTGG - Intronic
1004023582 6:11797119-11797141 TTCAGTTTAAAAGCTAATGTTGG - Intronic
1004171066 6:13295951-13295973 GACAGCTCATATTCTAATGGTGG - Intronic
1004176724 6:13346656-13346678 TTCACTTTTTTTTCTAATTGAGG - Intergenic
1005194224 6:23264307-23264329 TTCATTTTATCTTGTAATGAAGG + Intergenic
1006586763 6:35120198-35120220 TTCAGTTTATCTACAAATTGGGG + Exonic
1007591845 6:43026261-43026283 TTCAGTTCATATTCAAATCCTGG + Intronic
1008113443 6:47519108-47519130 ATGAGTTCATATTCTAATGGTGG + Intronic
1008204822 6:48641931-48641953 GTCAGTCTATATTTTAGTGGGGG - Intergenic
1008435355 6:51469448-51469470 TGAAGTTTATATTCTAATGAAGG + Intergenic
1008702188 6:54114699-54114721 TGGAGTTTATATTCTAGTGGAGG - Intronic
1008805697 6:55424926-55424948 TACAGTTGATATTCTACTGGAGG - Intergenic
1008932204 6:56953475-56953497 TACAGTTTATATTTTGCTGGTGG - Intronic
1009293470 6:61913598-61913620 TTGAGCTTACATTCTAATGTGGG + Intronic
1010092332 6:71998477-71998499 TGGAGTTTACATTCTAATGGAGG - Intronic
1010149706 6:72716985-72717007 TGGAGTTTGCATTCTAATGGAGG + Intronic
1010153560 6:72765287-72765309 TTGAGTTTATATTCTGGTTGTGG + Intronic
1010785978 6:80001894-80001916 TGGAGTTTACATTCTAGTGGGGG + Intergenic
1010849970 6:80761870-80761892 TACAGCTTATATTCAAATAGAGG + Intergenic
1010968202 6:82236219-82236241 TTAAGTTTTTATTCTACTAGGGG - Intronic
1012139122 6:95599521-95599543 TTGCAGTTATATTCTAATGGAGG + Intronic
1012431459 6:99168182-99168204 TACATTTTAAATTCTAATAGTGG + Intergenic
1012643460 6:101651443-101651465 TGGAGTTTATATTCTAGTGGAGG + Intronic
1013129770 6:107221717-107221739 TTGAGTTGCTTTTCTAATGGTGG + Intronic
1013144220 6:107371836-107371858 TTGAGTTCCTATTCTAATGCTGG + Intronic
1013442853 6:110189316-110189338 TGGAGTTTATATTCTAGTGGAGG - Intronic
1013679233 6:112504827-112504849 CTGAGTTAATATTGTAATGGAGG + Intergenic
1014242196 6:119029741-119029763 TTCACTTGACATTCTAATGCAGG + Intronic
1015185851 6:130414820-130414842 TTCCCTTTATAATCTAGTGGAGG + Intronic
1015432733 6:133150223-133150245 TTCAGTTTATACTCTAAGCCAGG - Intergenic
1016205605 6:141464975-141464997 ATCTGTTTATTTTCTATTGGAGG - Intergenic
1017273214 6:152533723-152533745 TGAAGCTTATATCCTAATGGGGG - Intronic
1017821337 6:158050991-158051013 TGCAGTTTATATGTTAACGGGGG + Intronic
1018072349 6:160175935-160175957 TTGAATTTATATTCTAGTTGGGG + Intronic
1018543060 6:164904556-164904578 TTCAGTTTATGTACAAATGGTGG - Intergenic
1018630872 6:165821325-165821347 TTCAGTTTTTGTTCTGAAGGGGG - Intronic
1019116663 6:169769832-169769854 TTCACTTTTTTTTCTGATGGAGG - Intronic
1019866893 7:3720494-3720516 TTCAGTTTATATTTTCCTGGTGG - Intronic
1020586179 7:10071407-10071429 TTGATTTTATATCCTAATAGTGG - Intergenic
1020869503 7:13609344-13609366 TTAAGTATATATATTAATGGGGG + Intergenic
1020872334 7:13647360-13647382 TTTAGTTCATATTCTAATCAAGG + Intergenic
1021150725 7:17147820-17147842 CAGAGTTTATATTCTAACGGGGG - Intergenic
1021482343 7:21131592-21131614 TTCAGTTTATCTTTTATTGTAGG - Intergenic
1021651940 7:22841128-22841150 TGGACTTTGTATTCTAATGGCGG + Intergenic
1022057599 7:26755601-26755623 TGGAACTTATATTCTAATGGAGG - Intronic
1022159474 7:27694547-27694569 TTCATTATAAATTGTAATGGTGG + Intergenic
1022860712 7:34363703-34363725 CTTAGTCTATATTTTAATGGGGG + Intergenic
1027567056 7:79808211-79808233 TCAAGCTTAAATTCTAATGGAGG - Intergenic
1028108347 7:86907172-86907194 TTCAGTTTATTGATTAATGGTGG - Intronic
1028167889 7:87560112-87560134 TGGAGCTTAAATTCTAATGGGGG - Intronic
1028382444 7:90213726-90213748 TGCAGTTTATTGTCCAATGGGGG + Intronic
1028716289 7:93973812-93973834 TACAGTTTGTATTCTAGTTGGGG - Intronic
1030044032 7:105478712-105478734 TTCAGTTTATATTGTATAGGTGG - Intronic
1030569397 7:111203328-111203350 TGGAGTTTTTATTCTAATGAAGG + Intronic
1032123851 7:129176435-129176457 CTAAGTTTACATTCTACTGGAGG + Intergenic
1032233216 7:130095039-130095061 TTAAGTTTACATTCTAATTAGGG - Intronic
1033026507 7:137778663-137778685 TGCAGTTTGTCTTTTAATGGGGG - Intronic
1033131094 7:138746081-138746103 TTCAGTTTATTTTCTAATGCAGG - Intronic
1033383446 7:140847234-140847256 TTAAGCTTATATTTTAATGAGGG - Intronic
1033387937 7:140896981-140897003 TTAAGTTTATATGTTAATGTAGG - Intronic
1033522597 7:142176519-142176541 TAAAGTTTTTATTCTAATGGAGG + Intronic
1033821881 7:145144419-145144441 TTCATTTTATATTGTAAAAGGGG + Intergenic
1034331336 7:150285700-150285722 TTCAGTTTATATTCAGTAGGTGG - Intronic
1034666707 7:152824156-152824178 TTCAGTTTATATTCAGTAGGTGG + Intronic
1034871449 7:154688250-154688272 TTAAGTCTATATACCAATGGAGG + Intronic
1035193409 7:157192923-157192945 TACAGTTTAAATTAAAATGGGGG - Intronic
1036192482 8:6683059-6683081 TCCTGTTGATATTATAATGGCGG - Intergenic
1037115584 8:15222162-15222184 AGCATTTTATATTCTAAAGGGGG + Intronic
1037280513 8:17236729-17236751 TGGAGTTTATATTCTCATGGGGG - Intronic
1038645195 8:29355250-29355272 ATGAGTTTATATTCTAAAGCAGG - Intergenic
1040395142 8:46991671-46991693 TGCAGTTTACATTCTAGTGAAGG - Intergenic
1040801872 8:51350994-51351016 TTCAGTATTGATTCTAATTGAGG - Intronic
1040854325 8:51933000-51933022 TGGAGTTTATATTCTAGTGAGGG + Intergenic
1041923481 8:63210389-63210411 TTCAGTATACATATTAATGGGGG - Intronic
1042126474 8:65542393-65542415 TACAGGCTATATTCTAAAGGGGG + Intergenic
1042420578 8:68583812-68583834 TTCAATTTATATTCTTGTGAGGG + Intronic
1042786928 8:72558269-72558291 TGCAGCTTACATTCTCATGGAGG - Intronic
1042790970 8:72605753-72605775 TTCAATAAATATTCTAATGGTGG + Intronic
1042791171 8:72608032-72608054 TGGAGCTTATATTCTCATGGGGG + Intronic
1043269577 8:78314801-78314823 CTCATATTATATTCTCATGGAGG - Intergenic
1043313804 8:78895149-78895171 GGCAGTTTCTATTCTCATGGTGG + Intergenic
1043766899 8:84146850-84146872 TGGTGTTTATATTCTAGTGGTGG + Intergenic
1043875195 8:85478225-85478247 ATAAGTTCATATTCTAAGGGAGG - Intronic
1044040760 8:87365767-87365789 TTCTGATTATATTTTAATAGAGG - Intronic
1044150113 8:88765664-88765686 TTCTCTTCATATTCTAATTGTGG - Intergenic
1044218771 8:89645583-89645605 TGCAGTTTATATTCTATTAAGGG - Intergenic
1044998739 8:97861649-97861671 GTGAGTTTATAATCTACTGGGGG - Intergenic
1045085538 8:98679558-98679580 TTGAGTTTATATTCTACTGAGGG - Intronic
1045105088 8:98884756-98884778 TGAAACTTATATTCTAATGGGGG - Intronic
1045631017 8:104122033-104122055 TGGAGTTTATATTCTGATGGGGG + Intronic
1046000903 8:108420091-108420113 TTGGGTTTATATTCTAGTGAGGG + Intronic
1046278861 8:111998193-111998215 TTGAGCTTACATTCTAGTGGTGG - Intergenic
1046545021 8:115638930-115638952 AGCAGTTTATAGTCTAATGGGGG - Intronic
1046553194 8:115742850-115742872 ATGAGTTTATATGCTACTGGTGG - Intronic
1047555911 8:125930152-125930174 GGCAGTTTATATCCTAATGGAGG + Intergenic
1049008026 8:139868816-139868838 TGGAGCTTATATTCTAATGAGGG + Intronic
1050477193 9:6052428-6052450 TTAAGTCTACATTCTAGTGGAGG - Intergenic
1050850458 9:10278619-10278641 TTGTGTTTATATTCTAAGTGAGG - Intronic
1051480576 9:17555707-17555729 TTGAGTTAAAATTCTGATGGGGG + Intergenic
1052137201 9:24927519-24927541 TCCTGTTTATCCTCTAATGGGGG - Intergenic
1052867699 9:33475083-33475105 TTCATTTTATTTCCTAATGCAGG + Intergenic
1054999290 9:71430136-71430158 TGGAGCTTATATTCTAATGAAGG - Intronic
1055376227 9:75650358-75650380 TATACTTTATATTCTGATGGTGG + Intergenic
1055837330 9:80458817-80458839 AACAGTTTATATTCTAAGGGTGG + Intergenic
1056189661 9:84172594-84172616 TGCAGCATATATCCTAATGGTGG + Intergenic
1058170552 9:101675573-101675595 TGCAGCTTATATTCTATTGAAGG + Intronic
1058516018 9:105776746-105776768 TGGAGTTTATATTCCAGTGGCGG + Intergenic
1058742509 9:107957914-107957936 TTAAGTTCATAATCTAATGTGGG + Intergenic
1059097795 9:111437579-111437601 TTCAGTGGATTTTCTAATGTAGG - Intronic
1059995731 9:119907023-119907045 TTGAGTTTATATTCTAGTGAAGG + Intergenic
1060716204 9:125931696-125931718 TTGAGCTTATATTCTACTTGAGG + Intronic
1185810361 X:3103202-3103224 TGGAGTTTATATCCTACTGGAGG + Intronic
1185956571 X:4497528-4497550 TTGAATTTATTTTCTGATGGTGG + Intergenic
1186565015 X:10653016-10653038 TTCAGTTTATATTCTAATGGAGG - Intronic
1186588572 X:10903481-10903503 TGGAGTTTACATTCTAATAGGGG + Intergenic
1187094474 X:16131988-16132010 TGGAGCTTATATTCTAGTGGTGG - Intronic
1187581804 X:20615051-20615073 TAGAGTTTGTATTCTAGTGGAGG + Intergenic
1187609561 X:20927298-20927320 TGGATCTTATATTCTAATGGCGG - Intergenic
1187761473 X:22591083-22591105 TTTAATTTATATTTTAATGGAGG - Intergenic
1188029940 X:25253116-25253138 TGTAGTTTACATTCTAGTGGAGG - Intergenic
1189135036 X:38540155-38540177 TTGAGTTTATACTCTTATGTTGG + Intronic
1190623917 X:52317522-52317544 TTCAGTTTATATTCTTGTGGGGG + Intergenic
1191130319 X:57001086-57001108 CTCAGTATATACTCTAATGAAGG - Intergenic
1192162858 X:68801634-68801656 TGCAGCTTATATTCCAGTGGAGG + Intergenic
1192315996 X:70052308-70052330 TGAAGTTTATATTCTGGTGGAGG + Intergenic
1194383990 X:93230944-93230966 TTGAGTTTCTATTCTATTGAAGG + Intergenic
1194449659 X:94028903-94028925 TTCAGTTTACATTCTGGAGGAGG + Intergenic
1194511697 X:94804461-94804483 TTCACTTTACACTCTAATGTGGG - Intergenic
1195015532 X:100776153-100776175 GTCTATTTATATTCTTATGGAGG + Intergenic
1195756299 X:108202325-108202347 TTGAGATTACATTGTAATGGGGG - Intronic
1196377581 X:115051233-115051255 TTGAGTTTACATTCTAGTAGTGG + Intergenic
1196749129 X:119098780-119098802 TGGAGTTTATATTGTAATGGGGG - Intronic
1197403502 X:126022973-126022995 TGCAGCTTACATTTTAATGGAGG + Intergenic
1197461537 X:126748829-126748851 TTCATTTTATCTTATAAAGGTGG + Intergenic
1197562232 X:128037528-128037550 TTCAGTTTATATTAACATGAAGG + Intergenic
1197801856 X:130358630-130358652 TTCATTTTAGATTCGAATGCAGG + Exonic
1198721918 X:139631560-139631582 TTCATTTTACAGTTTAATGGAGG - Intronic
1198795771 X:140392342-140392364 TGCACTTTATATTTTTATGGAGG + Intergenic
1199329991 X:146548223-146548245 TTAAGCTCATATTCTAGTGGAGG + Intergenic
1199862849 X:151817462-151817484 TTCAGTATATAGACTAATGATGG - Intergenic