ID: 1186565084

View in Genome Browser
Species Human (GRCh38)
Location X:10653802-10653824
Sequence ACAGCCTTTAAAGGTATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186565084 Original CRISPR ACAGCCTTTAAAGGTATTGC TGG (reversed) Intronic
907650169 1:56287352-56287374 ACAGCAATTAAATGGATTGCTGG - Intergenic
910738517 1:90489543-90489565 ACAGCCAGTAATGGGATTGCTGG + Intergenic
912576766 1:110678997-110679019 ATACCCTGTAATGGTATTGCTGG - Intergenic
915673714 1:157511658-157511680 ACAGGCCTTGAAGGTATTGGAGG + Intergenic
915790814 1:158669021-158669043 ACACACTTTAAATGTATTGATGG + Intronic
916030596 1:160874530-160874552 ACAGCCTTTAAAGGAGTGCCTGG - Intergenic
916846218 1:168653168-168653190 AGAGCCTTTAAAGTTATTCCTGG - Intergenic
917019897 1:170574845-170574867 ACACCCAGTAAAGGGATTGCAGG - Intergenic
917572493 1:176282722-176282744 ACAGCCAATAATGGGATTGCTGG + Intergenic
917708235 1:177656703-177656725 ACAGCATTTTAAGATATGGCTGG + Intergenic
920637774 1:207721041-207721063 ACAGCCTTGAAAGTTTCTGCAGG + Intronic
921869590 1:220125361-220125383 ACAGCCTTTGTATGTATTACAGG + Intronic
922415385 1:225417417-225417439 ACAAATTTTAAAGATATTGCAGG + Intronic
923649049 1:235855029-235855051 ATACCCTTTGAAGGAATTGCAGG - Intronic
924852487 1:247844367-247844389 ACACACTGGAAAGGTATTGCAGG + Intergenic
1065503292 10:26402919-26402941 ACACCCTGTAATGGGATTGCTGG - Intergenic
1066644462 10:37591759-37591781 ATAGGCTTTAAAGGTAATGTTGG - Intergenic
1067573786 10:47392487-47392509 ACAGTCAGTAACGGTATTGCTGG + Intergenic
1070792823 10:79199848-79199870 ACATCCTTTAAAGCAATTGGAGG + Intronic
1072628060 10:97126988-97127010 TCAGGCTTTAAAGGTTTTGAAGG + Intronic
1077203421 11:1326241-1326263 ACTGCCATTAAAAGTCTTGCTGG - Intergenic
1079916774 11:26378701-26378723 TCAGCCTTTACTGGTAATGCAGG - Intronic
1080218048 11:29868052-29868074 ACAGCCTTCAAAGTTGTGGCTGG - Intergenic
1081478856 11:43464797-43464819 ACAGCCTTTAAAAGTCATGCAGG + Intronic
1083351201 11:62030345-62030367 TCAGCCTCTAAAAGTACTGCTGG - Intergenic
1089880381 11:121767809-121767831 ACAGCTTTTAAAGGTAGAGACGG - Intergenic
1090114578 11:123955114-123955136 ACACCCTGTAATGGGATTGCTGG - Intergenic
1094378661 12:29818711-29818733 ACAGCCTTGAAAGCTTTAGCAGG + Intergenic
1094382087 12:29854086-29854108 ATAGCCAGTAATGGTATTGCTGG - Intergenic
1097312564 12:58136525-58136547 ACACCCAGTAATGGTATTGCTGG + Intergenic
1099273999 12:80552018-80552040 AAAGCCTTTAATGGCATTTCTGG + Intronic
1100051077 12:90448128-90448150 ACAGCTCATAAAGGTAGTGCAGG + Intergenic
1104569735 12:129914710-129914732 ACAGCCTTGCAGGGCATTGCAGG - Intergenic
1106426715 13:29637286-29637308 ATAGCCAGTAAAGGGATTGCTGG - Intergenic
1107838136 13:44428728-44428750 CCAGCCTTCTAAGTTATTGCTGG + Intergenic
1107966453 13:45602534-45602556 ACAGCCTTTTAAGGGTTTGAAGG + Intronic
1109480006 13:62939477-62939499 ACACCCATTAATGGTATTGCAGG - Intergenic
1109925694 13:69135544-69135566 ACAGCCAGTAATAGTATTGCTGG + Intergenic
1110693395 13:78458309-78458331 ACAGCCAGTAATGGGATTGCTGG - Intergenic
1114536371 14:23425499-23425521 ACAGCCTAGAAAAGGATTGCAGG + Intronic
1114845390 14:26314531-26314553 ACACCCAGTAATGGTATTGCTGG - Intergenic
1117526482 14:56611669-56611691 ACAGCCAATAATGGGATTGCTGG - Intronic
1126389328 15:48129139-48129161 TCAGCCTTTAAAAGCATTACAGG + Intronic
1127242420 15:57131697-57131719 AGAGCCTTTAAAGTTATGTCAGG + Intronic
1127263161 15:57340390-57340412 CCAGCCATTAAAGGTAGAGCTGG + Intergenic
1130680256 15:85990313-85990335 ACATGCTTTTAAGATATTGCTGG - Intergenic
1138803589 16:60065152-60065174 ACATCTTTTAAAGGAATTGAAGG - Intergenic
1139171862 16:64640175-64640197 ACACCCTGTAATGGGATTGCTGG + Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140495782 16:75387014-75387036 TAAGCCTTTATAGGTATTGCAGG - Intronic
1140697201 16:77546976-77546998 ATATCCTTTGAAGGTATGGCAGG - Intergenic
1145116520 17:20215158-20215180 ACAGCTTCTAAAGGTACTGGAGG - Intronic
1145358547 17:22187868-22187890 ACACCCATTAATGGTATTGCAGG + Intergenic
1148520546 17:48270915-48270937 AGTGCTTTTAAAGGTAGTGCAGG + Intronic
1150453071 17:65285414-65285436 ACAGCCAATAGAGGGATTGCTGG + Intergenic
1151110392 17:71669291-71669313 ACAGCCTTATAAGATAATGCAGG + Intergenic
1153760417 18:8325689-8325711 ACAGCCAATAATGGGATTGCTGG + Intronic
1155360560 18:24995897-24995919 TCAGCCTTCCAAGTTATTGCAGG - Intergenic
1157506006 18:48227144-48227166 ACAGCCTTTTCAGGCATGGCTGG - Intronic
1158784546 18:60693648-60693670 ACATCCTTTAACGCTATTGTTGG - Intergenic
1159600944 18:70428141-70428163 ACAGCCTTTAAATGAAAAGCAGG - Intergenic
933885576 2:86717319-86717341 ACAGCAGTTAAAGGTAGGGCTGG + Intronic
933924600 2:87079379-87079401 ACAGCAGTTAAAGGTAGGGCTGG - Intergenic
934818992 2:97355710-97355732 ACAGCCTTTAAAAGGCTTGGGGG + Intergenic
936547754 2:113407234-113407256 ACAGTCTTTAAAAGTCTTGATGG + Intergenic
941706298 2:168662102-168662124 ACAGCCTTGAATGGTATACCAGG - Intronic
943942211 2:194012924-194012946 ACAGCCAGTAATGGGATTGCTGG - Intergenic
944053114 2:195493839-195493861 ACAGCTCATAAAGGTAGTGCGGG - Intergenic
945202356 2:207295327-207295349 ACAACCTGTAATGGGATTGCTGG + Intergenic
1170575979 20:17661748-17661770 ACAGCATCTAGAGGTTTTGCAGG - Intronic
1170915251 20:20617294-20617316 ACAGCCTTTAAAGTTATCTTAGG + Intronic
1171817645 20:29802562-29802584 GCAGCCTTTAAAGGTTATGTCGG + Intergenic
1173093376 20:39998377-39998399 ACACCCATTAATGGAATTGCTGG - Intergenic
1183816841 22:40309138-40309160 ACAGCATTTAAGGGCATTGCAGG + Intronic
949765407 3:7520898-7520920 TCAAGCTTTAAATGTATTGCAGG - Intronic
950199500 3:11033296-11033318 AAAGCCTTTGAAGGAATGGCTGG + Intronic
955238310 3:57159446-57159468 ACAGCCTTTGAAGCTCTTCCCGG - Intronic
955590449 3:60529020-60529042 ACAGGCTTTAAATATATTTCAGG - Intronic
958465189 3:94448702-94448724 ACACCCATTAATGGGATTGCCGG - Intergenic
961537947 3:127581236-127581258 ACAGCCTTTACAAGCATTCCTGG - Intronic
961735422 3:128999370-128999392 AAAGCTTTTAAATGTCTTGCTGG - Intronic
963280220 3:143377266-143377288 CCAGGCTTCAAAGGTATTCCAGG + Intronic
965980674 3:174686179-174686201 ATACCCTTTAATGGGATTGCTGG + Intronic
971901322 4:32662960-32662982 ATAGCCTTTATAGGTAATACTGG - Intergenic
979926510 4:126572662-126572684 AAAGCCTTTAAAGGTAAAGTGGG + Intergenic
984331440 4:178325418-178325440 ACAGCCAGTAATGGGATTGCTGG + Intergenic
985239503 4:187915232-187915254 ACAGCCCGTAATGGAATTGCTGG - Intergenic
985980718 5:3460881-3460903 ACAGCATTTCAAGCTTTTGCTGG - Intergenic
986957541 5:13172140-13172162 ACAGCATTTCAAGGTATTTCTGG + Intergenic
987209235 5:15662042-15662064 AAAGCCAGTAAAGGGATTGCTGG + Intronic
990900706 5:60745529-60745551 ATACCCTGTAAAGGGATTGCTGG + Intergenic
991487125 5:67149025-67149047 ACAGCCTTTCATGGTATGGGGGG + Intronic
993255251 5:85582760-85582782 ATACCCATTAATGGTATTGCTGG + Intergenic
993375407 5:87144371-87144393 ACACCCAGTAATGGTATTGCTGG + Intergenic
995928205 5:117401600-117401622 ACAGCCTTTAAAGGAAAGACTGG + Intergenic
998463756 5:142326787-142326809 ACAGCCTTAAAAGGAAGTCCTGG - Intergenic
998960717 5:147483637-147483659 ACAGCCTTCAAAGGAATCTCAGG + Intronic
1005851085 6:29822971-29822993 ATAACCTTTAATGGGATTGCTGG - Intergenic
1008051149 6:46901630-46901652 ACAGACTTTAAAGGCAGAGCAGG + Intronic
1008935253 6:56985087-56985109 TCTGCCTTCAAAGGTATTCCAGG + Intronic
1009448202 6:63768702-63768724 ATAGCCAGTAATGGTATTGCTGG - Intronic
1010075456 6:71792119-71792141 ACAGCTCATAAAGGTAGTGCAGG - Intergenic
1010171971 6:72985790-72985812 ATAGCCAGTAATGGTATTGCTGG - Intronic
1014059505 6:117054171-117054193 ACACCCAGTAATGGTATTGCTGG + Intergenic
1014961238 6:127687834-127687856 ACACCCAGTAAAGGGATTGCTGG + Intergenic
1019035476 6:169052857-169052879 ACATACCTTAAAGATATTGCGGG + Intergenic
1019909822 7:4093128-4093150 GCAGCTTTTATAGGTATTTCTGG + Intronic
1020540236 7:9453573-9453595 ACATCCAGTAAAGGAATTGCAGG + Intergenic
1021037751 7:15821831-15821853 ACATCCATTAAAGGAATTACTGG - Intergenic
1022399152 7:30019814-30019836 ACAGGCTTTAAAAATAATGCAGG + Intronic
1023211848 7:37814353-37814375 AAACCCAATAAAGGTATTGCTGG - Intronic
1023267285 7:38420509-38420531 ACATCCTTTACAGATATTGGTGG + Intronic
1028615162 7:92757665-92757687 ACACCCAGTAAAGGGATTGCTGG + Intronic
1028754871 7:94423348-94423370 AAAGCCCTTAAAGCTATTGAAGG + Intronic
1028833085 7:95346602-95346624 ACAGCCTTTCCTGGTATTCCTGG - Intergenic
1028923223 7:96329357-96329379 ACTGCCTTGAGTGGTATTGCTGG - Intergenic
1030700007 7:112627787-112627809 ATACCCAATAAAGGTATTGCTGG + Intergenic
1031039287 7:116822010-116822032 ACACCCTGTAACGGGATTGCTGG + Intronic
1032173342 7:129604019-129604041 ACACCCTGTAATGGGATTGCTGG - Intergenic
1032295393 7:130633272-130633294 ACTGGCTCTAAAGGTATTTCTGG + Intronic
1035938785 8:3873184-3873206 ATAGCCAGTAAAGGGATTGCTGG - Intronic
1035975889 8:4311130-4311152 ACAGCCAGTCACGGTATTGCTGG - Intronic
1037148944 8:15611697-15611719 AGTGCCTTTAAAGGTAGTGGTGG + Intronic
1038106908 8:24445598-24445620 ACAGCCTTAAATGGTTTTCCTGG + Intronic
1039291406 8:36097897-36097919 ACATCCAGTAACGGTATTGCTGG + Intergenic
1043809694 8:84721963-84721985 GAAGCATTTAAAGTTATTGCAGG + Intronic
1044558896 8:93593421-93593443 ACAGCCTTGAAAGGTAGCGATGG + Intergenic
1045608100 8:103801285-103801307 ATAGTCTTTAAAGACATTGCTGG - Intronic
1045729420 8:105217936-105217958 ACACCCAGTAAAGGAATTGCTGG - Intronic
1046116064 8:109785193-109785215 ACACCCCATAATGGTATTGCTGG - Intergenic
1050233868 9:3557381-3557403 ACAGCCAGTAATGGGATTGCTGG + Intergenic
1051535234 9:18150251-18150273 ACAGCCTTTAAAGGATGGGCAGG + Intergenic
1053333729 9:37243178-37243200 ACAGCTTTTAAAGGAATCGATGG + Intronic
1053352291 9:37421656-37421678 ATGGCCTTTAAATGTATGGCTGG - Intergenic
1055201900 9:73673991-73674013 ATAGCCAGTAAAGGGATTGCTGG - Intergenic
1056244812 9:84683699-84683721 ATACCCTTTAATGGGATTGCTGG + Intronic
1056901451 9:90604069-90604091 ACAGACTTTAAATCTATCGCAGG + Intergenic
1058507704 9:105683137-105683159 AAAGCCTTTACAGGTAATTCAGG - Intergenic
1060906825 9:127314437-127314459 ACAGGCTTTGAAGGCATTGTGGG - Intronic
1185686034 X:1929241-1929263 ACAGCTTTTAAAGAAATTGGTGG - Intergenic
1186565084 X:10653802-10653824 ACAGCCTTTAAAGGTATTGCTGG - Intronic
1188739027 X:33754732-33754754 ATACCCTTTAATGGAATTGCTGG - Intergenic
1188799807 X:34515578-34515600 ACACCCATTAATGGGATTGCTGG - Intergenic
1189950110 X:46220664-46220686 ACAGCCTTGAGAGGTTTTCCAGG + Intergenic
1190576427 X:51844058-51844080 GTAGACTTTAAAGGTATTGCTGG + Intronic
1192764968 X:74130710-74130732 ACAGCCTTCAAAGCTTTTCCTGG - Intergenic
1193889661 X:87029103-87029125 AAAGCCTTTCAAGATATTGTGGG - Intergenic
1196731601 X:118946615-118946637 ACAGCCCTTAAGGGTAGTGTTGG + Intergenic
1201235949 Y:11911767-11911789 ACAGCCTTTCCAGGTATTTCAGG + Intergenic