ID: 1186566309

View in Genome Browser
Species Human (GRCh38)
Location X:10666630-10666652
Sequence GTTCTGAGCACAATTAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 1, 2: 20, 3: 203, 4: 443}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186566302_1186566309 24 Left 1186566302 X:10666583-10666605 CCTGAGGAAATCTGGCCATTCAA 0: 1
1: 0
2: 1
3: 17
4: 114
Right 1186566309 X:10666630-10666652 GTTCTGAGCACAATTAAAGGGGG 0: 1
1: 1
2: 20
3: 203
4: 443
1186566303_1186566309 9 Left 1186566303 X:10666598-10666620 CCATTCAAATGATTTCAAAGATA 0: 1
1: 0
2: 4
3: 47
4: 476
Right 1186566309 X:10666630-10666652 GTTCTGAGCACAATTAAAGGGGG 0: 1
1: 1
2: 20
3: 203
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186566309 Original CRISPR GTTCTGAGCACAATTAAAGG GGG Intronic
900006678 1:60483-60505 GTTCTGAGCACATTTAAGGTAGG - Intergenic
901708225 1:11092945-11092967 TTTCTGAGCACATTTAAAGCAGG + Intronic
901804779 1:11731479-11731501 GTTCTGAGCATGTTTAAAGTAGG - Intergenic
903746974 1:25593824-25593846 GTTCTGAGCACATTTAAGGGAGG - Intergenic
905157458 1:35997553-35997575 GTTCTGAGCACATTTAAGGTAGG + Intronic
905350214 1:37340501-37340523 GTTCTGAGCACGTTTAAGGTTGG + Intergenic
905784318 1:40741372-40741394 GTTCTGAGCACATTTAAGGTGGG + Intronic
906884522 1:49630021-49630043 GGTCTGAGGACCATCAAAGGGGG - Intronic
907214769 1:52852799-52852821 GTTCTGAGCACATTTAAGGTAGG - Intronic
907561591 1:55395044-55395066 GTTCTGAGCATGTTTAAAGTAGG + Intergenic
907771348 1:57467935-57467957 GTTCTGAGCTCAATAAATAGTGG - Intronic
908643609 1:66252456-66252478 GTTCTGAGCACATTTAAGGTAGG - Intronic
908839263 1:68261964-68261986 GTTCTGAGCACGTTTAAGGTAGG + Intergenic
910693867 1:89992128-89992150 GTTCTAAGCACATTTAAGGTAGG + Intergenic
910857401 1:91709297-91709319 GTTCTGAGCATGTTTAAAGTAGG - Intronic
911058667 1:93729268-93729290 GTTTTGAGCACAGTTAAGGGAGG - Intronic
911156589 1:94643293-94643315 GTTCTGAAAAGAATTTAAGGGGG + Intergenic
911207291 1:95104725-95104747 GTTCTGAGCATGTTTAAAGTAGG - Intergenic
911287332 1:96012029-96012051 GTTCTGAGCACATTTAAGCTAGG - Intergenic
911661174 1:100503043-100503065 TTTCTAAGCAAAGTTAAAGGGGG - Intronic
911698229 1:100918651-100918673 GTTCTGAGCACATTTAAGGTAGG - Intronic
911709372 1:101052464-101052486 GTTCTGAGCACATTTAAGGTAGG + Intergenic
911866782 1:103036808-103036830 GTTTTGTGGACCATTAAAGGAGG - Intronic
912057209 1:105617985-105618007 GTTCTGAGCACATTTAAGCTAGG + Intergenic
912162931 1:107008169-107008191 GTTCTGAGCACATTTAAATTAGG - Intergenic
912376928 1:109217281-109217303 GTTCTGAGCACATTTAAGGTAGG - Intronic
912773449 1:112487476-112487498 GTTCTGAGCACATTTAAGGTAGG - Intronic
913158776 1:116126970-116126992 GTTCTGAGCACTTTTAAGGTAGG + Intronic
913387576 1:118276527-118276549 GTTTTGAGCACATTTAAGGTAGG + Intergenic
914914725 1:151812423-151812445 ATTCTGAGCACATTTAAGGTAGG + Intronic
915035590 1:152921231-152921253 GTTCTGAGCACATTTAAGGGTGG + Intergenic
916730388 1:167561646-167561668 GTTCTGAGCACGTTTAAGGTAGG + Intergenic
916823247 1:168420317-168420339 GTAATGAGCACCATTAAAGTTGG - Intergenic
916985190 1:170183221-170183243 GTGAGGAGCACATTTAAAGGAGG + Intergenic
916995691 1:170297023-170297045 GTTCTGAGCACATTTAAGGTAGG + Intergenic
917265504 1:173216695-173216717 CTTCTGAGCACAGCTTAAGGAGG - Intergenic
917551542 1:176036783-176036805 ATTCTGAGCACATTTAAGGTAGG + Intronic
917732393 1:177888392-177888414 GTTCTGAGCACATTTAAAGTAGG + Intergenic
918244990 1:182651346-182651368 GTTCTGAGCACATTTAGGGTAGG - Intronic
918481951 1:184987937-184987959 GTTCTGAGAACTATTGTAGGAGG + Intergenic
919651817 1:200156813-200156835 ATTCTGAGCACATTTAAGGCAGG + Intronic
919847890 1:201652920-201652942 GTTCTGAGCACGTTTAAGGTAGG - Intronic
920145394 1:203856813-203856835 GTATTGGGCACAATTTAAGGAGG + Intergenic
920493000 1:206432797-206432819 GTTCTGAGCACATTTAAGGCAGG - Intronic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921665703 1:217868463-217868485 GTTCTGAGCATATTTAAGGTAGG - Exonic
921961715 1:221041966-221041988 GTTCTGAGCACATTTAAGGTAGG - Intergenic
922137116 1:222839982-222840004 GTTCTGAGCACATTTAAGACAGG - Intergenic
922236973 1:223729354-223729376 GTTCTGAGCACAATTAAGGTAGG + Intronic
922317421 1:224455070-224455092 GTTCTGAGCACGTTTAAGGTAGG - Intronic
922498181 1:226077120-226077142 ATTCTGAGAACATTTAAAGTAGG - Intergenic
922640365 1:227223942-227223964 GTTCTGAGCACGTTTAAGGTAGG + Intronic
922656992 1:227393991-227394013 GTTCTGAGCACATTTAATTTAGG + Intergenic
922690884 1:227689488-227689510 TTTCTCAGCAAAATAAAAGGTGG + Intergenic
923013603 1:230108669-230108691 GCTCTGAGCACAATGAAGGCAGG - Intronic
923974439 1:239245687-239245709 GTTCTGAGCACATTTAAGGAAGG - Intergenic
924803582 1:247345403-247345425 ACTCTGAACACAAGTAAAGGTGG - Intergenic
924954741 1:248915488-248915510 GTTCTGAGCACGATTAAGGTAGG + Intronic
1063967927 10:11361301-11361323 GTTCTGAGCACGTTTAAGGTAGG - Intergenic
1064083982 10:12331246-12331268 GTTCTGAGCACATGTAAGGTAGG - Intergenic
1064393535 10:14961136-14961158 GTTCTGAGGACGTTTAAAGTTGG - Intronic
1066073120 10:31841631-31841653 GTTCAGAGCACATTTAAGGTAGG + Intronic
1066093218 10:32046934-32046956 GTTCTGAGCACATTTAAAGTAGG - Intronic
1066137210 10:32461278-32461300 GTTCTCAGCACATTTAAGGTAGG - Intronic
1066244191 10:33566608-33566630 GTGCTGAGCACAAACAAAAGGGG - Intergenic
1066489160 10:35877450-35877472 GTTCTGAGCACGTTTAAGGTAGG + Intergenic
1067784552 10:49235332-49235354 GTTTTGAGCACAGTTAAGGTAGG - Intergenic
1067905774 10:50289234-50289256 GTTCTGAGCACGTTTAAGGTAGG - Intergenic
1068180834 10:53516571-53516593 GTTCTGAGTACATTTAAGGTAGG + Intergenic
1068255748 10:54508511-54508533 GGTCTGAGCACATTTAAGGTAGG - Intronic
1068768095 10:60787282-60787304 GTTTTGAGCACAATTAAGGTGGG + Intronic
1069519720 10:69109168-69109190 GTTCTGAGCATACTTAAAGTAGG + Intergenic
1070822484 10:79368897-79368919 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1071181954 10:82996668-82996690 GTTCTGAGCATATTTAAGGTAGG - Intergenic
1071827314 10:89338028-89338050 GTTCTGAGCACATTTAAGCTAGG + Intronic
1071843333 10:89495617-89495639 TTTCCGAGCACATTTAAAGTAGG - Intronic
1071933991 10:90506169-90506191 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1072912126 10:99511948-99511970 GTTCTGAGCACGTTTAAGGTAGG - Intergenic
1072931449 10:99666703-99666725 GTTCTGAGCACCTTTAAAGTAGG - Intronic
1073534586 10:104264756-104264778 TTTCTGAGCACATTTAAAGCAGG - Intronic
1074602245 10:114926787-114926809 GTTCTGAGCACATTTAAGGTAGG - Intergenic
1074770152 10:116728249-116728271 GTTCTGAGCATATTTAAGGTAGG + Intronic
1075964204 10:126596591-126596613 GTTCTGAGTACATTGAAAGTAGG - Intronic
1076273053 10:129173000-129173022 ATTTTGAGCATAATGAAAGGAGG - Intergenic
1077899271 11:6476567-6476589 GCTCTAAGCACAATTAAACTGGG + Exonic
1079198200 11:18349849-18349871 GTTCGGAACACATTTAAAGTAGG - Intronic
1079321154 11:19452634-19452656 GTTCTAAGCACATTTAAAGTAGG - Intronic
1079373964 11:19875299-19875321 GTTCTGAGCACATTTAAGGTAGG - Intronic
1079781071 11:24606355-24606377 GTTCTGAGCACATTTAAAGTAGG + Intronic
1080069126 11:28058065-28058087 GTTCTGAGAAGAGTTGAAGGTGG + Intronic
1080304471 11:30821442-30821464 GCTTTGTGCAGAATTAAAGGAGG + Intergenic
1080349276 11:31364123-31364145 GTTCTGAGCACAATTAAAGTAGG + Intronic
1081345405 11:41979531-41979553 GTTCTGGGCACATTTAAGGTAGG - Intergenic
1081447821 11:43147418-43147440 GTTGTGAACACTATTATAGGGGG + Intergenic
1081477939 11:43453856-43453878 GTTCTGAACACATTTAAAAAAGG - Intronic
1086339558 11:85834687-85834709 GTTCTGAGGACATTTAAGGCAGG + Intergenic
1086418276 11:86611435-86611457 GTTCTCAACACAAAAAAAGGTGG + Intronic
1086725902 11:90183767-90183789 GTTCTGAGCACATTTAAGGTAGG + Intronic
1087115628 11:94521445-94521467 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1087349771 11:97017086-97017108 GTTCAGAGCATAAGAAAAGGAGG + Intergenic
1087759497 11:102090585-102090607 GTTCTAAGCACATTTAAGGCAGG - Intergenic
1087969644 11:104463913-104463935 GTTCTGAGCACATTTAAGGTAGG - Intergenic
1087973067 11:104509653-104509675 GTTCTGAGCACATATAAGGTAGG + Intergenic
1088095292 11:106092869-106092891 ATTCTGAGCACATTTAAGGTAGG + Intronic
1088197303 11:107289219-107289241 GTTCTGAGCACATTTAATGTAGG - Intergenic
1088464718 11:110122749-110122771 GTTCTGAGTACATTTAAGGTAGG + Intronic
1088910783 11:114190382-114190404 GTTCTGAGCACATTTAAGGTAGG - Intronic
1088927261 11:114314899-114314921 GTTCTGAGCATATTTAAGGTAGG + Intergenic
1088961028 11:114664915-114664937 GTTCAGAGCACATTTAAAGTGGG + Intergenic
1089525054 11:119091782-119091804 GTTCTGAGCACATGTAAGGTAGG + Intronic
1090262591 11:125332162-125332184 GTTCTGTGAACAATAAATGGTGG + Intronic
1090724112 11:129507328-129507350 ATCCTGAGCACATTTAAAGTAGG - Intergenic
1090755735 11:129789589-129789611 GTTCTGAGCACATTTAAGATAGG - Intergenic
1090773297 11:129941771-129941793 GTTCTGATCACATTTAAGGCAGG + Intronic
1091418465 12:312735-312757 GTTCTGAGCACCTTTAAGGTAGG - Intronic
1091717902 12:2793152-2793174 GTGCCGAACAGAATTAAAGGGGG + Intergenic
1092949675 12:13489864-13489886 GTTCTGGGCACATTTAAGGTAGG + Intergenic
1093552566 12:20432452-20432474 GTTCTTATCACAAAAAAAGGTGG + Intronic
1093862178 12:24179710-24179732 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1093890401 12:24513187-24513209 GTTCTGAGCAGGATTAAGGTAGG + Intergenic
1093922585 12:24875981-24876003 GTTCTGAGCACATTTAAGATAGG - Intronic
1094100741 12:26759653-26759675 GTGCAGAGCACAACTAAAGCAGG + Intronic
1094107000 12:26824117-26824139 GTTCTGAGAACACGTAAAGAAGG - Intronic
1094122824 12:26992192-26992214 GTTCTGAGCACATTTAAGGTAGG - Intronic
1094497772 12:30999452-30999474 GTTCTGAGCACGTTTAAGGTAGG - Intergenic
1095408336 12:41892863-41892885 GTTCTCAGCACATTTAAGGTAGG - Intergenic
1095876453 12:47084162-47084184 GTTCTGTGCACATTTAAGGCAGG - Intronic
1095891688 12:47240712-47240734 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1096995954 12:55838421-55838443 GTTCGGAGCCAAATTAAAGGTGG - Intronic
1097689680 12:62723041-62723063 GTTCTGAGCACATTTAAGGTAGG - Intronic
1097993357 12:65860171-65860193 GTTCTGAGCATATTTAAGGTAGG - Intronic
1098574131 12:72021601-72021623 GTTCTGAGCACTGTTAAGGTAGG + Intronic
1099397226 12:82155915-82155937 GTTCTGAGCACGTTTAAGGTAGG + Intergenic
1099419152 12:82431812-82431834 GTTCTGACCACATTTAAAGTAGG - Intronic
1099685852 12:85887782-85887804 GTTCTGTGTACATTTAAAGCAGG + Intergenic
1099867201 12:88297900-88297922 GTTCTGAACACATTTAAGGTAGG - Intergenic
1100135752 12:91551324-91551346 GTTCTGAGCATGTTTAAAGTAGG + Intergenic
1100324441 12:93527788-93527810 GTCCTGAGCACAGTTAAGGTAGG - Intergenic
1100922636 12:99505896-99505918 GTTCTGAGCACATTTAAGGTAGG - Intronic
1100945875 12:99783276-99783298 GTTCTGAGCATATTTAAAGTAGG - Intronic
1102384341 12:112494939-112494961 GTTCTGAGCACGTTTAAAGTAGG + Intronic
1103056167 12:117822541-117822563 GTTCTGAGCACATTTAAGGTAGG - Intronic
1103422529 12:120799189-120799211 GTTCTGAGCACGTTTAAGGTAGG - Intronic
1104766217 12:131332069-131332091 GTTCTGAGCATGTTTAAAGTAGG + Intergenic
1105283745 13:18986853-18986875 GATCAGAGCAGAATTGAAGGAGG + Intergenic
1105545889 13:21350821-21350843 GTTTTGAGCACACTTAAGGTAGG - Intergenic
1105730407 13:23209728-23209750 GTTCTGAGCATATTTAAGGTGGG + Intronic
1105756018 13:23465359-23465381 GTTCTGAGCACGTTTAAGGTAGG + Intergenic
1105774234 13:23641894-23641916 GTACTGAGCACATTTAAAGCAGG - Intronic
1105791378 13:23802895-23802917 ATTCTGAGCACATTTAAGGTAGG + Intronic
1106323107 13:28660443-28660465 GTTCTGAGCACATTTAAGGTAGG + Intronic
1106453599 13:29907455-29907477 GTTCTGAGCACGTTTAAGGAAGG + Intergenic
1106506507 13:30375311-30375333 GTTCTGAGCACGTTTAAGGGAGG - Intergenic
1106889585 13:34229819-34229841 GTTCTGAGCACGTTTAAGGTAGG - Intergenic
1107607404 13:42073588-42073610 GTTCTGAGCACATGTAAAGTAGG + Intronic
1107672133 13:42757024-42757046 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1107844025 13:44492228-44492250 GTTCTGAGCACATTTAAGGTAGG - Intronic
1108015411 13:46070227-46070249 GTTCTGAGCACATTTAAGGAAGG + Intronic
1109153987 13:58881382-58881404 GTTCTGAGCACATTTAAGAGAGG - Intergenic
1109987956 13:70015685-70015707 GTTCTGAGCACCTTTAAGGTAGG + Intronic
1109994106 13:70100673-70100695 AATCTGAGCAAAATTAAAGATGG - Intronic
1110950379 13:81480995-81481017 ATTCTGAGCATATTTAAAGTAGG - Intergenic
1111125003 13:83903893-83903915 GTTCTGAGAATATTTAAAGTTGG - Intergenic
1111489655 13:88955206-88955228 GTTCTGAGTACATTTAAGGTAGG - Intergenic
1111666389 13:91273753-91273775 GTTCTGAGCACGTTTAAGGTAGG - Intergenic
1111947346 13:94679740-94679762 GTTCTGATCACAAATAAAGTAGG - Intergenic
1113113465 13:106849377-106849399 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1113236999 13:108288454-108288476 GTTCTGAGCACATTTATGGTAGG - Intronic
1114786451 14:25605326-25605348 GTACTGAGCACATTTAAATTAGG - Intergenic
1117371521 14:55082795-55082817 GTTCTAAGCACATTTAAGGTAGG - Intergenic
1118098598 14:62568968-62568990 GTTCTGAGCACACTTAAGGTAGG + Intergenic
1118417005 14:65550358-65550380 GTTCTGGGCACATTTAAGGTAGG - Intronic
1118618674 14:67594835-67594857 GTTCTGAGCACGTTTAAGGTAGG - Intronic
1119669228 14:76506166-76506188 GTTCTTAGCACACTTCAACGGGG - Intergenic
1119764050 14:77177183-77177205 ATTCTGAGCACATTTAAGGTAGG + Intronic
1120224904 14:81779673-81779695 GTTTTGAGGACAATTAAATAAGG - Intergenic
1120293898 14:82614120-82614142 GTTCTGAGCACATTTGAGGTAGG + Intergenic
1120767805 14:88346658-88346680 GTTCTGAGCACATTTAAGATAGG + Intergenic
1121370403 14:93352888-93352910 GTTCTGAGCACGTTTAAGGTAGG - Intronic
1121588823 14:95083519-95083541 GTTCTGAGCACATTTACATTAGG + Intergenic
1122569131 14:102682688-102682710 GTTCTGAGTACAATTTAAGATGG - Intronic
1123727158 15:23114568-23114590 GTTCTGAGCACATGTAAGGTAGG - Intergenic
1123929587 15:25157727-25157749 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1123986647 15:25652436-25652458 GTTGTCAGCAGAATCAAAGGAGG - Intergenic
1124234685 15:27979208-27979230 GTTCTGAGCACATTTAAGGTGGG + Intronic
1124579091 15:30936716-30936738 ATTCTGAGCACATTTAAGGTAGG - Intronic
1124821448 15:33050112-33050134 GTTCTGAGCATATTTAAGGTAGG + Intronic
1126447999 15:48771782-48771804 GTTCTGAGCACATTTAAGGTAGG - Intronic
1126476960 15:49075516-49075538 GTTCTGAGCACATTTAAGGCAGG + Intergenic
1126526410 15:49660316-49660338 GTTCTGAGCACGTTTAAGGTAGG - Intergenic
1126696006 15:51325911-51325933 GTTCTGAGCACATTTAAGGTAGG - Intronic
1126896889 15:53267666-53267688 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1127118713 15:55752790-55752812 GTTCTGAGCACGTTTAAGGTAGG + Intergenic
1127367884 15:58308751-58308773 GTTCTGAGCCCATTTAAGGTAGG + Intronic
1127572640 15:60259244-60259266 GTTCTGAGCACAGTTTAGAGTGG - Intergenic
1128481473 15:68043765-68043787 GTTCTGAGCACATTTAAGGTAGG - Intergenic
1128829515 15:70754449-70754471 GTTCTGAGCATGTTTAAAGAAGG + Intronic
1128970838 15:72104252-72104274 GTTCTGAGCGCATTTAAGGAAGG + Intronic
1129290330 15:74561974-74561996 GTTCTGAGCACGTTTAAGGTAGG + Intronic
1130359887 15:83173365-83173387 GTTCTCAGCACATTTAAGGCAGG + Intronic
1130870062 15:87963629-87963651 GTTCTGAGCACATTTAAGGTAGG + Intronic
1132426447 15:101721982-101722004 GTTCTGAGCACTTTTAATGTAGG + Intronic
1132446786 15:101930158-101930180 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1134163563 16:11912550-11912572 GTTCTGAGAAGCATTAAAGGTGG + Intronic
1135255031 16:20934434-20934456 GTTCTAAGCACATTTAAGGGAGG - Intronic
1135292978 16:21256126-21256148 GTTCTGAGCACATTTAAGGTAGG + Intronic
1135501041 16:22995953-22995975 GTTGTGAGCACATTTAAAGTAGG - Intergenic
1137987891 16:53125765-53125787 GTTCTGAGCACATTTAAGGTAGG + Intronic
1138937691 16:61749706-61749728 GTTCAGAGCAAAATAAAACGGGG - Intronic
1139072393 16:63398943-63398965 TTTCTGATCACAAATAATGGTGG - Intergenic
1139667984 16:68471657-68471679 GTTCTGAGGGCAATTAAGGCTGG - Intergenic
1139830777 16:69796379-69796401 GTCCTGAGCACATTTAAGGTAGG - Intronic
1140071530 16:71654624-71654646 GTTCTGAGCACACTTAACGTAGG + Intronic
1140152443 16:72383048-72383070 GTTCTGAGCACATTTAAGGTAGG - Intergenic
1140492827 16:75354165-75354187 GTTGTGAGCACATTTAAGGTAGG + Intronic
1140760103 16:78102220-78102242 GTTTTGAGCTCAAGTAGAGGTGG + Intronic
1140824993 16:78697691-78697713 GTTCTGAACACATTTAAGGTAGG + Intronic
1141483159 16:84320223-84320245 GTTCTGAGCACAGTTAAGGTAGG + Intronic
1141967473 16:87455906-87455928 GTTCTGAGCACATTTAAGGTAGG + Intronic
1142520990 17:504336-504358 GTTCTGAGCACGTTTAAGGTAGG - Intergenic
1143243779 17:5466294-5466316 GTTCCGAGCACACTGAAAGTAGG + Intronic
1143438859 17:6952272-6952294 GTTCTGAGCACATTTAAGGTAGG + Intronic
1144000770 17:11052777-11052799 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1144354668 17:14433886-14433908 GTTCTCAACACAATTAAAAATGG - Intergenic
1144886400 17:18465854-18465876 GTTCTGAGCACGTGTAAAGTAGG + Intergenic
1145042437 17:19587002-19587024 GTTCTGAGCACGTTTAAAGTGGG + Intergenic
1145145808 17:20478457-20478479 GTTCTGAGCACGTGTAAAGTAGG - Intergenic
1145763542 17:27442306-27442328 GTTCTGAGCACATTTAAAGTAGG + Intergenic
1146105245 17:30029306-30029328 GTTCTGAGCACATTTAAGATGGG - Intronic
1146477946 17:33178018-33178040 GTTCTGTGTACAATTCAAGGGGG + Intronic
1147330865 17:39698652-39698674 GTGCTGAGCACACTTAAAGCAGG - Intronic
1147380399 17:40051985-40052007 GTTCTGAGCACATTTACGGTAGG + Intronic
1147901544 17:43789525-43789547 GTTCTGAGCACATTTAAGTTAGG + Intergenic
1149663466 17:58349406-58349428 GTTCTGAGCACATTTGAAGTAGG + Intronic
1149790136 17:59469546-59469568 ATTCTGAACACAATTAAGGTAGG - Intergenic
1149813284 17:59698724-59698746 GTTCTGAGCACATTTAAGGTAGG - Exonic
1149813662 17:59702939-59702961 GTTCTGAGCACCTTTAAGGTAGG + Intronic
1150096920 17:62384968-62384990 GTTCTGAGCACATTTAAGGTAGG + Intronic
1151028639 17:70709022-70709044 GTTCTGAGCACATTTAAGGTAGG - Intergenic
1151372964 17:73660911-73660933 GTTCTGAGCACATTTGAAGTAGG + Intergenic
1153011281 18:541877-541899 GTTCTGAGCACTCATAAAGTTGG + Intergenic
1153745228 18:8171839-8171861 GTTCTGAGCACATTTAAGGGAGG - Intronic
1155283635 18:24266377-24266399 GTTCTGAGAAGAAGGAAAGGGGG + Intronic
1155588590 18:27398254-27398276 GTTTTGAGCACATTTAAGGTAGG + Intergenic
1156282009 18:35648349-35648371 GTTCTGAGCACATTTAAGGTAGG + Intronic
1157084703 18:44567780-44567802 GTTCTGAGCACATTTGAGGTAGG + Intergenic
1157135477 18:45050108-45050130 GTTGTAATCACAATTAAATGAGG + Intronic
1158516834 18:58137930-58137952 GGTCTGAGCACACTGAAAAGAGG - Intronic
1159147381 18:64471437-64471459 GTTCTGAGCACATTTAAGGTAGG - Intergenic
1159314439 18:66753362-66753384 GTTCTGACCACCATCAAATGAGG - Intergenic
1159647122 18:70932181-70932203 GTTCTGAGCACACTTGAGGGAGG + Intergenic
1160638433 19:102059-102081 GTTCTGAGCACATTTAAGGTAGG - Intergenic
1163013190 19:14438191-14438213 GTTCTGAGCACATTTAAGGTAGG + Intronic
1163099409 19:15085054-15085076 GTTCTGAGCACATTGAAGGTGGG + Intergenic
1165701955 19:37945017-37945039 GTTCTGAGCACATTTAAGGAAGG - Intronic
1166792092 19:45404560-45404582 TCTCTGAGCAGAATTAAGGGTGG - Intronic
925655885 2:6148634-6148656 ATTCTGAGCACATTTAAGGGAGG - Intergenic
926030607 2:9583747-9583769 GTTCTGGGCACATTTAATGTAGG + Intergenic
926503725 2:13684993-13685015 GTGCTCAGCATAATTAAAAGTGG + Intergenic
927831075 2:26350956-26350978 GTTCTGAGCACATTTAAGGTAGG - Intronic
927986218 2:27412807-27412829 TTTGTGAACACAATTAAATGTGG - Intergenic
928048264 2:27961482-27961504 GTTCTGAGCACATTTAAGGTAGG + Intronic
928334046 2:30380771-30380793 GTTCTGAGCACATTTCAGGTAGG + Intergenic
928690693 2:33795434-33795456 GGTCTGAACACACTTAAAGCAGG - Intergenic
928707750 2:33969021-33969043 GTTGTGAGCACACTTAAGGTAGG - Intergenic
928727167 2:34187931-34187953 GTTCTGAACACATTTAAGGTAGG - Intergenic
928859311 2:35837109-35837131 GTTCTGAGCACATGTAAGGTAGG + Intergenic
929490991 2:42396014-42396036 GTTCTGAGCATGTTTAAAGTAGG - Intronic
929983977 2:46707883-46707905 GCTCTGAGCACATTTAAGGTAGG - Intronic
930194336 2:48494337-48494359 GTTTTGAGCACATTTAAGGCAGG - Intronic
930773042 2:55146922-55146944 GTTCTGAGCATGTTTAAAGTAGG + Intergenic
931023328 2:58076309-58076331 GTTCTGAGCACATTTAAGGTAGG - Intronic
931615763 2:64155776-64155798 GTTCTGGGCACAATTAAGGTAGG + Intergenic
931624627 2:64245640-64245662 GTTCTGAGCACTTTTAATGTAGG - Intergenic
932035309 2:68240030-68240052 GTTCTAAGCACATTTAAGGTAGG + Intronic
933431143 2:82181257-82181279 GTTCTGATCACATTTAAGGTAGG + Intergenic
935227378 2:101064749-101064771 GTTCTGAGAACAACCAGAGGTGG + Intronic
936054608 2:109252688-109252710 GTTCTGAGTACATTTAAAGTAGG - Intronic
937133386 2:119530225-119530247 GTTCTGTGCCCAATTAAAAAGGG + Intergenic
937192270 2:120114460-120114482 GTTCTGAGCACAGTTAATGTAGG + Intronic
938398643 2:130969107-130969129 GTTCTGAGCACATTTAAGGTAGG - Intronic
938944155 2:136195848-136195870 GTTCTGAGCACGTTTAAATTAGG - Intergenic
939082784 2:137683366-137683388 GTTCTGAGCACATTAGAAAGTGG + Intergenic
939207356 2:139124214-139124236 GTTTAGAGCAAAATTATAGGAGG + Intergenic
939440144 2:142237494-142237516 GTTCTGAGCACATTTAAGGTAGG + Intergenic
939670313 2:145002731-145002753 GTTCTGAGCACATTTAAGGTAGG - Intergenic
939670342 2:145003054-145003076 GTTCTGAGCACTTTTAAGGTAGG + Intergenic
939684133 2:145176791-145176813 GTTCTGAGCACATTTAAAATAGG + Intergenic
940288100 2:152052154-152052176 ATTCTGAGCACACTTAAGGTAGG - Intronic
941064110 2:160881428-160881450 GTTCTGAGGACATTTAAGGTAGG - Intergenic
941311085 2:163932735-163932757 GTTCTGAGCACATTTAAGGTAGG + Intergenic
942125938 2:172825192-172825214 GTTCTGAGCACATTTAAGGTGGG - Intronic
942194758 2:173506426-173506448 CTTCTGAGAACAATTAAAAGAGG - Intergenic
943056127 2:182982640-182982662 GTTCTGAGCACATTGAAGGTAGG + Intronic
943272126 2:185819762-185819784 GTTCTGAGCACATTTAAGGTAGG + Intronic
943314879 2:186374953-186374975 GTTTTGAGCACATTTAAAGTAGG + Intergenic
943445080 2:187974667-187974689 GTTCTGAGCACATTTAAGGTAGG + Intergenic
943591112 2:189798016-189798038 GTTCTGAGCATGTTTAAAGTAGG - Intronic
944380021 2:199097681-199097703 GTTCTGAGCACATTTAAAGTAGG - Intergenic
944567683 2:201007312-201007334 GTTCTGAGCACATTTAAGGTAGG - Intronic
945138883 2:206662194-206662216 GTTCTGAGCACATTTAAGGTAGG + Intronic
945816630 2:214612931-214612953 GTTCTGAGCACGTTTAAGGTAGG + Intergenic
945945508 2:215991538-215991560 GATCAGAGCAGAATTGAAGGAGG + Intronic
945961786 2:216143021-216143043 GTTTTGAGCACATTTAAAGTAGG - Intronic
946546836 2:220753019-220753041 GTTCTGAGCACATTTAAGGTAGG - Intergenic
947335188 2:229075072-229075094 GTTCTGAGCACATTTATGGTAGG - Intronic
947626352 2:231621528-231621550 ATTCTGAGCACAGATAATGGAGG - Intergenic
947629942 2:231645571-231645593 GTTCTGAGCACATTTAAGGCAGG + Intergenic
948018664 2:234712095-234712117 GTCCTGAGCACGTTTAAGGGAGG - Intergenic
948034303 2:234845710-234845732 GTTCTGTGCACATTTAAGGTAGG - Intergenic
948979851 2:241488042-241488064 GTTCTGAGCACATTTAGAGTAGG - Intronic
949005792 2:241646715-241646737 GTTCTGAGCACATTTAAGGCAGG + Intronic
1168742933 20:209941-209963 ATTCTGAGCACATTTAAGGCAGG - Intergenic
1169095315 20:2892640-2892662 GTTCTGAACACATTTAAGGTAGG + Intronic
1169233172 20:3906501-3906523 GTTCTAAGCACATTTAAGGTAGG - Intronic
1169793808 20:9440251-9440273 GTTCTGAGCACATTTAAAATAGG - Intronic
1169989634 20:11486813-11486835 GTTCTGAGCACGATGAAGGCAGG + Intergenic
1170096112 20:12647666-12647688 GTTCTGAGCACATTTAAAGTAGG + Intergenic
1170444764 20:16414958-16414980 GTTCTGAGCATATTTAAGGTAGG + Intronic
1170449148 20:16463798-16463820 GCTCTCAACAAAATTAAAGGAGG + Intronic
1171024575 20:21617503-21617525 GTTCTGAGCACATTTAATGTAGG - Intergenic
1171328340 20:24315849-24315871 GTTCTCAGCACATTTAAGGTAGG - Intergenic
1173385369 20:42582461-42582483 GTTTTGTGCACAACTATAGGTGG - Intronic
1173995347 20:47334027-47334049 GTTCTGAGCACATTTAAGGTAGG - Intronic
1174500824 20:50982663-50982685 GCTCTGAGCACAATTTGAGCTGG - Intergenic
1174525988 20:51171861-51171883 GTTCTGAGCACATTTAAGATAGG + Intergenic
1175727425 20:61328995-61329017 GTTCCGAGCACGGTTAAGGGAGG - Intronic
1176975040 21:15311244-15311266 GTTCTGAGCACATTTAATATAGG + Intergenic
1178293838 21:31392063-31392085 GTTTTGAGCACATTTAAGGTAGG + Intronic
1178778834 21:35579975-35579997 GCTCTGATCACTATTAAAGATGG - Intronic
1178869794 21:36363497-36363519 GTTCTGAGCACAATTAAGGTAGG - Intronic
1179346304 21:40560646-40560668 GTTCTGAGCACATTTCAAGTAGG - Intronic
1179370047 21:40797270-40797292 GTTCTCATCATAATTAAGGGAGG + Intronic
1181460707 22:23084383-23084405 GTTCTGAGCACATTTAAGGTAGG + Intronic
1182218085 22:28736090-28736112 GTTCTGAGCATGTTTAAAGGAGG + Intronic
1183286903 22:36972168-36972190 GTTCTGAAAATAATAAAAGGTGG + Intergenic
1183402677 22:37613875-37613897 GTTCTCAGCAGAATCAGAGGAGG + Intronic
1183696328 22:39425482-39425504 GTTCTGAGCACATTTAAGGTAGG + Intronic
1184433258 22:44454094-44454116 CTTCTCAACCCAATTAAAGGTGG - Intergenic
1184442766 22:44528397-44528419 GTTCTGAAGACAATAAAAGATGG + Intergenic
1184687131 22:46101591-46101613 GTTCTGAGCACGTTTCAGGGAGG - Intronic
1184917006 22:47576243-47576265 GTTCTGAGCACATTGAAGGTGGG - Intergenic
949382495 3:3461732-3461754 ATTCTGAGCACATTTAAGGTAGG - Intergenic
949902443 3:8828222-8828244 GTTCTGAGCACATTTAAGGTAGG + Intronic
949907107 3:8866871-8866893 GTTCTGAGCACATTCAACGCAGG + Intronic
949934425 3:9105882-9105904 GTTCTGAGCACGTTTAAGGTAGG - Intronic
950233866 3:11300865-11300887 GTTCTGGGCACGTTTAAGGGAGG + Intronic
950245211 3:11409451-11409473 GTTCTGAACACGTTTAAGGGAGG + Intronic
950529933 3:13547484-13547506 GTTCTGAGCACATTTAAGGTAGG + Intergenic
950615340 3:14153505-14153527 GTTCTCAGCACGTTTAAGGGAGG + Intronic
951540109 3:23774390-23774412 GTTCTGAGCACATTTAAAGCAGG + Intergenic
951675257 3:25232893-25232915 GTTCTGAGCACATTTAAGGCAGG + Intronic
952725300 3:36578008-36578030 GTTCTGAGCACATTTAAGGTAGG + Intergenic
952839575 3:37633406-37633428 GTTCTGAACACATTTAAGGTAGG - Intronic
953029490 3:39169094-39169116 GTTCTGAACACATTTAAAGTAGG - Intergenic
953270314 3:41436213-41436235 GTTCTGAGCACATATAAGGTAGG + Intronic
953298659 3:41749544-41749566 GTTCTGAGCACATTTAAGGTAGG + Intronic
953859770 3:46533544-46533566 GTTCTCAGCACATTTAAGGTAGG - Intronic
954493324 3:50928989-50929011 GTTCTGAGCACATTTAAGGGAGG + Intronic
956782667 3:72616660-72616682 GTTCTGAGAACAATGGGAGGTGG + Intergenic
956870795 3:73415699-73415721 GTTCTGAACATATTTAAGGGAGG + Intronic
957489731 3:80908157-80908179 GATCAGAGCAGAATTGAAGGCGG + Intergenic
957675770 3:83362207-83362229 GTTCTGAGCACATTTACGGTGGG + Intergenic
957918383 3:86715950-86715972 TTTCTGAGCACATTTAAGGTAGG - Intergenic
958164472 3:89861977-89861999 GTTCTGAGCATATTTAAGGTAGG - Intergenic
960233751 3:115257793-115257815 GATCAGAGCAGAATTGAAGGAGG + Intergenic
960357940 3:116676771-116676793 GTTCTGAGCACTTTTAAGGTAGG - Intronic
960476365 3:118133938-118133960 CTTCTGAGCACATTTAAGGTAGG - Intergenic
960675252 3:120187316-120187338 GTTCTGAGCACATTAAAGGTAGG - Intronic
960800119 3:121530345-121530367 GTTCTGAGAACATTTAAGGTAGG + Intronic
961054037 3:123771749-123771771 GTTCTGAGCATGTTTAAGGGAGG - Intronic
962168291 3:133074420-133074442 GTTCTGAACACATTTAAGGTAGG - Intronic
962307694 3:134302934-134302956 GGTCTGAGCACATTTAAGGTAGG + Intergenic
962510584 3:136095989-136096011 GTTCTGAGCATATTTAAGGCTGG - Intronic
963926089 3:150952416-150952438 GTCCTGAGCACATTTAACGTAGG + Intronic
964250099 3:154704614-154704636 GTTCTGAGCACATTTAAGGTGGG - Intergenic
964390597 3:156193441-156193463 GTTCTGAGCATGTTTAAAGTGGG + Intronic
964502205 3:157360640-157360662 ATTCTGAGCACATTTAAGGTAGG - Intronic
964831971 3:160894006-160894028 GTTCTGAGCACATTTAAGGTAGG + Intronic
965068367 3:163882599-163882621 GCTCTGAGCACATTTAAGGTAGG + Intergenic
965482469 3:169236139-169236161 GTCCTGAGCACATTTAAGGTAGG + Intronic
965525191 3:169709129-169709151 GTTCTGAGCACATTTAAGGTAGG - Intergenic
966518693 3:180848971-180848993 GTTCTGAGCACATTTAAGGTAGG + Intronic
966558125 3:181286575-181286597 GTTCTGAAGAGAGTTAAAGGGGG + Intergenic
967842498 3:194018141-194018163 TTTCTGAGCACACTTAAACCTGG - Intergenic
967897126 3:194406227-194406249 CTTCTGAGCACAACGAATGGGGG + Intronic
968325900 3:197815347-197815369 GTTTTGAGCACATTTAAAGTAGG - Intronic
969068005 4:4505278-4505300 GTACTGAGCACACTTAAGGTAGG - Intronic
969979299 4:11138192-11138214 GATCTGAGAGCAATTAAAGCAGG + Intergenic
970217435 4:13774797-13774819 GTTCTAAGCACTTTTAAAGTAGG + Intergenic
972352185 4:38246063-38246085 GTTCTGAGCACCTTTAAGGCAGG + Intergenic
972851088 4:43051868-43051890 ATTCTGAGCACATTTGAAGTAGG + Intergenic
973266431 4:48215581-48215603 GTTCTGAGCACATTTAAGGTAGG + Intronic
973800000 4:54468164-54468186 GTTCTGAGCACATTTAGTGTTGG + Intergenic
974246488 4:59326139-59326161 GTTCTGAGCACTTTTAAGGTAGG - Intergenic
974346279 4:60685795-60685817 GTTCTGAGTATATTTAAGGGAGG - Intergenic
975566679 4:75763458-75763480 GTTCTGGGCACATTTAAAGTAGG + Intronic
975601723 4:76107104-76107126 GTTCTGAGCACGTTTAAGGTAGG + Intronic
975604030 4:76134910-76134932 GTTCTGAGCATGTTTAAAGTAGG + Intronic
976172129 4:82315218-82315240 GTTTTGAGCACATTTAAGGTAGG + Intergenic
976469823 4:85415306-85415328 GTTCTGAGCACATTTAAAGTAGG - Intergenic
976684093 4:87791452-87791474 GTCCTGAGCACATTTAAGGTAGG - Intergenic
977631853 4:99251903-99251925 GTTCTGAGCACGTTTAAGGAAGG - Intergenic
977934614 4:102786941-102786963 GTTCAGAGCACATTTAAAGTAGG - Intergenic
978161001 4:105548108-105548130 GTGCTGTGCACTATTATAGGAGG - Intergenic
978216509 4:106211120-106211142 GTGCTGAGCACAATTTAATTAGG + Intronic
978400304 4:108323974-108323996 GTTCTGAGCAAATTTAAGGCAGG + Intergenic
978913470 4:114094887-114094909 GTACTGAGCACATTTAAGGTAGG - Intergenic
979083512 4:116374774-116374796 GTTCTGAGCACTATTAAGGTAGG + Intergenic
979164496 4:117510436-117510458 GTTCGGAGCACATTTAAAATAGG - Intergenic
979401038 4:120250061-120250083 GTTCTGAGCATGTTTAAAGTAGG + Intergenic
979994642 4:127415889-127415911 GTTCTGAGCACATTTAAGGTAGG + Intergenic
980023015 4:127731346-127731368 GTTCTGCCCAAAATTCAAGGGGG + Intronic
980321294 4:131280923-131280945 GTTCTGAGCCTGATTAAGGGAGG + Intergenic
980608097 4:135120202-135120224 GTTCTAAGCACATTTAAGGTAGG - Intergenic
980706708 4:136506165-136506187 GTTTTGAGCACATTTAAAAAAGG - Intergenic
981101741 4:140836582-140836604 GTTCTGAGCGCGTTTAAAGTAGG - Intergenic
981361771 4:143854167-143854189 GTTCTGAGCTTATTTAAAGTAGG - Intergenic
981372503 4:143975070-143975092 GTTCTGAGCTTATTTAAAGTAGG - Intergenic
981562249 4:146060517-146060539 GTTCTGAGCACATTTAAGGCAGG - Intergenic
981982693 4:150813842-150813864 GTTCTGAGCACATTTAAGATAGG + Intronic
982659222 4:158187163-158187185 TTTCTGAGCATATTTAAAGTAGG + Intergenic
983324404 4:166234970-166234992 GTTCTGAACACATTTAAGGTAGG - Intergenic
984153958 4:176170955-176170977 GTTCTGAGCACGTTTAAGGAAGG - Intronic
984158688 4:176225210-176225232 GTTCTGTGCACATGGAAAGGGGG + Intronic
984248944 4:177308821-177308843 GTTCTGAACACATTTAAGGAGGG - Intergenic
984395383 4:179191367-179191389 TTTCTGAGCACATTTAAAGTAGG + Intergenic
984981616 4:185287458-185287480 GTTCTGAGAACTATTTAAGACGG + Intronic
985270935 4:188194513-188194535 GTTCAGAGCACACTTAAGGTAGG - Intergenic
985342559 4:188970864-188970886 GCTCTGAGCACATTTAAGGTAGG - Intergenic
986053749 5:4115212-4115234 GTTCTGAGCACGTTTAAGGTAGG - Intergenic
986925634 5:12745324-12745346 GTTCTGAGCACATTTAACATAGG - Intergenic
987318956 5:16749846-16749868 GTTCAGGGCAGAATTAAAGAAGG - Intronic
987440968 5:17956067-17956089 GTTCTGAGAACACTTAAACAAGG + Intergenic
987523136 5:19013256-19013278 GTTCTGAGCACATTTAAGGTAGG + Intergenic
987557638 5:19475335-19475357 GTTCTGAGCACATTTAAGGTAGG - Intronic
988114610 5:26868612-26868634 GTTCTGAGCACATGTAAGGTAGG - Intergenic
988700405 5:33668170-33668192 GTTCTGAGCACACTTAACGTAGG - Intronic
989562284 5:42865944-42865966 GATCAGAGCAGAACTAAAGGAGG + Intronic
989982407 5:50660203-50660225 ATTCTGAGCACATTTAAGGTAGG - Intergenic
990355990 5:54966665-54966687 GTTGTGAGCACATTTAAGGTAGG - Intergenic
990469031 5:56096727-56096749 GTTCTGAGCACATTAAAGGTAGG + Intergenic
990931601 5:61097323-61097345 GTTCTGAACACATTTAAAGTAGG - Intronic
991229694 5:64317870-64317892 GTTCTGAGCACATTTAAGGTAGG - Intronic
991358206 5:65791759-65791781 CTTCTGAGCAAAAGAAAAGGGGG + Intronic
991375288 5:65958875-65958897 GTTCTGAGCATGCTTAAAGTAGG + Intronic
991385995 5:66090757-66090779 ATTCTGAGCACATTTAAAGTAGG - Intergenic
992476349 5:77105439-77105461 GTTCTGAGCACATTTAATGTAGG + Intergenic
992883768 5:81137264-81137286 GTCCTGAGCACATTTAAGGTGGG + Intronic
992959423 5:81943966-81943988 GTTCTGAGCACATTTAAGCTAGG + Intergenic
993527813 5:88988273-88988295 GTTCTGAGCACGTTTAACGTGGG + Intergenic
994714605 5:103306601-103306623 GTTCTGAGTACATTTAAGGTAGG + Intergenic
994928078 5:106145486-106145508 GTTGAGTGCATAATTAAAGGGGG + Intergenic
994958876 5:106572071-106572093 GTTCAGAGAATAATTGAAGGTGG + Intergenic
995085256 5:108101449-108101471 GTGCTGGGCCCAATCAAAGGAGG + Intronic
995359837 5:111282864-111282886 GTTCTGAGCACATTTAAGGCAGG - Intronic
995548942 5:113261168-113261190 GTTTTGAGCACGTTTAAAGTAGG - Intronic
995674637 5:114649646-114649668 GTTCTGGGCTCAGTTAAAAGGGG + Intergenic
996569542 5:124917564-124917586 GTTCTAAGCACATTTAAGGTAGG + Intergenic
996959371 5:129227368-129227390 GTTCTGAGCACATTTAAAGTAGG + Intergenic
997110766 5:131071745-131071767 GTTCTGAGTACATTTAAGGTAGG + Intergenic
997754333 5:136381919-136381941 GTTCTCAGCACATTTAAGGTAGG - Intronic
997874173 5:137533638-137533660 GTTCTGAGGACGTTTAAAGTAGG - Intronic
997936966 5:138120932-138120954 GTTCTGAGCACATTTAAAGTAGG - Intronic
998588779 5:143455447-143455469 GTTCTTAGCACATTTAAGGTAGG - Intergenic
998899445 5:146837294-146837316 GTTCTGAGCCCATTTAAAGTAGG + Intronic
999054459 5:148559008-148559030 TTTCTGAGCACATTTAAGGTAGG - Intronic
1000624387 5:163522524-163522546 GTTCTGAGCATATTTAAGGTAGG + Intergenic
1001188743 5:169605417-169605439 TTTCTGAGCACATTTAAGGCAGG + Intergenic
1001228866 5:169968756-169968778 GTGATGAGCAAAATAAAAGGAGG + Intronic
1001359708 5:171069702-171069724 GTTCTGATCACATTTAAGGTAGG + Intronic
1002305299 5:178279513-178279535 GTTCTGGGCACAATTGAACCAGG - Intronic
1003343508 6:5244262-5244284 GTCCTGAGCACATTTAAAATTGG + Intronic
1003405719 6:5825633-5825655 GTTCTGAGCACACTTAAGGTAGG + Intergenic
1003887960 6:10537796-10537818 GTTCTGAGCATGTTTAAGGGAGG - Intronic
1004034627 6:11911407-11911429 GTTCTGAGCACATTTAACATAGG + Intergenic
1004487552 6:16081654-16081676 GTCCTGAGCACATTTCAGGGAGG + Intergenic
1005832867 6:29684734-29684756 GTTCTGAGCACATTTAAGGTAGG - Intergenic
1005879901 6:30048626-30048648 GTGCTGAGCACATTCAACGGGGG + Intergenic
1006869070 6:37234035-37234057 GTTCTTAGCACATTTAAGGTAGG + Intronic
1008168769 6:48175687-48175709 GTTCTGAGAACATTTAAGGTAGG - Intergenic
1009539728 6:64938705-64938727 GTTCTGAGCATGTTTAAGGGAGG + Intronic
1009772126 6:68157305-68157327 GTTCTGAGCACAAATCATGGAGG + Intergenic
1009848850 6:69170028-69170050 GTTCTAAGTACAATTAATGAAGG + Intronic
1009983557 6:70755526-70755548 GTTCTGAGCACATTTAATGTAGG + Intronic
1010604412 6:77870350-77870372 GATCTGAGCACATTTAAGGTAGG + Intronic
1010661794 6:78579983-78580005 GTTCTGAGCACGTTTAAGGTGGG + Intergenic
1010687119 6:78866327-78866349 GTGATGAGCCTAATTAAAGGAGG + Intergenic
1010694894 6:78959915-78959937 GTTCTGAGCACATTTGAGGTAGG - Intronic
1011045245 6:83074673-83074695 GTTCTGAGCACATTTAAGGTAGG + Intronic
1011096351 6:83668970-83668992 GTTCTCAGCACATTTAAGGTAGG - Intronic
1011439748 6:87375002-87375024 GTTCTGAGCACATTCAAGGTAGG + Intronic
1011949479 6:92946418-92946440 GTTCAGAGCACATTTAAGGTGGG - Intergenic
1012349950 6:98237639-98237661 GTTCTGAGCACATTTAAGGTAGG - Intergenic
1012598263 6:101065143-101065165 GATCAGAGCAGAATTGAAGGAGG + Intergenic
1012844126 6:104368225-104368247 GTTCTTACCACAATAAAAGATGG - Intergenic
1013032752 6:106351318-106351340 GTTCTGAGCACTTTTAAGGTAGG - Intergenic
1013400270 6:109788091-109788113 GTTCTGAGCACTTTTAAGGTAGG + Intronic
1013758724 6:113491104-113491126 GTTCTGAGCACATTTAATATAGG - Intergenic
1013758777 6:113491807-113491829 GTTCTGAGCACATTTAAAATAGG - Intergenic
1013801174 6:113945823-113945845 GTTCTGAGCACGTTTAAAGTAGG + Intronic
1013984549 6:116174455-116174477 GTTATGAGCATAATTTAAGTTGG - Intronic
1014473095 6:121839724-121839746 GTTCTGAGCACATTTAATTAAGG - Intergenic
1014685224 6:124489520-124489542 GTTTTGAGCACATTTAAGGTAGG - Intronic
1014689156 6:124540866-124540888 TTTCTGAGCACATTTAAGGTAGG + Intronic
1014790496 6:125666688-125666710 GTTCTGAGCAAATTTGAGGGAGG - Intergenic
1014973750 6:127851867-127851889 GTTCTGAGCACATTTAAGGTAGG - Intronic
1014975907 6:127883781-127883803 GTTCTGAGCACATTTAAGGTAGG + Intronic
1014990710 6:128072401-128072423 GTTCTGAGCACATTTAAGTTAGG - Intronic
1015123270 6:129724094-129724116 TTTCTGTGAACAATGAAAGGAGG + Intergenic
1015652050 6:135474085-135474107 GTTCTGAGCACACTTAAGGTAGG + Intronic
1015742185 6:136468559-136468581 GTTCTTAGCACATTTAAGGTAGG - Intronic
1015931323 6:138362863-138362885 GTTCTGAGCATGATTAAGGTAGG - Intergenic
1016236082 6:141868644-141868666 GCTCTGAGCACATTTAAGGTAGG + Intergenic
1016351444 6:143173378-143173400 GATCTCAGCAGAATTAAATGAGG - Intronic
1016972482 6:149777186-149777208 GTTCTGAGCACATTTAAGGTAGG - Intronic
1017183429 6:151576249-151576271 GTTCTGAGCACTTTTAAGGTAGG + Intronic
1017217634 6:151928273-151928295 GTTCTGAGCACATTTAAGGGAGG - Intronic
1017268120 6:152475358-152475380 GTTCTGAGCACATTTAATGTCGG - Intronic
1017288393 6:152705213-152705235 GTTCTGAGCACATTTAAGTTAGG - Intronic
1017527562 6:155255153-155255175 GTTCTGAGCACACTGAAGGCAGG + Intronic
1017902425 6:158729955-158729977 GTTATGAGCACAAAGCAAGGAGG - Intronic
1018234045 6:161705275-161705297 GTTCTGAGCACATTTAAGGTAGG - Intronic
1018300836 6:162401436-162401458 GTTCTGAACACATTTAAAGTAGG - Intronic
1018532140 6:164777017-164777039 GTTCTGAGCATATTTAAGGTAGG + Intergenic
1018614338 6:165672365-165672387 GTTCTCAGCACATTTAAGGCAGG - Intronic
1020550781 7:9601664-9601686 GTTCTGGGCACATTTAAGGTAGG - Intergenic
1021121658 7:16802422-16802444 GTTCTGAGCACATTTACGGTAGG - Intronic
1021129086 7:16889425-16889447 GTTCTGAACACATTTAAGGTAGG - Intergenic
1021908322 7:25358766-25358788 GGTCAGAAAACAATTAAAGGAGG - Intergenic
1022431011 7:30320637-30320659 GTTCTGAGCACATTTAAGGTAGG + Intronic
1022571119 7:31455207-31455229 GTTCTGAGCACATTTAAGGTAGG - Intergenic
1023304588 7:38811983-38812005 GTTCTGACTACAATTAAGGTAGG + Intronic
1024148698 7:46544387-46544409 GCTCTGAGTACAATTAACAGTGG + Intergenic
1024160537 7:46670395-46670417 GTTCTGAGCACCTTTAAAGCAGG - Intergenic
1024338719 7:48235949-48235971 GTTCTGAGCACAGTTCAGGTAGG + Intronic
1024368170 7:48547816-48547838 GTTCTGAGCACACTTAAGATAGG + Intronic
1024437650 7:49377661-49377683 GTGCCCAGCTCAATTAAAGGTGG + Intergenic
1024850602 7:53711635-53711657 GTTCTGAGCACATTTAAGGTAGG - Intergenic
1025714760 7:63944737-63944759 GATCAGAGCAGAATTGAAGGAGG + Intergenic
1026185131 7:68076671-68076693 GTTCTGAGTACATTTAAGGGAGG - Intergenic
1026881799 7:73910946-73910968 GTTCTGAGCACATTTAAGACAGG - Intergenic
1028324908 7:89510968-89510990 GTTCTGGGCACATTTACAGTAGG - Intergenic
1028547774 7:92023645-92023667 GTTCTCAACACAGTTAAAGCAGG + Intronic
1028952684 7:96654638-96654660 GTTCTGTGCACACTTAAGGTAGG + Intronic
1029239224 7:99146804-99146826 GTTCTGTGCACATTTAAGGTAGG - Intergenic
1029683165 7:102126614-102126636 GTTCTGAGCACGCTTAAAATAGG - Intronic
1030061424 7:105624334-105624356 TTTCTGAGCACCATTAAACTGGG - Intronic
1030069491 7:105686591-105686613 GTTCTGAGCACATTTAAGATAGG - Intronic
1030271377 7:107671845-107671867 GTTCTGAGCACATTTCAGGTAGG - Intronic
1030516694 7:110547883-110547905 GTTCTGTGCACATTTGAAGTAGG - Intergenic
1030646082 7:112063432-112063454 GTTCTGAGCACATTTAAGGTAGG - Intronic
1031018916 7:116605422-116605444 GTTCTGAGCAGGTTTAAAGTAGG - Intergenic
1031583677 7:123507362-123507384 ATTCTGAGCACACTTAAGGTAGG + Intronic
1031603298 7:123739611-123739633 GTTCTGAGCACATTTAAGGAAGG + Intronic
1032869355 7:135966274-135966296 GTTCTGAGCACATTCAAGGCGGG - Intronic
1033419110 7:141190210-141190232 ATTCTGAGCACACTTAAGGTAGG - Intronic
1034008465 7:147501672-147501694 GTTCTGAGCACATTTAAGTTTGG + Intronic
1034090933 7:148363349-148363371 GTTCTGAGCACATTTAAGGTAGG + Intronic
1035271828 7:157724610-157724632 GTTCTGAGCACACGTAAGGCAGG - Intronic
1035661775 8:1353496-1353518 GTTCTGAGCACGTTTAAGGTTGG + Intergenic
1036058659 8:5289864-5289886 GTTCTGAGCACATTGAAGGTAGG + Intergenic
1036173148 8:6509783-6509805 GTTCCGAGCACATTTAAGGAAGG - Intronic
1036799872 8:11782497-11782519 GTTCTGAGCACATATAAGGTAGG - Intronic
1036934465 8:12987752-12987774 GTTCTGAGCACGTTTAAGGTAGG - Intronic
1037188073 8:16088861-16088883 GTTCTTAGCACATTTAAGGTAGG - Intergenic
1037406747 8:18550582-18550604 GTTCTGAGCACATTTAAGGTAGG - Intronic
1037669492 8:21001999-21002021 GTTCTGAGGATCATAAAAGGAGG - Intergenic
1037940859 8:22949787-22949809 GTTCTGAGCACATTTAAGGTAGG + Intronic
1038641168 8:29329984-29330006 CTTCTGAGCACATTTAAGGTGGG - Intergenic
1039152286 8:34519527-34519549 GTTCTGAGCACATTTAAGATAGG - Intergenic
1039504107 8:38039336-38039358 GTTCTGAGCACATTTAAGGTAGG + Intronic
1039862414 8:41470122-41470144 GTTCTGAGCACTTTTAAGGCAGG - Intergenic
1041164945 8:55082115-55082137 GTTCTGAGCACGCTTACAGAAGG + Intergenic
1041487767 8:58397750-58397772 GTTCTGAGCACATTTCAGGTAGG + Intergenic
1041517103 8:58712711-58712733 ATTCTGAGCACATTTAAGGTAGG - Intergenic
1041685257 8:60638614-60638636 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1042900721 8:73724603-73724625 GTTCTGAGCACATTTAAGGTAGG + Intronic
1043256283 8:78141728-78141750 ATTTTGAGCACATTTAAAGTTGG + Intergenic
1043756321 8:84008218-84008240 GTTTTGAGCACACTTAAGGTAGG - Intergenic
1043886802 8:85610254-85610276 GTTCTGAGCATAATTAAGGTAGG - Intergenic
1044375613 8:91466782-91466804 GTTCTGTCCATATTTAAAGGAGG + Intergenic
1044377842 8:91497356-91497378 GATCAGAGCAGAACTAAAGGAGG - Intergenic
1045191298 8:99887105-99887127 GTTCTGAGCACATTTAAGGTAGG - Intronic
1045994420 8:108345615-108345637 GTTCTCAGGACAATTGAATGTGG + Intronic
1046632647 8:116636584-116636606 GTTCTGAGCACGTTTAAGGTAGG + Intergenic
1046639209 8:116706909-116706931 GTTCTGAATACATTTAAAGTGGG + Intronic
1047459878 8:125052916-125052938 GTTCTGAGCACATTTGAAGTAGG - Intronic
1047616446 8:126566253-126566275 GTTGTGAGCACAAATAGAGGTGG - Intergenic
1047944189 8:129858628-129858650 GTCATGACCACAATTAACGGTGG + Intronic
1048107130 8:131423469-131423491 GTTCTGAGCACATTTAAGATAGG + Intergenic
1048460687 8:134619170-134619192 GTTCTGAGCACATTTAAGATAGG - Intronic
1048700185 8:137079571-137079593 GTTCTGAGCACATTTAAGGTGGG - Intergenic
1048929510 8:139301062-139301084 GTTCTGAGCACATTTAAGGCAGG - Intergenic
1050054058 9:1633144-1633166 GTTCTGAGCACACCTAAGGTAGG + Intergenic
1050256697 9:3799885-3799907 GTTCTGAGCATGTTTAAAGCAGG + Intergenic
1051072741 9:13192397-13192419 GTTCTGAGCACAGTAAACTGTGG - Intronic
1052447032 9:28576108-28576130 GTTCTAAGCACATTTAAGGTAGG - Intronic
1052478048 9:28986736-28986758 GTTCTGAGCACTTTTAAGGTAGG - Intergenic
1052838622 9:33271638-33271660 GTTCTGAGCACAATTAAGGTAGG + Intronic
1053026057 9:34729304-34729326 GTTCTGAACTCAATTCATGGTGG + Exonic
1053034619 9:34813987-34814009 CTTCTGGGCAAAATCAAAGGTGG - Intergenic
1053186205 9:36018646-36018668 GTTTTGAGCACATTTAAGGTAGG + Intergenic
1053555783 9:39135695-39135717 GTTCTGAGCACATTTAAGTTAGG - Intronic
1053595925 9:39561698-39561720 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1053610474 9:39708308-39708330 GTTCTGAGCATGTTTAAAGTAGG - Intergenic
1053819901 9:41955952-41955974 GTTCTGAGCACATTTAAGTTAGG - Intronic
1053853892 9:42318339-42318361 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1053868512 9:42466338-42466360 GTTCTGAGCATGTTTAAAGTAGG - Intergenic
1054087778 9:60762848-60762870 GTTCTGAGCATGTTTAAAGTAGG + Intergenic
1054110170 9:61099612-61099634 GTTCTGAGCACATTTAAGTTAGG - Intergenic
1054243049 9:62634087-62634109 GTTCTGAGCATGTTTAAAGTAGG + Intergenic
1054557173 9:66668605-66668627 GTTCTGAGCATGTTTAAAGTAGG + Intergenic
1054570334 9:66803317-66803339 GTTCTGAGCACATTTAAGGTAGG - Intergenic
1054610687 9:67231513-67231535 GTTCTGAGCACATTTAAGTTAGG + Intergenic
1055445816 9:76381320-76381342 GTTCTGCCCACAAATAAATGAGG + Intergenic
1055459671 9:76507040-76507062 GTTCTGAGAACATTTAAGGTAGG - Exonic
1055699009 9:78920770-78920792 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1055703172 9:78968834-78968856 GTTCTAAGCACATTTAAGGTAGG - Intergenic
1055832240 9:80394622-80394644 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1056325277 9:85473186-85473208 GTGCTCACCACAATTGAAGGAGG + Intergenic
1056847065 9:90048209-90048231 ATTCTGAGCACAATTCAGGTAGG + Intergenic
1057815524 9:98291165-98291187 GTTCTGAGCACATTTAAGGTAGG - Intronic
1057919388 9:99084411-99084433 ATTCTGAGCACATTTAAGGTAGG + Intergenic
1058308972 9:103476968-103476990 ATTCTGAGCACATTTAAAGTAGG + Intergenic
1058347008 9:103976260-103976282 GTTCTGACAGCAATTAAAGTAGG - Intergenic
1058400530 9:104612980-104613002 CTTCTGAGCACATTTAAGGTAGG + Intergenic
1058764741 9:108170792-108170814 GTTCTGAACACATTTAAGGAAGG + Intergenic
1059780653 9:117522663-117522685 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1059982766 9:119791545-119791567 GTTCTGGGCACATTTAAAGTAGG + Intergenic
1060550747 9:124484026-124484048 GGTCTGAGCACATTTAAGGTAGG - Intronic
1060888095 9:127169852-127169874 GTTCTGGGCACATTTAAGGTAGG + Intronic
1062210145 9:135359127-135359149 GTTCTGAGCACGTTTAAGGCAGG - Intergenic
1185947437 X:4392859-4392881 CTTCTCAGCACATTTAAAGTAGG - Intergenic
1185990176 X:4885786-4885808 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1186043482 X:5507599-5507621 GTTCTGAGCACATTTAAGGTAGG - Intergenic
1186044362 X:5519043-5519065 GTTCTGAGCACATTTAAGGTAGG - Intergenic
1186566309 X:10666630-10666652 GTTCTGAGCACAATTAAAGGGGG + Intronic
1186722573 X:12321530-12321552 GTTGTGAGCACATTTAAAGTAGG + Intronic
1187355636 X:18567938-18567960 GTTCTGAGCATGTTTAAAGGAGG - Intronic
1187436972 X:19280085-19280107 CTACTGAGCACAATTAGATGGGG + Intergenic
1187886145 X:23890719-23890741 GTTCTGAGTACATTTAAGGGAGG + Intronic
1188164879 X:26849951-26849973 GTTCTGAGCATATTTAAGGTAGG - Intergenic
1188693601 X:33160155-33160177 GTTCTGAGCATGATTAAGGTAGG + Intronic
1189944358 X:46163076-46163098 GCTCTGAGCCCCATTAAAGCTGG + Intergenic
1190124809 X:47694673-47694695 GTTCTGAGCACATTTAAGGTAGG - Intergenic
1190225532 X:48541943-48541965 GTTCTGAGCACGTTTAAGGTAGG + Intronic
1190841597 X:54150229-54150251 ATTCTGAGCACATTTAAGGTGGG - Intronic
1192359248 X:70428343-70428365 GTTCTGAGCACACTTAAGGCAGG + Intronic
1193138757 X:78003304-78003326 GTTGTGAAGATAATTAAAGGTGG + Intronic
1194462342 X:94187268-94187290 GTTCTGAGCACATTTAAAGCAGG + Intergenic
1194687201 X:96935542-96935564 CTACTGAGGACAATTAAATGAGG + Intronic
1195013348 X:100754296-100754318 GTTCTGAGCACATTTAAAGTAGG - Intergenic
1195505609 X:105653248-105653270 TTTATGTGCAGAATTAAAGGAGG - Intronic
1195837015 X:109127634-109127656 GTTCTGAGCACATTTAAGGCAGG + Intergenic
1196420729 X:115518314-115518336 GTTCTGGGCACATTTAAGGTTGG + Intergenic
1196469220 X:116006855-116006877 GTTCTGAGCACATTTCAAGTAGG - Intergenic
1196929796 X:120670201-120670223 GTTCTGAGCACATTTAATGTAGG + Intergenic
1197095495 X:122589698-122589720 GTTCTCAGCACGTTTAAAGTAGG + Intergenic
1197311070 X:124906121-124906143 GTTCTGAGCACATTTAAGGTAGG - Intronic
1197539260 X:127735328-127735350 GTTTTGAGTACACTTAAAGTAGG - Intergenic
1198447529 X:136732724-136732746 TTTCTGAGCACATTTAAGGTAGG + Intronic
1198630411 X:138630872-138630894 GTTCTAAGCACATTTAAAGTAGG - Intergenic
1198801851 X:140456137-140456159 ATTCTGACCACAAAAAAAGGCGG - Intergenic
1199025493 X:142932342-142932364 GTTCTGAGCACATTTAAGGTAGG + Intergenic
1199413724 X:147555709-147555731 AATCTGAGCACATTCAAAGGAGG - Intergenic
1199974872 X:152888197-152888219 ATTCTGAGCACATTTAAGGTAGG + Intergenic
1200276970 X:154742410-154742432 GTTCTGAGCACATGTAAGGTAGG - Intronic