ID: 1186567075

View in Genome Browser
Species Human (GRCh38)
Location X:10674632-10674654
Sequence CTTTATAACCAGAATGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 905
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 861}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186567075 Original CRISPR CTTTATAACCAGAATGAGCA TGG Intronic
901252607 1:7792089-7792111 CTTTATTAGCAGCATGAGAATGG - Intronic
901689195 1:10961394-10961416 CTTCTTAACCTGAAGGAGCAGGG - Intronic
902065045 1:13678591-13678613 CTTTATTAGCAGCATGAGAACGG - Intergenic
902182959 1:14703594-14703616 CTTTATTAGCAGCATGAGAATGG + Intronic
902524240 1:17044625-17044647 TTTTAAAACAAGAATGAGCTTGG - Intronic
903483852 1:23675070-23675092 CTTTATTAACAGCATGAGAACGG + Intergenic
903796275 1:25931179-25931201 CTTTATAAGCAGCTTGAGAATGG + Intergenic
906081365 1:43090925-43090947 CTTTTGAGCCAGAATGAGCCAGG - Intergenic
906390117 1:45407812-45407834 CTTTATTAGCAGCATGAGAAAGG + Intronic
906744886 1:48214635-48214657 CTTTTGAGCCAGGATGAGCAAGG + Intergenic
907713187 1:56903487-56903509 CTTTATTAGCAGCATGAGAATGG + Intronic
907840076 1:58148532-58148554 CTTTATTAGCAGCATGAGAATGG - Intronic
908112487 1:60910984-60911006 CTTTATTAGCAGCATGAGAACGG + Intronic
908541766 1:65129037-65129059 CTTTATTAGCAGCATGAGAACGG - Intergenic
908715956 1:67069160-67069182 CTTTATGAGCAGCATGAGAATGG + Intergenic
908757549 1:67482698-67482720 CTTTATAACCATAGTGAGATGGG - Intergenic
908800115 1:67871356-67871378 CTTTATTAGCAGCATGAGAATGG + Intergenic
909181574 1:72430179-72430201 CTTTATTAGCAGCATGAGAATGG + Intergenic
909189274 1:72531862-72531884 CTTTATTAGCAGCATGAGAATGG - Intergenic
909371453 1:74887212-74887234 CTTTATTAGCAGCATGAGAAGGG + Intergenic
909622698 1:77685047-77685069 CTCTATAAGTAGAAAGAGCAAGG - Intergenic
909883060 1:80904707-80904729 CTTTATTAGCAGCATGAGAATGG - Intergenic
909910843 1:81256055-81256077 CTTTATTAGCAGGATGAGAACGG - Intergenic
909984523 1:82144152-82144174 CTTTATAGGCAGCATGAGAATGG + Intergenic
910707038 1:90140707-90140729 CTTTATTAGCAGCATGAGAATGG - Intergenic
911014977 1:93322712-93322734 CTTAAGAACCAGAATGGACATGG + Intergenic
911236470 1:95417752-95417774 CTTTATTAGCAGCATGAGAATGG - Intergenic
911387479 1:97194813-97194835 CTTTATTAGCAGCATGAGAATGG + Intronic
911941510 1:104053253-104053275 CTTTATTAGCAGCATGAGAATGG - Intergenic
912157918 1:106945274-106945296 CTTTATTAGCAGCATGAGAATGG - Intergenic
912712512 1:111960156-111960178 CTTTATTAGCAGCATGAGAACGG + Intronic
912798366 1:112706302-112706324 CTTTAAAACCAGAGTGAGGGCGG + Intronic
913208568 1:116564457-116564479 CTTTATTAGCAGCATGAGAATGG - Intronic
913286794 1:117233996-117234018 CTTTATTAGCAGCATGAGAACGG - Intergenic
913392307 1:118327864-118327886 CTTTATTAGCAGCATGAGAATGG + Intergenic
913481040 1:119289461-119289483 CTTTATTAGCAGCATGAGAATGG + Intergenic
913531648 1:119738027-119738049 CTTAATAACAAGAAAGAACATGG - Intronic
916089037 1:161292613-161292635 TGTTATAACCAGAAGGAGCCTGG + Intergenic
916270111 1:162931744-162931766 CTATACAGGCAGAATGAGCAGGG - Intergenic
916828257 1:168464203-168464225 CTTTATTAGCAGCATGAGAACGG - Intergenic
916839713 1:168587099-168587121 CTTTATTAGCAGCATGAGAACGG - Intergenic
916845132 1:168642841-168642863 CTTTATAAGCAGCATGAAAATGG - Intergenic
916904277 1:169264831-169264853 CTTTATTAGCAGCATGAGTACGG - Intronic
916948668 1:169757465-169757487 CTTTATTAGCAGCATGAGAAAGG - Intronic
917586329 1:176430807-176430829 CTTTATTAGCAGCATGAGAATGG - Intergenic
917892265 1:179451880-179451902 CTTTATCAGCAGAATGAAAATGG + Intronic
917895164 1:179480180-179480202 CTTTATCAGCAGCATGAGAATGG - Intronic
918257552 1:182763185-182763207 CTATGTAATCAAAATGAGCAAGG - Intergenic
918429552 1:184444571-184444593 CTTTATCAGCAGAATGAAAATGG + Intronic
918717991 1:187817065-187817087 CTTTATTAGCAGCATGAGAATGG - Intergenic
919135548 1:193503952-193503974 CTTTATAAGCAGCATGAAAATGG + Intergenic
919162224 1:193845189-193845211 CTTTATTAGCAGCATGAGAATGG + Intergenic
919166311 1:193898797-193898819 CTTTATAAGCAGCATGAAAATGG - Intergenic
919337173 1:196250734-196250756 ATTAATAACCAGAATGTGTAAGG + Intronic
920202945 1:204271325-204271347 CTTTATCACCAGAGCCAGCAAGG + Intronic
920594371 1:207254532-207254554 CTTTATTAACAGCATGAGAATGG - Intergenic
921399374 1:214703664-214703686 CTTTATTAGCAGCATGAGAATGG + Intergenic
921414556 1:214871116-214871138 CTTTATGACCATCATGAACAGGG - Intergenic
921433633 1:215091228-215091250 CATTCTAAGCAGAATGGGCATGG + Intronic
921695446 1:218203910-218203932 CTTTATTAGCAGCATGAGTACGG + Intergenic
921761888 1:218924286-218924308 CTTTATTAGCAGCATGAGAATGG + Intergenic
921970331 1:221141438-221141460 CTTTATTAGCAGCATGAGAATGG + Intergenic
922530342 1:226340451-226340473 CTTTATCAGCAGCATGAACATGG + Intergenic
923179278 1:231500254-231500276 CTTTATTAGCAGCATGAGAATGG - Intergenic
923762318 1:236858122-236858144 CTTTATCAGCAGCATGAGAATGG - Intronic
923808822 1:237289351-237289373 CTTTATTAGCAGCATGAGAAAGG - Intronic
923876691 1:238057696-238057718 CTTTATCAGCAGCATGAGAATGG - Intergenic
923911731 1:238454102-238454124 CTTTATTAGCAGCATGAGAATGG + Intergenic
923915423 1:238497736-238497758 CTTTATAAGCAGTATGAGAATGG + Intergenic
924020502 1:239776677-239776699 CTTTATTAGCAGCATGAGAATGG - Intronic
924687713 1:246312457-246312479 CTTTAAAAGCAGCATAAGCAGGG + Intronic
1063222152 10:3979202-3979224 CTTTATTAGCAGCATGAGAATGG + Intergenic
1063481350 10:6379448-6379470 CTTTATAAGCAGCATGAAAATGG - Intergenic
1063712253 10:8490945-8490967 CTTTATTAGCAGCATGAGAATGG + Intergenic
1063715449 10:8522251-8522273 CTTTATTAGCAGCATGAGAACGG - Intergenic
1063722667 10:8599845-8599867 CTTTATTACCAGCATGAGAATGG - Intergenic
1063841526 10:10077065-10077087 CTTTATCAGCAGCATGAGAACGG + Intergenic
1064129887 10:12700185-12700207 CTTTATTAGCAGCATGAGAATGG - Intronic
1064232891 10:13545018-13545040 CTTTATTAGCAGCATGAGAACGG + Intergenic
1064501353 10:15976926-15976948 CTTTATTAGCAGCATGAGAATGG + Intergenic
1065398402 10:25267171-25267193 CTTTATTAGCAGCATGAGAATGG - Intronic
1065642182 10:27794471-27794493 CTTTATAAACAGTGTGAGAATGG + Intergenic
1065795269 10:29301354-29301376 CTTTATCAGCAGAATGAAAATGG + Intronic
1065922493 10:30404875-30404897 CTTTATAAGCAGCATGAGAATGG + Intergenic
1066754110 10:38692426-38692448 CTTTATCAGCAGAATGAAAACGG + Intergenic
1067900525 10:50236177-50236199 CTTTATTAGCAGCATGAGAATGG - Intronic
1068350134 10:55832660-55832682 TTTTATAACCAGACTGTGCAAGG - Intergenic
1068696753 10:59975979-59976001 CTTTATAAGCAGCATGAATATGG - Intergenic
1068747640 10:60553068-60553090 CTTTATCAGCAGCATGAGAATGG + Intronic
1068778380 10:60892130-60892152 CTTTATTAGCAGCATGAGAATGG + Intronic
1069327294 10:67246828-67246850 TTTTACAAGCAGAATGCGCAAGG + Intronic
1069339761 10:67397023-67397045 CTTTATTACCAGCATGAGAATGG + Intronic
1070005515 10:72420476-72420498 CTTTATTAGCAGCATGAGAATGG + Intronic
1070422793 10:76253552-76253574 CTTTTTACCTAGAATGAGCTAGG - Intronic
1070507219 10:77124822-77124844 CTTTATTAGCAGAGTGAGAACGG - Intronic
1071169622 10:82848990-82849012 CTTTATTAGCAGTATGAGAATGG + Intronic
1071990427 10:91096232-91096254 CTTTATTAGCAGTATGAGAATGG - Intergenic
1072905824 10:99452679-99452701 CTTTATAAACAGCATGGACATGG - Intergenic
1073333463 10:102686752-102686774 TTTGATAATCAGACTGAGCACGG - Intronic
1073669364 10:105570527-105570549 CTTTATTAGCAGCATGAGAATGG - Intergenic
1073726419 10:106236590-106236612 CTTTATCAGCAGCATGAACATGG - Intergenic
1073811103 10:107152782-107152804 CTTTATTAGCAGCATGAGAATGG + Intronic
1073977869 10:109120538-109120560 CTTTATTAGCAGCATGAGAATGG + Intergenic
1074222831 10:111455131-111455153 CTTTATTAGCAGCATGAGAACGG + Intergenic
1074451607 10:113564003-113564025 CTTTATTAGCAGCATGAGAATGG - Intronic
1074491391 10:113942388-113942410 CTTTATTAGCAGCATGAGAACGG + Intergenic
1074500661 10:114020978-114021000 CTTTATCAGCAGCATGAGAACGG + Intergenic
1074794425 10:116927327-116927349 CTTTATTAGCAGCATGAGAATGG - Intronic
1075178840 10:120191514-120191536 CTTTATTAGCAGCATGAGAATGG - Intergenic
1075536758 10:123278027-123278049 CTTTATCAGCAGCATGAGAATGG - Intergenic
1075681270 10:124334546-124334568 CTTTATTAGCAGCATGAGAATGG - Intergenic
1075937698 10:126357517-126357539 CTTTATTAGCAGCATGAGAATGG - Intronic
1075941890 10:126396825-126396847 CTTTATTAGCAGCATGAGCACGG + Intergenic
1075985433 10:126780957-126780979 CTTTATTAGCAGCATGAGAATGG + Intergenic
1076016771 10:127034140-127034162 CTTTATCAGCAGCATGAACAGGG - Intronic
1076200332 10:128552702-128552724 CTTTATCAGCAGCATGAACACGG + Intergenic
1077588164 11:3470467-3470489 CTTTTGAGCCAGGATGAGCAAGG + Intergenic
1078104191 11:8348230-8348252 CTTTATTAGCAGCATGAGAATGG - Intergenic
1078517798 11:12039612-12039634 CTTTATCAGCAGCATGAGAATGG - Intergenic
1079409598 11:20174901-20174923 CTTTATTAGCAGCATGAGAATGG + Intergenic
1079475625 11:20826187-20826209 CTTTATTAGCAGCATGAGAATGG + Intronic
1079568682 11:21915745-21915767 CTTTATTAGCAGCATGAGAATGG + Intergenic
1079570949 11:21942626-21942648 CTTTATAAGCAGCATGAGAATGG + Intergenic
1079975514 11:27086086-27086108 CTTTATAACATGAAAGTGCAAGG + Intronic
1080115220 11:28614710-28614732 CTTTATTAGCAGTATGAGAATGG - Intergenic
1080194701 11:29595470-29595492 CTTTATTAGCAGCATGAGAATGG + Intergenic
1080475446 11:32585937-32585959 CTTTAAAACCAGGCTGAGCACGG + Intronic
1080671043 11:34378118-34378140 CTTTATAACATAAATGTGCAAGG + Intergenic
1080768712 11:35320938-35320960 CTTTATTAGCAGAGTGAGAATGG - Intronic
1080949437 11:37013373-37013395 CTTTATTAGCAGTATGAGAATGG + Intergenic
1081041136 11:38214951-38214973 ATTTATAATCAGACAGAGCAGGG + Intergenic
1081238789 11:40678816-40678838 CTTTATTAGCAGCATGAGAACGG + Intronic
1081299192 11:41429328-41429350 CTTTATTAGCAGCATGAGGACGG + Intronic
1081414170 11:42793389-42793411 CTTTATTAGCAGCATGAGAATGG + Intergenic
1082630874 11:55540620-55540642 CTTTATAAACAGCATGAAAACGG - Intergenic
1083497680 11:63072569-63072591 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1083574075 11:63776651-63776673 CTTTATGAACAGCATGAGAACGG + Intergenic
1084235049 11:67782368-67782390 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1084243860 11:67842116-67842138 CTTTTGAGCCAGGATGAGCAAGG + Intergenic
1084245910 11:67856826-67856848 CTTTTGAGCCAGGATGAGCAAGG + Intergenic
1084560005 11:69899303-69899325 CTCTGTAACCAGAATGGGGAGGG - Intergenic
1084741387 11:71141656-71141678 CGTTATTACCAGCATGAGAATGG + Intronic
1084826764 11:71737688-71737710 CTTTTGAGCCAGGATGAGCAAGG - Intergenic
1084828830 11:71752465-71752487 CTTTTGAGCCAGGATGAGCAAGG - Intergenic
1085866660 11:80302915-80302937 CTTTATCAGCAGCATGAGAATGG + Intergenic
1085873907 11:80383660-80383682 CTTTATTAGCAGCATGAGAATGG + Intergenic
1086850192 11:91799430-91799452 CTTTATCAGCAGAATGAAAATGG - Intergenic
1086942519 11:92813175-92813197 CTTTATTAGCAGCATGAGAACGG + Intronic
1087124331 11:94608125-94608147 GTCCATAACCAGAATGAACATGG + Intronic
1087401941 11:97678447-97678469 ATTAATAACCAGAATGTGTAAGG - Intergenic
1087472025 11:98587828-98587850 CTTTATTAGCAGCATGAGAATGG - Intergenic
1087675496 11:101157259-101157281 CTTTATTAGCAGCATGAGAATGG + Intergenic
1087919499 11:103849985-103850007 CTTCATAAACAGAAGCAGCAAGG - Intergenic
1087960938 11:104348071-104348093 CTTTATTAGCAGTATGAGAACGG + Intergenic
1088411167 11:109536246-109536268 ATTAATAACCAGAATGTACAAGG - Intergenic
1088752190 11:112853387-112853409 CTCTACAACTAGAAAGAGCAAGG - Intergenic
1088778189 11:113107451-113107473 CTTTATCACCAGCATGAAAAGGG - Intronic
1089685016 11:120141235-120141257 CTCTCCAACCAGGATGAGCATGG + Intronic
1091060939 11:132461649-132461671 CTTTATTAGCAGTATGAGAATGG - Intronic
1091077048 11:132628988-132629010 CTTTATTAGCAGGATGAGAATGG + Intronic
1091099105 11:132853847-132853869 CTTCATCACCAAAATGTGCAGGG + Intronic
1091966628 12:4748099-4748121 ATTAATAACCAGAATATGCAAGG - Intronic
1092382336 12:8007101-8007123 CTTTATAACCTAAAAGTGCAAGG + Intergenic
1092414415 12:8279235-8279257 CTTTTGAGCCAGGATGAGCAAGG + Intergenic
1094181665 12:27598165-27598187 CTTTATTAGCAGCATGAGAATGG - Intronic
1094299116 12:28940971-28940993 CTTTATTAGCAGCATGAGAATGG + Intergenic
1094539474 12:31351265-31351287 CTTTATTACCAACATGAGAATGG + Intergenic
1095522490 12:43084406-43084428 CTTTATTAGCAGCATGAGAAAGG + Intergenic
1095759596 12:45814666-45814688 TTTTATAACTGGAATGAGGAGGG - Intronic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1095915149 12:47470708-47470730 CTTTATTAGCAGCATGAGAATGG + Intergenic
1096519236 12:52174810-52174832 CTTTCTAGCCAGAATGCTCAGGG + Intronic
1097618225 12:61908530-61908552 CTTTATTAGCAGCATGAGAACGG + Intronic
1098068928 12:66650928-66650950 CTTCATCTCCAAAATGAGCATGG + Intronic
1098578257 12:72069527-72069549 CTTTATTAGCAGCATGAGAATGG - Intronic
1098578571 12:72071916-72071938 CTTTATTAGCAGCATGAGAATGG - Intronic
1098695093 12:73542440-73542462 CTTAATATCCAGAATTAACAAGG + Intergenic
1099048327 12:77751686-77751708 CTTTATTAGCAGCATGAGAATGG + Intergenic
1099872522 12:88368202-88368224 CTTTAGAGCCAGGATGAGCCAGG - Intergenic
1099908467 12:88800411-88800433 CTTTATTAGCAGCATGAGAATGG - Intergenic
1100085060 12:90900662-90900684 CCTTAGAACAAGAATGAGCTTGG + Intergenic
1100378852 12:94043228-94043250 CTTTATTAGCAGAATGAGAATGG - Intergenic
1100658087 12:96668318-96668340 CTTTATTAGCAGCATGAGAATGG - Intronic
1100991672 12:100257892-100257914 CTTTATAACCAAACAGATCATGG - Intronic
1101127315 12:101650318-101650340 CTTTATTAGCAGCATGAGAACGG - Intronic
1101194475 12:102368801-102368823 CTTTATTAACAGCATGAGAATGG - Intergenic
1101314786 12:103619131-103619153 CTTTATTAGCAGCATGAGAATGG + Intronic
1101449905 12:104766624-104766646 CTTTATTAGCAGCATGAGAATGG + Intergenic
1102026378 12:109716035-109716057 CTTAAACACCAGAAGGAGCAGGG - Intronic
1102397620 12:112600803-112600825 CTTTATTAGCAGCATGAGGACGG - Intronic
1104190286 12:126475607-126475629 CTTTATTAGCAGAATGAGAATGG - Intergenic
1104262679 12:127198905-127198927 CTTTATTAGCAGTATGAGAACGG - Intergenic
1104510820 12:129376203-129376225 CTTTATTAGCAGCATGAGAATGG - Intronic
1104528832 12:129549648-129549670 CTTTATCAGCAGCATGAGAATGG + Intronic
1104539784 12:129653185-129653207 TTTGATAACCAGGATGAGGAGGG + Intronic
1104549518 12:129743578-129743600 CTTTATTAGCAGCATGAGAATGG + Intronic
1106410521 13:29508141-29508163 CTTCATAACCAAAATGTGCAAGG + Intergenic
1106886015 13:34184820-34184842 CATTATAAACAGAATGAACAGGG - Intergenic
1107066591 13:36219998-36220020 CTTTATTAGCAGCATGAGAATGG + Intronic
1107312758 13:39097476-39097498 CTTTATTAGCAGCATGAGAATGG - Intergenic
1107342442 13:39422768-39422790 CTTTATTAGCAGCATGAGAATGG - Intronic
1107438449 13:40402995-40403017 CTTTAGAACCAGTGTGAACATGG + Intergenic
1107621667 13:42238200-42238222 CTTTATATCCAAAATGACCGTGG - Intronic
1107693815 13:42980339-42980361 CTTTATTAGCAGCATGAGAATGG - Intronic
1107766970 13:43745992-43746014 CTTTATTAGCAGCATGAGAATGG + Intronic
1108745514 13:53389417-53389439 CTTTATCAGCAGCATGAGAATGG - Intergenic
1109214818 13:59577605-59577627 ATTAATAACCAGAATAAACAAGG + Intergenic
1109448131 13:62471953-62471975 CTTTATCAGCAGCATGAGAATGG - Intergenic
1109718249 13:66245228-66245250 CTTTATTACCAGCCTGAGAAGGG + Intergenic
1109718511 13:66247200-66247222 CTTTATTAGCAGGATGAGAATGG + Intergenic
1109730101 13:66401525-66401547 CTTTATTAGCAGCATGAGAATGG + Intronic
1109740839 13:66552785-66552807 CTTTATTAGCAGCATGAGAATGG - Intronic
1110007905 13:70294914-70294936 CTTTATTAGCAGCATGAGAACGG + Intergenic
1110034142 13:70657402-70657424 CTTTATCAGCAGTATGAGAAAGG + Intergenic
1110208815 13:72948628-72948650 CTTTATTAGCAGCATGAGAATGG - Intronic
1110828118 13:79997002-79997024 CTTTATAAATTGAAAGAGCAGGG - Intergenic
1111074398 13:83214690-83214712 CTTTATCAGCAGCATGAGAATGG - Intergenic
1111254467 13:85647850-85647872 CTTTATTAGCAGCATGAGAAAGG + Intergenic
1111499877 13:89104580-89104602 CTTTATTAGCAGCATGAGAATGG + Intergenic
1111539923 13:89656452-89656474 CTTTATTAGCAGCATGAGAAGGG + Intergenic
1111601736 13:90482719-90482741 CTTTATTAGCAGCATGAGAATGG - Intergenic
1112079161 13:95949130-95949152 CTTTATTAGCAGCATGAGAACGG + Intronic
1112359764 13:98706780-98706802 CTTTATCAGCAGCATGAGAATGG + Intronic
1112391921 13:98992776-98992798 CTTTATTAGCAGCATGAGAATGG + Intronic
1112568343 13:100570235-100570257 CTTTATTAGCAGTATGAGAATGG - Intronic
1112840916 13:103576718-103576740 CTTTATTAGTAGAATGAGAATGG + Intergenic
1112888828 13:104207811-104207833 CTTTTGAGCCAGAATGAGCCAGG + Intergenic
1112931361 13:104742908-104742930 ATTTATTACCAGTATGAGGAAGG + Intergenic
1112996092 13:105576352-105576374 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1113329679 13:109316258-109316280 CTTTATTAGCAGCATGAGAATGG - Intergenic
1113341885 13:109433624-109433646 CTTTATTAGCAGCATGAGAACGG - Intergenic
1113386187 13:109850570-109850592 CTTTATTAGCAGCATGAGAACGG - Intergenic
1113470897 13:110545135-110545157 CTTTATTAGCAGCATGAACACGG + Intronic
1114986625 14:28238078-28238100 CTTTTTAAGCAGCATGAGAATGG + Intergenic
1115010756 14:28541417-28541439 CTTTATTAGCAGTATGAGAATGG + Intergenic
1115055746 14:29124399-29124421 CTTTATTAACAGCATGAGAAGGG - Intergenic
1115134608 14:30094078-30094100 CTTTATAAGCAGCATGAAAATGG - Intronic
1115430943 14:33317795-33317817 CTTTATTAGCAGCATGAGAATGG + Intronic
1115456287 14:33607711-33607733 CTTTATTAGCAGCATGAGAACGG - Intronic
1116286774 14:42984687-42984709 CTTTATTAGCAGCATGAGAATGG - Intergenic
1116381200 14:44270754-44270776 CTTTTTATTCAAAATGAGCATGG - Intergenic
1116542147 14:46112021-46112043 CTTTATTAGCAGCATGAGAATGG + Intergenic
1116704419 14:48278691-48278713 CTTTTGAGCCAGAATGAGCCAGG + Intergenic
1116720977 14:48495183-48495205 CTTTATTAGCAGCATGAGAATGG + Intergenic
1116738052 14:48719589-48719611 CTTTATTAGCAGCATGAGAATGG - Intergenic
1116748638 14:48852985-48853007 CTTTATTAGCAGCATGAGAATGG - Intergenic
1117639134 14:57778287-57778309 CTTTATCAGCAGCATGAGAATGG + Intronic
1117946124 14:61023770-61023792 CTTTAAAAGCAAAATGACCATGG + Intronic
1118151319 14:63194070-63194092 CTTTATTAGCAGCATGAGAATGG + Intergenic
1118228743 14:63928008-63928030 CTTTATCAGCAGCATGAGAATGG + Intronic
1118302325 14:64626592-64626614 CTTTATTAGCAGCATGAGAATGG + Intergenic
1118481010 14:66165894-66165916 CTTTATTAGCAGCATGAGAACGG - Intergenic
1118833086 14:69453235-69453257 CTTTAGATCCAGAAGCAGCAAGG + Exonic
1118925291 14:70186336-70186358 CTTTATTACCAGTGTGAGAACGG + Intronic
1119132924 14:72191409-72191431 CTTTATTAGCAGCATGAGAAAGG - Intronic
1119142856 14:72283682-72283704 CTTTATCAGCAGCATGAGAATGG + Intronic
1119150689 14:72356900-72356922 CTTTATTAGCAGCATGAGAATGG + Intronic
1119454764 14:74745397-74745419 CTTTATCACCAGCATGAAAACGG - Intergenic
1119764054 14:77177245-77177267 CTTTATCAGCAGCATGAGGACGG - Intronic
1120285336 14:82493369-82493391 CTTTATTAGCAGCATGAGAATGG + Intergenic
1120323095 14:82991002-82991024 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1120430688 14:84410704-84410726 CTTCATAACATGAAAGAGCAAGG + Intergenic
1120484994 14:85102319-85102341 CTTTATCACCAGCATGAAAACGG - Intergenic
1120810213 14:88795246-88795268 CTTTATTAGCAGCATGAGAACGG - Intergenic
1120887825 14:89465531-89465553 CTTTATTAGCAGCATGAGAACGG + Intronic
1121300939 14:92870455-92870477 CTTTATTAGCAGCATGAGAACGG - Intergenic
1121301137 14:92872236-92872258 CTTTATTAGCAGCATGAGAACGG - Intergenic
1121301273 14:92873386-92873408 CTTTATTAGCAGCATGAGAACGG - Intergenic
1121301407 14:92874539-92874561 CTTTATTAGCAGCATGAGAACGG - Intergenic
1121359279 14:93241512-93241534 CCTTATGACCAGAATGTGCAGGG + Exonic
1122008032 14:98721937-98721959 CTTTATTAGCAGCATGAGAATGG + Intergenic
1122150899 14:99725669-99725691 CTTTAGAACCAGACTGAGCTGGG - Intronic
1122241610 14:100372019-100372041 CTTTTGAGCCAGGATGAGCAAGG - Intronic
1122380794 14:101305478-101305500 CTTTTGAACCAGGATGAGCCAGG + Intergenic
1125100143 15:35902863-35902885 CTTTATTAGCAGCATGAGAATGG + Intergenic
1126126595 15:45299542-45299564 CTTTATAAGCAGCATGAAAATGG + Intergenic
1126909075 15:53399379-53399401 CTTTATTAGCAGCATGAGAATGG - Intergenic
1127006029 15:54571150-54571172 CTTTATTAGCAGCATGAGAATGG - Intronic
1127038823 15:54950421-54950443 CCTAATATCCAGAATCAGCAAGG - Intergenic
1127053133 15:55105694-55105716 CTTTATTAGCAGCATGAGAACGG - Intergenic
1127525654 15:59790238-59790260 CTTTATTAGCAGCATGAGAATGG + Intergenic
1127746919 15:61987289-61987311 CTTTATTAGCAGCATGAGAATGG - Intronic
1127787145 15:62365621-62365643 CTTTATTAGCAGAATGAGAACGG + Intergenic
1127869902 15:63063107-63063129 CTTTATATCCTGAAGGAGGAGGG + Intronic
1128535688 15:68488554-68488576 CTTTATCAGCAGCATGAGAACGG - Intergenic
1128588623 15:68874724-68874746 CTTTCCAACCAGAATGAGATGGG - Intronic
1128740290 15:70079039-70079061 CCTCATAACCAGAGTGAGCTGGG - Intronic
1129585646 15:76861771-76861793 CTTTATAAGCAGTATGAAAATGG - Intronic
1130711458 15:86285656-86285678 CTTTATTAGCAGCATGAGAATGG + Intronic
1130763807 15:86849848-86849870 CTTTAGAAACAGAGTGAGTAAGG + Intronic
1131394652 15:92076896-92076918 CTTTATTAGCAGCATGAGAATGG - Intronic
1132262641 15:100440370-100440392 CTTTTGAGCCAGAATGAGCCAGG - Intronic
1133698568 16:8288050-8288072 CTTTATTAACAGCATGAGAATGG - Intergenic
1133952995 16:10413492-10413514 CTTTATCACCAGCATGAAAATGG + Intronic
1134277911 16:12792901-12792923 CTTTATTAGCAGCATGAGAACGG + Intronic
1135609476 16:23853840-23853862 CTTTATTAGCAGCATGAGAATGG - Intronic
1135680153 16:24449637-24449659 CTTTATTAGCAGCATGAGAATGG - Intergenic
1135828738 16:25754497-25754519 CTTTATTAACAGCATGAGAATGG - Intronic
1135875084 16:26191258-26191280 CTTTATTAGCAGCATGAGAATGG + Intergenic
1138220677 16:55247799-55247821 CTTTATCAGCAGCATGAGAATGG - Intergenic
1138421854 16:56904139-56904161 CTTTATGACCATAACCAGCAGGG - Intronic
1138620228 16:58205311-58205333 CCTTAGAACCAGAATAGGCATGG + Intergenic
1138861165 16:60759383-60759405 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1139195438 16:64913138-64913160 CTTAAAAAGCAGAATAAGCAGGG - Intergenic
1139345055 16:66297408-66297430 CTGTATAACCAGAATCAGCCTGG - Intergenic
1139671412 16:68494315-68494337 CTTTATTAACAGTATGAGAACGG - Intergenic
1140552712 16:75884833-75884855 CTTTATTAGCAGCATGAGAATGG - Intergenic
1140649539 16:77071973-77071995 CTTTATTAGCAGCATGAGAATGG + Intergenic
1141214097 16:82008254-82008276 CTTTATTAGCAGTATGAGAATGG + Intronic
1141693361 16:85608551-85608573 CTTAATAATCAGAGTGACCATGG + Intergenic
1141902526 16:87001851-87001873 CTTTATTAGCAGCATGAGAATGG - Intergenic
1143760923 17:9103649-9103671 CTTTATTAGCAGCATGAGAATGG + Intronic
1146998015 17:37337800-37337822 CTTTAAAACTAGAATCAGCTGGG + Intronic
1148224403 17:45888441-45888463 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1149101128 17:52908424-52908446 CTTTATTAGCAGCATGAGAATGG + Intergenic
1149164023 17:53727917-53727939 CTTTATTAGCAGCATGAGAATGG - Intergenic
1149180340 17:53928839-53928861 ATTAATAACCAGAATGTACAAGG - Intergenic
1149448389 17:56731462-56731484 CTTTATTAGCAGCATGAGAATGG + Intergenic
1150506340 17:65702654-65702676 CTTTATTAGCAGCATGAGAATGG - Intronic
1150539609 17:66083403-66083425 CTTTATTAGCAGCATGAGAACGG + Intronic
1151075332 17:71265870-71265892 CTTTATTAGCAGCATGAGAATGG - Intergenic
1151839302 17:76606212-76606234 CTTTTGAGCCAGAATGAGCCAGG + Intergenic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1152015121 17:77745521-77745543 CTTTATTAGCAGCATGAGAATGG - Intergenic
1153161963 18:2216558-2216580 CTTTATTAGCAGCATGAGAATGG + Intergenic
1153619252 18:6961682-6961704 CTTTGTCACCAGAATCAGAATGG - Exonic
1155467689 18:26156503-26156525 CGTTATAACGTGAATGAGCCTGG + Intronic
1155675808 18:28426843-28426865 CTTTATCAGCAGCATGAACATGG + Intergenic
1155779699 18:29815493-29815515 CTTGAGAACCAGAATAAGCAAGG + Intergenic
1155781090 18:29837135-29837157 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1156023008 18:32620923-32620945 CTTTATTAGCAGAATGAGAATGG + Intergenic
1156151441 18:34248866-34248888 CTTTATTAGCAGCATGAGAACGG - Intergenic
1156540947 18:37909738-37909760 TTTTATAATGAGAATGGGCAAGG + Intergenic
1156673434 18:39498750-39498772 CTTTATAAGCAGCATGAATATGG - Intergenic
1156808948 18:41224136-41224158 CTTTATAACCAGTTTGAAAATGG + Intergenic
1158743720 18:60173062-60173084 CTTTATTAGCAGCATGAGAATGG - Intergenic
1159136258 18:64340646-64340668 CTTTATTAGCAGCATGAGAATGG - Intergenic
1159178982 18:64876890-64876912 CTTTATTAGCAGAATGAGAATGG - Intergenic
1159183823 18:64944781-64944803 CTTTATTAGCAGCATGAGAATGG - Intergenic
1159286996 18:66366722-66366744 CTTTATTAACAGAGTGAGAATGG + Intergenic
1159492853 18:69161279-69161301 CTTTATTAGCAGCATGAGAATGG - Intergenic
1159494922 18:69190184-69190206 CTTTATTAGCAGCATGAGAATGG + Intergenic
1159507006 18:69351671-69351693 CTTTATAAGCAGCATGAAAATGG - Intergenic
1159617380 18:70597499-70597521 CTTTATCAGCAGCATGAACACGG + Intergenic
1159618004 18:70604005-70604027 CTTTATTAGCAGTATGAGAATGG - Intergenic
1159768881 18:72524370-72524392 CATTATAACCAGAAATAGCATGG + Intergenic
1159863832 18:73681678-73681700 CTATATAACCAGAAAGACCCAGG - Intergenic
1159888360 18:73931987-73932009 CTTTATTAACAGCATGAGAATGG + Intergenic
1161948793 19:7455656-7455678 CTTTATCAGCAGCATGAACACGG - Intronic
1161998211 19:7727560-7727582 CTTTATTAGCAGCATGAGAACGG + Intergenic
1162051633 19:8037584-8037606 CTTTAAAAAAAAAATGAGCAGGG - Intronic
1162597882 19:11642970-11642992 CTTTATTAGCTGAATGAGAACGG + Intergenic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1163229992 19:15995016-15995038 CTTTATTAGCAGCATGAGAATGG + Intergenic
1163472003 19:17502891-17502913 CTTTATTAGCAGCATGAGAATGG - Intronic
1164799417 19:31063686-31063708 CTTTCTAGCCCGAATCAGCATGG - Intergenic
1165835802 19:38755053-38755075 CTTTTGAACCAGGATGAGCCAGG - Intronic
1167512316 19:49901878-49901900 ATCTAAAACCAGAGTGAGCAGGG + Exonic
1167886617 19:52505180-52505202 CTCAAAAACCAGAATGAGCTGGG - Intronic
1167892040 19:52548032-52548054 CTCAAAAACCAGAATGAGCTGGG - Intronic
1167912249 19:52713594-52713616 CTCAAAAACCAGAATGAGCTGGG + Intronic
924976822 2:185021-185043 CTTTATTAGCAGCATGAGAATGG + Intergenic
925796994 2:7556342-7556364 CTTTATTAACAGCATGAGAATGG - Intergenic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
926280410 2:11441615-11441637 CTTTATTAGCAGCATGAGAATGG - Intergenic
926307322 2:11647759-11647781 CTTTATCACCAGCATGAAAATGG + Intergenic
926392114 2:12403917-12403939 CTTTATTAACAGCATGAGAAAGG + Intergenic
926415555 2:12646234-12646256 CTTTATAAGCAGCATGAGAATGG - Intergenic
926646503 2:15295240-15295262 GTGTATAGCAAGAATGAGCATGG + Intronic
926657535 2:15425115-15425137 GTTTTTAACGAGAATGATCATGG + Intronic
926946465 2:18192667-18192689 CTTTATTAGCAGCATGAGAATGG + Intronic
927308032 2:21596185-21596207 CTTTATTAGCAGAATGAGAATGG + Intergenic
928133789 2:28672837-28672859 CTTTATTATCAGCATGAGAATGG + Intergenic
928202112 2:29254245-29254267 CTTTATTAGCAGCATGAGAATGG + Intronic
928327547 2:30331842-30331864 CTTTATCAGCAGCATGAGAATGG + Intergenic
928694366 2:33834027-33834049 CTTTATTAGCAGCATGAGAATGG + Intergenic
928749683 2:34457370-34457392 CTTTATTAGCAGCATGAGAATGG - Intergenic
929043733 2:37771265-37771287 CTTTATTAGCAGCATGAGAAAGG + Intergenic
929103820 2:38344023-38344045 CTTTATTACCAGCATGAAAATGG + Intronic
929448896 2:42023355-42023377 CTTTACAAGCAGCATGAGAATGG + Intergenic
929560317 2:42952483-42952505 CTTTATAAGCAGCATGAAAACGG + Intergenic
930514723 2:52392678-52392700 CTTTATTAGCAGCATGAGAATGG - Intergenic
931290169 2:60865703-60865725 CTTTAGAAGCAGTATGAGAACGG + Intergenic
931568436 2:63641672-63641694 ATTAATAACCAGAATAAGTAAGG - Intronic
931742273 2:65257821-65257843 CTTAATAACCAGAATCTACAAGG - Intronic
932987719 2:76747154-76747176 CTTTATTAGCAGCATGAGAATGG - Intergenic
933098926 2:78225872-78225894 CTTTATTAGCAGCATGAGAATGG - Intergenic
933332740 2:80915081-80915103 ATTAATAACCAGAATGTACAGGG - Intergenic
933361641 2:81293877-81293899 CTTTATTAGCAGCATGAGAAGGG + Intergenic
933532468 2:83527592-83527614 CTAGATAACCATAATTAGCATGG + Intergenic
934317410 2:91936763-91936785 CTTTATCAGCAGAATGAAAACGG + Intergenic
934874906 2:97908558-97908580 CTTCTTCACCAAAATGAGCAAGG + Intronic
935372697 2:102364682-102364704 CTTTATTAGCAGCATGAGAATGG - Intronic
935868671 2:107420775-107420797 CTTTATTAGCAGCATGAGAATGG - Intergenic
935891149 2:107679862-107679884 CTTTATAGGCAGAATGAGTAGGG + Intergenic
937607431 2:123818403-123818425 CTTTATTAGCAGCATGAGAATGG - Intergenic
937827484 2:126382413-126382435 CTTTTGAGCCAGAATGAGCCAGG + Intergenic
938974417 2:136462070-136462092 CTTTATTAGCAGCATGAGAACGG - Intergenic
939094630 2:137820739-137820761 CTTTGTTAGCAGCATGAGCATGG - Intergenic
939423268 2:142001203-142001225 CTTTATCAGCAGCATGAGAATGG + Intronic
939752542 2:146064940-146064962 CTTTATCACCAGCATGAAAAAGG - Intergenic
939780914 2:146446479-146446501 CTTTATTAGCAGCATGAGAATGG - Intergenic
940483985 2:154274718-154274740 CTTTATTAGCAGCATGAGAATGG + Intronic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940717180 2:157239252-157239274 ATTTATAATTAGAAGGAGCAAGG - Intergenic
941067965 2:160924653-160924675 CTTTATTAGCAGCATGAGAATGG - Intergenic
941607829 2:167621983-167622005 CTTTATTAGCAGCATGAGAATGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942733476 2:179083617-179083639 CTTTATTAGCAGCATGAGAAAGG - Intergenic
942846272 2:180429442-180429464 CTTTATTAGCAGCATGAGAATGG - Intergenic
942950259 2:181713311-181713333 CTTTATCAACAGAATGAAAATGG + Intergenic
943123992 2:183773335-183773357 CTTTATCAGCAGCATGAGAACGG + Intergenic
943238194 2:185348794-185348816 CTTTATTAGCAGCATGAGAATGG + Intergenic
943289464 2:186050328-186050350 CTTTATTAGCAGCATGAGAATGG - Intergenic
943502345 2:188707465-188707487 CTTTATTAGCAGCATGAGAACGG + Intergenic
943701790 2:190995302-190995324 CTTTATTAGCAGCATGAGAATGG - Intronic
943835842 2:192512934-192512956 CTTTTGAGCCAGAATGAGCCAGG - Intergenic
943850607 2:192717482-192717504 CTTTATTAGCAGCATGAGAACGG - Intergenic
944264605 2:197709544-197709566 CTTTTGAACCAGGATGAGCCAGG + Intronic
944937842 2:204588013-204588035 CTTTATTAGCAGCATGAGAATGG + Intronic
945123630 2:206485067-206485089 CTTTATGAGCAGCATGAGAATGG + Intronic
945362144 2:208905237-208905259 CTTTTGAGCCAGAATGAGCCAGG - Intergenic
945593779 2:211767481-211767503 CTTTATTAGCAGCATGAGAACGG - Intronic
945652107 2:212575536-212575558 ATTAATAACCAGAATGTACAAGG - Intergenic
946477155 2:220018136-220018158 CTTTATTAGCAGCATGAGAACGG + Intergenic
946562338 2:220927249-220927271 CTTTATAAGCAGCATGAAAATGG - Intergenic
946677080 2:222171505-222171527 CTTTATTAGCAGCATGAGAATGG + Intergenic
946769781 2:223076981-223077003 CTTTATTAGCAGCATGAGAAAGG - Intronic
946974540 2:225133807-225133829 CTTTATCAGCAGCATGAGAATGG - Intergenic
946983698 2:225248019-225248041 TTTTTTAACAAGAATGAGCATGG + Intergenic
947166316 2:227265772-227265794 CTTTATTAGCAGCATGAGAATGG - Intronic
947396865 2:229695234-229695256 CTTTATTAGCAGCATGAGAATGG + Intronic
947886360 2:233575344-233575366 CTTTATAAGCAGCATGAAAATGG - Intergenic
948007743 2:234624268-234624290 CTTTATTAGCAGCATGAGAATGG + Intergenic
948730191 2:239958231-239958253 ATTTATATCCAGTGTGAGCACGG + Exonic
1169744437 20:8929032-8929054 CTATATAAAAAGAATTAGCAGGG - Intronic
1169817930 20:9678253-9678275 CTTTATTAGCAGTATGAGAATGG - Intronic
1169836795 20:9889289-9889311 CTTTATTAGCAGCATGAGAACGG - Intergenic
1170286448 20:14715009-14715031 CTTTATTAGCAGCATGAGAATGG - Intronic
1170341022 20:15327361-15327383 CTTTATTAGCAGCATGAGAATGG - Intronic
1171392114 20:24808385-24808407 TTTTAAAACCAGAGTGAGCTGGG - Intergenic
1171750011 20:29039572-29039594 CTTTATTAGCAGCATGAGAATGG - Intergenic
1173323246 20:42008984-42009006 CTTTATTAGCAGCATGAGAATGG - Intergenic
1173924435 20:46770342-46770364 CTTTATTAGCAGCATGAGGATGG - Intergenic
1174701522 20:52614031-52614053 ATTTATAACCAGATTGAAAAAGG - Intergenic
1175230966 20:57472954-57472976 CTTTATTAGCAGCATGAGAATGG + Intergenic
1175647969 20:60692155-60692177 CTTTTTAGCCAGAATGAGTGAGG + Intergenic
1176315207 21:5236344-5236366 CTTTATTAGCAGCATGAGAATGG + Intergenic
1177484304 21:21737178-21737200 CTTTATTAGCAGCATGAGAACGG - Intergenic
1177521933 21:22237969-22237991 CTTTATTAGCAGCATGAGAATGG + Intergenic
1177854363 21:26384599-26384621 CTTTATTAGCAGCATGAGAATGG + Intergenic
1177955512 21:27593520-27593542 GTCTACAACCAGAATGAGCCTGG - Intergenic
1178114542 21:29404175-29404197 CTTTATTAGCAGCATGAGAAGGG + Intronic
1178331449 21:31697630-31697652 GTCTATAAGCAGAATGAGCACGG - Intronic
1178362465 21:31960506-31960528 CTTTATTAGCAGCATGAGAATGG - Intronic
1178419272 21:32430488-32430510 CTTTATTAGCAGAGTGAGAATGG - Intronic
1178745956 21:35250562-35250584 CTTTATCAGCAGCATGAGAATGG + Intronic
1179793966 21:43771611-43771633 CTTTATTAGCAGCATGAGAATGG - Intergenic
1180218189 21:46339995-46340017 CTTTATTAGCAGCATGAGAATGG - Intronic
1180392995 22:12302298-12302320 CTTTATTAGCAGCATGAGAATGG + Intergenic
1180406755 22:12562470-12562492 CTTTATTAGCAGCATGAGAATGG - Intergenic
1180723084 22:17923841-17923863 CTTTATTAGCAGCATGAGAATGG - Intronic
1181086891 22:20444248-20444270 TCTTCTAACCAGAGTGAGCAGGG + Intronic
1181445056 22:22964176-22964198 ATTCATAACCAGAATGTACAAGG - Intergenic
1182454845 22:30443768-30443790 CTTTAAAAATAGAGTGAGCAAGG - Intergenic
1182640077 22:31759977-31759999 CTTTAAAACCAGAAAGAGGCTGG - Intronic
1182999066 22:34839773-34839795 CTTTTGAGCCAGGATGAGCAAGG - Intergenic
1183801139 22:40165574-40165596 CTTTATTAGCAGCATGAGAATGG - Intronic
1184862231 22:47179108-47179130 CTTTATTAACAGCATGAGAATGG + Intergenic
1203295867 22_KI270736v1_random:42677-42699 CTTTATTAGCAGCATGAGAATGG + Intergenic
949204194 3:1418549-1418571 CTTCATTACAAGAATGAGCTTGG + Intergenic
949474044 3:4425731-4425753 CTTTATTAGCAGCATGAGAATGG - Intronic
949670795 3:6397778-6397800 CTTTTTAGCCAGGATGAGCCAGG - Intergenic
950050936 3:9988935-9988957 TTTTATAGCCAGAGTGAGTAGGG - Intronic
950058025 3:10044052-10044074 TTTTATAGCCAGAGTGAGTAGGG - Intronic
951291988 3:20882518-20882540 CTTTATTAGCAGCATGAGAATGG - Intergenic
951316528 3:21194019-21194041 CTTTTGAACCAGGATGAGCCAGG + Intergenic
951947696 3:28159473-28159495 CTTTATTAGCAGCATGAGAATGG + Intergenic
952134998 3:30408563-30408585 CTTTATTAGCAGCATGAGAAAGG + Intergenic
952298326 3:32081356-32081378 CTTTATTACCAACATGAGAATGG - Intergenic
953229731 3:41054153-41054175 CTTTATTAGCAGCATGAGAATGG - Intergenic
954159148 3:48707732-48707754 CATTAAAACCAGAATGAGCCTGG - Intronic
954820803 3:53325691-53325713 CTTTAAGACAAGAATAAGCATGG + Intronic
956591828 3:70923507-70923529 CTTTATTAACAGTATGAGAATGG + Intergenic
956849118 3:73212192-73212214 CTTTATTAGCAGCATGAGAATGG - Intergenic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
957251107 3:77772133-77772155 CTTTATCAACAGAATGAAAATGG - Intergenic
957267308 3:77983719-77983741 CTTTATTAGCAGCATGAGAATGG - Intergenic
957360589 3:79151239-79151261 CTTTATTAGCAGCATGAGAATGG + Intronic
957680525 3:83427578-83427600 TTTTATAACCAAACTAAGCAGGG - Intergenic
957787612 3:84902149-84902171 CTTTATAAGCAGAATGAAAATGG + Intergenic
957799662 3:85059847-85059869 CTTTATAAGCAGCGTGAACATGG + Intronic
957987320 3:87589172-87589194 CTTTATAAGCAGCATGAAAAAGG - Intergenic
958076836 3:88691130-88691152 CTTTATCAGCAGCATGAGAACGG - Intergenic
958468292 3:94485272-94485294 CTTTATTAACAGCATGAGAATGG - Intergenic
958563959 3:95782660-95782682 CTTTATTAGCAGTATGAGAAAGG + Intergenic
958611734 3:96435677-96435699 CTTTATTAGCAGCATGAACATGG - Intergenic
958637368 3:96762650-96762672 CTTTATTAGCAGCATGAGAATGG + Intergenic
958886368 3:99732302-99732324 CTTTATTAGCAGCATGAGAAGGG - Intronic
959033224 3:101327570-101327592 CTTTATTAGCAGCATGAGAACGG + Intronic
959139878 3:102472870-102472892 CTTTATTAGCAGCATGAGAATGG - Intronic
959741960 3:109730868-109730890 CTTTATTAGCAGCATGAGAATGG - Intergenic
960036002 3:113103772-113103794 TTTCATAAGCAGAATAAGCAAGG + Intergenic
960099481 3:113725015-113725037 CTTTATTAGCAGCATGAGAAAGG + Intronic
960217320 3:115057842-115057864 CTTTATTAGCAGCATGAGAACGG - Intronic
960430378 3:117561342-117561364 CTTTATTAGCAGCATGAGAATGG + Intergenic
960478167 3:118157253-118157275 CTTTATTAGCAGTATGAGAATGG - Intergenic
960478486 3:118159669-118159691 CTTTATTAACAGCATGAGAACGG + Intergenic
960501900 3:118447994-118448016 CTTTATTAGCAGCATGAGAATGG - Intergenic
960866684 3:122208803-122208825 CTTTCTAATCAGTATGAGGAAGG - Intronic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
961884691 3:130088897-130088919 CTTTATTAGCAGAGTGAGAATGG + Intronic
961891964 3:130137853-130137875 CTTTTGAGCCAGGATGAGCAAGG + Intergenic
961894034 3:130152555-130152577 CTTTTGAACCAGGATGAGCAAGG + Intergenic
962067161 3:131993021-131993043 CTTTATTAGCAGCATGAGAATGG + Intronic
962131005 3:132676336-132676358 CTTTATAACCTTGTTGAGCATGG + Intronic
962646536 3:137445991-137446013 CTTTATTAGCAGCATGAGAATGG - Intergenic
962684909 3:137837992-137838014 CTTTATTAGCAGCATGAGAAGGG + Intergenic
963339608 3:144019104-144019126 CTTTATTAGCAGCATGAGAATGG - Intronic
963520915 3:146359216-146359238 CTTTTGAGCCAGAATGAGCCAGG - Intergenic
963553386 3:146754111-146754133 CTTTATCAGCAGCATGAACACGG - Intergenic
964525363 3:157611220-157611242 CTTTATTAGCAGCATGAGAACGG + Intronic
964954326 3:162334085-162334107 CTTTATTAGCAGCATGAGAATGG + Intergenic
965060280 3:163775821-163775843 CTTAATAATCAGAATGAGAGAGG + Intergenic
965251579 3:166350178-166350200 CTTTATGAACAGAATGAAAATGG + Intergenic
965425584 3:168518653-168518675 CTTTATTAGCAGAATGAGAATGG - Intergenic
966311187 3:178595774-178595796 CTTTATTAGCAGCATGAGAACGG + Intronic
966343337 3:178949939-178949961 CTTTATTAGCAGCATGAGAACGG + Intergenic
967420486 3:189266812-189266834 CTTTGTAACTAGAAAGATCAAGG - Intronic
967640922 3:191862110-191862132 CTTTATTAGCAGCATGAGAATGG - Intergenic
969004129 4:4005628-4005650 CTTTTGAGCCAGGATGAGCAAGG + Intergenic
969109525 4:4834716-4834738 CTTTATCACCAGCATGAAAATGG - Intergenic
969748732 4:9094513-9094535 CTTTTGAGCCAGGATGAGCAAGG - Intergenic
969809778 4:9639086-9639108 CTTTTGAGCCAGGATGAGCAAGG - Intergenic
969820097 4:9713391-9713413 CTTTATTAGCAGAGTGAGAAAGG - Intergenic
969960385 4:10939345-10939367 CTTTATTAGCAGCATGAGAATGG + Intergenic
970560708 4:17279571-17279593 CTTTATCAGCAGCATGAGAATGG - Intergenic
970644014 4:18098654-18098676 CTTTATTAGCAGCATGAGAACGG - Intergenic
970723565 4:19016516-19016538 CTTTTGAGCCAGAATGAGCCAGG - Intergenic
970853541 4:20629993-20630015 CTTTTGAGCCAGAATGAGCCAGG + Intergenic
970985766 4:22155566-22155588 CTTTATTAGCAGCATGAGAATGG + Intergenic
971192175 4:24438009-24438031 ATTCATCACCAGAATGAGCATGG - Intergenic
971243586 4:24909958-24909980 CTTTATAAGCAGCATGAAAACGG + Intronic
971484690 4:27147293-27147315 CTTTATCAGCAGCATGAGAATGG - Intergenic
972017498 4:34264411-34264433 CTTTATTAGCAGCATGAGAATGG - Intergenic
972128816 4:35803088-35803110 CTTTATCAGCAGCATGAACACGG - Intergenic
972678089 4:41279598-41279620 CTTTATTAGCAGGATGAGAACGG - Intergenic
972900923 4:43682413-43682435 CTTTATTAGCAGCATGAGAATGG - Intergenic
973641851 4:52911005-52911027 CTTTATTAGCAGCATGAGAACGG + Intronic
973909508 4:55565305-55565327 CTTTATTAGCAGCATGAGAACGG - Intronic
973969081 4:56192992-56193014 CTTTATTAGCAGCATGAGAATGG - Intronic
974178565 4:58357359-58357381 CTTTATTACCATCATGAGAATGG + Intergenic
974255054 4:59441808-59441830 CTTTATTAGCAGCATGAGAATGG + Intergenic
974445593 4:61976838-61976860 CTTTATCAGCAGCATGAGAATGG + Intronic
974593446 4:63985159-63985181 CTTTTGAGCCAGAATGAGCCAGG + Intergenic
974738821 4:65977781-65977803 ATATATAACAAGAATGGGCAGGG - Intergenic
974753145 4:66167546-66167568 AATTATAACCAAAATGAGTATGG - Intergenic
974925425 4:68292183-68292205 CTTTATTAGCAGCATGAGAATGG - Intergenic
975042079 4:69758335-69758357 CTTTATATCCAAACTGAGAAGGG - Intronic
975157023 4:71083477-71083499 CTTAATAATCAGAATCAGGAAGG - Intergenic
976002887 4:80392720-80392742 CTTTATTAGCAGCATGAGAATGG + Intronic
976366414 4:84237721-84237743 CTTTATTAGCAGCATGAGAACGG + Intergenic
976719028 4:88152542-88152564 CTTTTGAGCCAGAATGAGCCAGG + Intronic
976730014 4:88252313-88252335 CTTTATCAACAGCATGAGAATGG - Intergenic
976932763 4:90588925-90588947 CTTTATCAGCAGCATGAGAATGG + Intronic
976975057 4:91155448-91155470 CTTTATTAGCAGCATGAGAACGG + Intronic
977270473 4:94911919-94911941 CTTTATAAGCAGCATGAAAAAGG - Intronic
977356243 4:95951469-95951491 CTTTATTAGCAGCATGAGAATGG - Intergenic
977512195 4:97974809-97974831 CTTTATCAGCAGCATGAACATGG + Intronic
977575748 4:98672580-98672602 TTTTATCAGCAGGATGAGCACGG - Intergenic
977949650 4:102955383-102955405 CTTTATCAGCAGAATGAAAACGG + Intronic
978044827 4:104113590-104113612 CTTTATTAGCAGCATGAGAATGG - Intergenic
978045084 4:104115476-104115498 CTTTATTAGCAGATTGAGAATGG - Intergenic
979126110 4:116973800-116973822 CTTTATTAGCAGCATGAGAATGG + Intergenic
979406023 4:120311314-120311336 CTTTATCAGCAGAATGAAAACGG - Intergenic
979500343 4:121433406-121433428 CTTTATCAACAGCATGAACATGG - Intergenic
979793382 4:124814577-124814599 CTTTATAAGCAGCATGAAAATGG - Intergenic
979922842 4:126523691-126523713 CTTTATCAGCAGCATGAACATGG - Intergenic
980034726 4:127870848-127870870 GTTTTTAAATAGAATGAGCAGGG + Intergenic
980161105 4:129164144-129164166 CTTTATTAGCAGCATGAGAATGG - Intergenic
980432040 4:132713897-132713919 CTTTATTAGCAGCATGAGAATGG - Intergenic
980471946 4:133263774-133263796 CTTTTGAGCCAGGATGAGCAAGG + Intergenic
980771139 4:137374554-137374576 CACTATAATCAGAAAGAGCATGG + Intergenic
980843893 4:138300837-138300859 CATTTTAACTAGAATGACCAGGG - Intergenic
983380428 4:166984934-166984956 CTTTATAACCAAAGTGAGTTTGG + Intronic
983478418 4:168243187-168243209 CTTTATCAGCAGCATGAACATGG + Intronic
983867865 4:172789759-172789781 CTTTAGAACCAGAATCAGAAAGG + Intronic
983889664 4:173017176-173017198 CTTTATTAGCAGCATGAGAATGG + Intronic
984164803 4:176294452-176294474 CTTTTGAACCAGGATGAGCCAGG + Intergenic
984286479 4:177735969-177735991 CTTTATTAGCAGCATGAGAATGG + Intronic
984373357 4:178894757-178894779 GTGGATAACCAGAGTGAGCAAGG + Intergenic
984394489 4:179177555-179177577 CTTCATAACCAGAATATACAAGG - Intergenic
984841409 4:184071358-184071380 CTTTATCAGCAGCATGAGAATGG - Intergenic
985108481 4:186522128-186522150 ATTTATAACCAGGCTGAGCTAGG - Intronic
985110139 4:186539924-186539946 CTTTATCAGCAGCATGAGAATGG - Intronic
985197264 4:187444615-187444637 CTTTACAAACAGTATGAGCAAGG - Intergenic
985431923 4:189889221-189889243 CTTTATTAGCAGCATGAGAATGG - Intergenic
985788502 5:1912481-1912503 CTTTATTAGCAGCATGAGAACGG + Intergenic
986077435 5:4352567-4352589 CTTTATTAGCAGCATGAGAATGG - Intergenic
986106735 5:4666995-4667017 CTTTATTAGCAGCATGAGAAGGG - Intergenic
986274781 5:6264078-6264100 CTTTATTAACAGAGTGAGAATGG + Intergenic
986640727 5:9869223-9869245 CTTTATTAGCAGCATGAGAATGG - Intergenic
986844402 5:11735860-11735882 CTTTATTAGCAGCATGAGAATGG + Intronic
987102086 5:14600374-14600396 CTTTATTAGCAGCATGAGAATGG + Intronic
987153714 5:15066848-15066870 CTTTATTAGCAGCATGAGAATGG - Intergenic
987165660 5:15195369-15195391 CTTTATTAGCAGAGTGAGAATGG - Intergenic
987455723 5:18143944-18143966 CTTTATCATCAGCATGAGAATGG - Intergenic
987457879 5:18169573-18169595 CTTTATTAGCAGCATGAGAATGG + Intergenic
987481154 5:18459485-18459507 CTTTATTAGCAGCATGAGAATGG + Intergenic
987593433 5:19963728-19963750 CTTTATTAGCAGCATGAGAATGG + Intronic
987642222 5:20627844-20627866 CTTTATTAGCAGCATGAGAACGG - Intergenic
987651037 5:20740149-20740171 CTTTATAAACAGCATGAAAATGG + Intergenic
987680665 5:21132652-21132674 CTTTATCAGCAGCATGAGAATGG + Intergenic
987741798 5:21918411-21918433 CTTTATTAGCAGCATGAGAATGG - Intronic
987814373 5:22881638-22881660 CTTTATTAGCAGCATGAGAATGG - Intergenic
988042293 5:25905195-25905217 CTTTATTAGCAGCATGAGAATGG - Intergenic
988204234 5:28114348-28114370 CTTTATCAGCAGCATGAACATGG - Intergenic
988247920 5:28712695-28712717 TTTAATAACCAGAATATGCAAGG + Intergenic
988289418 5:29266663-29266685 CTTTATTAGCAGCATGAGAATGG - Intergenic
988291102 5:29288070-29288092 CTTTATCAGCAGTATGAGAACGG - Intergenic
988356878 5:30187942-30187964 CTTTATTAGCAGCATGAGAATGG + Intergenic
988744523 5:34121314-34121336 CTTTATAAGCAGCATGAAAATGG - Intronic
988834975 5:35023242-35023264 CTTTATCAGCAGCATGAGAAAGG + Intronic
989307784 5:39977508-39977530 CTTTATTACCAGCATGAGACAGG - Intergenic
989320249 5:40125958-40125980 GTTAATATCCAGAATCAGCAAGG - Intergenic
989603220 5:43219347-43219369 CTTTATTAGCAGCATGAGAAAGG + Intronic
989747860 5:44852824-44852846 CTTTATTAGCAGCATGAGAATGG - Intergenic
990117384 5:52405141-52405163 CTTTATTAGCAGCATGAGAACGG + Intergenic
990198276 5:53343077-53343099 CTTTATAAGCAGCATGAAAATGG + Intergenic
990279743 5:54237368-54237390 CTTTATTAGCAGCATGAGAATGG + Intronic
990336358 5:54776568-54776590 CTTTCTTAGCAGAATGAGAATGG - Intergenic
990497603 5:56364134-56364156 CTTTATTAGCAGCATGAGAATGG + Intergenic
990594796 5:57302016-57302038 CTTTATTAGCAGAGTGAGAATGG - Intergenic
990861194 5:60329489-60329511 CTTTATTAGCAGCATGAGAATGG + Intronic
991143355 5:63273079-63273101 CTTTATCAGCAGCATGAACATGG - Intergenic
991158522 5:63467164-63467186 CATTAAAACCAGAATAAACAGGG - Intergenic
991394765 5:66192560-66192582 ATTTATAACCAGAATATACAAGG - Intergenic
991770808 5:70039268-70039290 CTTTATTATCAGCATGAGAACGG - Intronic
991850102 5:70914685-70914707 CTTTATTATCAGCATGAGAACGG - Intronic
992785715 5:80168771-80168793 CTTTGAAACAACAATGAGCAAGG + Intronic
992821760 5:80504834-80504856 CTTTATAACCACACTGATAAAGG + Intronic
993336922 5:86671185-86671207 CTTTATAAGCAGCATGAGAATGG + Intergenic
993740690 5:91534971-91534993 ATTTATAACCTCCATGAGCATGG + Intergenic
993761142 5:91799220-91799242 CTTTATTAGCAGCATGAGAATGG - Intergenic
994396542 5:99229949-99229971 CTTTTGAGCCAGAATGAGCCAGG - Intergenic
994503511 5:100609960-100609982 CTTAATAACCAGAATCTGTAAGG - Intergenic
994523950 5:100880246-100880268 CTTTACAACTAGAATATGCAAGG - Intronic
994578474 5:101610555-101610577 CTTTATTAGCAGCATGAGAATGG - Intergenic
994974826 5:106788641-106788663 CTGTATACTCATAATGAGCATGG + Intergenic
995050189 5:107694615-107694637 CTTTATTAGCAGCATGAGAACGG - Intergenic
995429001 5:112053925-112053947 CTTTATTAGCAGCATGAGAATGG + Intergenic
996006703 5:118429731-118429753 CTTTATTAGCAGCATGAGAATGG - Intergenic
996042129 5:118827136-118827158 CTTTATTAGCAGCATGAGAATGG - Intergenic
996250939 5:121331294-121331316 CTTTATTAGCAGAATGAGAATGG + Intergenic
997620031 5:135281982-135282004 CTTTATTAGCAGCATGAACACGG + Intronic
997692752 5:135837840-135837862 CTTTATTAGCAGAATAAGAATGG + Intronic
997801374 5:136865951-136865973 CTCCATCACCAGAATCAGCATGG - Intergenic
1000538475 5:162509335-162509357 CTATATAACCAGAATAGACATGG + Intergenic
1000612335 5:163388015-163388037 CTTTATTAGCAGCATGAGAAGGG - Intergenic
1000624611 5:163525027-163525049 CTTTATTAGCAGCATGAGAATGG - Intergenic
1000706668 5:164521332-164521354 CATTTTAACCAGAATGATAAGGG + Intergenic
1001054593 5:168438548-168438570 CTTTATTAGCAGCATGAGAACGG + Intronic
1001694827 5:173662137-173662159 CTTTATCAGCAGCATGAGAATGG - Intergenic
1002961893 6:1923174-1923196 CTTTATCAGCAGCATGAGAACGG + Intronic
1003659479 6:8046341-8046363 CTTTATAAGCAGCATGAAAATGG + Intronic
1004245799 6:13973761-13973783 CTTTATTAGCAGCATGAGAATGG + Intronic
1004700531 6:18075294-18075316 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1005783558 6:29218704-29218726 CTTTATTAGCAGCATGAGAATGG + Intergenic
1006052089 6:31353013-31353035 CATTATAACCAGAGTAAGGAAGG - Intronic
1007070577 6:39035115-39035137 CATGGTAACCAGAAGGAGCATGG + Intergenic
1007230600 6:40345217-40345239 CTTTATAAGCAGAGTGGACATGG + Intergenic
1007979299 6:46134158-46134180 CTTTGTAACTAGAATGATAAAGG + Intronic
1008658871 6:53644775-53644797 CTTTATTAGCAGCATGAGAATGG + Intergenic
1008851735 6:56030435-56030457 CTTTATTAGCAGCATGAGGATGG + Intergenic
1008966996 6:57322698-57322720 CTTTATTAGCAGCATGAGAATGG + Intronic
1009359809 6:62797206-62797228 CTTTTGAGCCAGAATGAGCCAGG - Intergenic
1009377661 6:62991759-62991781 CTTTATTAGCAGCATGAGAATGG - Intergenic
1009482977 6:64183283-64183305 CTTTATTAGCAGCATGAGAATGG + Intronic
1009569643 6:65367920-65367942 CTTTATTAGCAGTATGAGAATGG - Intronic
1009620187 6:66064858-66064880 CTTTATTAGCAGCATGAGAATGG + Intergenic
1009819169 6:68777494-68777516 AGTAATAACCAGAATGATCAGGG + Intronic
1010003688 6:70972904-70972926 CTTTATCAGCAGCATGAGAATGG + Intergenic
1010841629 6:80653198-80653220 CTTTTGAACCAGGATGAGCCAGG + Intergenic
1010845426 6:80701640-80701662 CTTTATTAGCAGAATGTGAATGG + Intergenic
1011040973 6:83030563-83030585 CTTTATTAGCAGCATGAGAACGG + Intronic
1011129925 6:84042317-84042339 CTTTATTAGCAGTATGAGAATGG + Intronic
1011263891 6:85496249-85496271 CTTTATTAGCAGCATGAGAACGG - Intergenic
1012005908 6:93712633-93712655 CTTTATTAGCAGCATGAGAATGG + Intergenic
1012194277 6:96319102-96319124 CTTTATCAGCAGAATGAAAATGG - Intergenic
1012250994 6:96980821-96980843 CTTTATTAGCAGCATGAGAACGG - Intronic
1012389491 6:98721257-98721279 ATTTATTACCAGAAAGACCAGGG + Intergenic
1012390184 6:98729378-98729400 CTTTATTAGCAGCATGAGAAGGG + Intergenic
1012391135 6:98741319-98741341 CTTTATGAGCAGCATGAGAATGG + Intergenic
1012739055 6:102990894-102990916 ATTTATAACCAGAATATACAAGG - Intergenic
1012867272 6:104633349-104633371 CTTTATTAGCAGTATGAGAAGGG - Intergenic
1012892774 6:104915737-104915759 ATTTATAACCAGAATGCATAAGG + Intergenic
1013417159 6:109935353-109935375 CTTTATTAGCAGCATGAGAATGG - Intergenic
1014228430 6:118874773-118874795 CTATATATCAAGAATGAACAAGG + Intronic
1014344288 6:120248268-120248290 ATTAATAACCAGAATATGCAAGG + Intergenic
1014580976 6:123137017-123137039 CTTTATTAGCAGCATGAGAATGG + Intergenic
1014671214 6:124306066-124306088 GTTTATAATCAGAATCTGCAAGG + Intronic
1014882781 6:126743909-126743931 CTTTATTAGCAGTATGAGAATGG + Intergenic
1015061853 6:128975865-128975887 CTTTATTAGCAGCATGAGAATGG + Intronic
1015199285 6:130561210-130561232 CTTTATTAGCAGCATGAGAATGG - Intergenic
1015598259 6:134887259-134887281 CTTTATTAGCAGCATGAGAACGG - Intergenic
1015995651 6:138993290-138993312 CTTTATTAGCAGCATGAGAACGG + Intergenic
1015995930 6:138995242-138995264 CTTTATTAGCAGCATGAGAATGG + Intergenic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016294208 6:142556740-142556762 ATTAATAACCAGAATATGCATGG + Intergenic
1016355150 6:143210307-143210329 CTTTATTAGCAGCATGAGAATGG + Intronic
1016524163 6:144981589-144981611 CTTTATTAGCAGCATGAGAATGG - Intergenic
1017386679 6:153893192-153893214 CTTTATTACCATATTGTGCAAGG - Intergenic
1017448135 6:154528178-154528200 CTTTATTAGCAGAGTGAGAATGG - Intergenic
1017531980 6:155302772-155302794 CTTTATTAGCAGCATGAGAACGG - Intronic
1018585349 6:165350968-165350990 CTTTATTAGCAGCATGAGAACGG + Intronic
1019066728 6:169307782-169307804 ATTAATAACCAGAATATGCAAGG + Intergenic
1019150704 6:170003754-170003776 CTTTATTAGCAGCATGAGAATGG - Intergenic
1020318069 7:6920906-6920928 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1020322307 7:6948413-6948435 CTTTTGAGCCAGGATGAGCAAGG + Intergenic
1020324264 7:6962128-6962150 CTTTTGAGCCAGGATGAGCAAGG + Intergenic
1020928800 7:14367567-14367589 CTTTATTAGCAGTATGAGAATGG + Intronic
1021138666 7:16996317-16996339 CTTTATTAGCAGCATGAGAATGG - Intergenic
1021341199 7:19464372-19464394 CTTTATTAGCAGCATGAGGACGG + Intergenic
1022038744 7:26559231-26559253 CTTTATTAGCAGCATGAGAATGG - Intergenic
1022247196 7:28571717-28571739 CCTTATCCCCAGAATGAGGATGG + Intronic
1022863097 7:34388359-34388381 CTTTATTAGCAGCATGAGAATGG + Intergenic
1023162284 7:37309076-37309098 CTTTATTAGCAGCATGAGAACGG - Intronic
1023287253 7:38632091-38632113 CTTTAAAACAAGAGTTAGCAGGG + Intergenic
1023650636 7:42365258-42365280 CTTTATTAGCAGAATGAAAAGGG - Intergenic
1023685595 7:42731540-42731562 CTTTATTAGCAGCATGAGAATGG + Intergenic
1024061210 7:45699974-45699996 CTTGATAACCAGAGAGACCAAGG - Intronic
1024114631 7:46181058-46181080 CTTTATTAGCAGCATGAGAATGG - Intergenic
1024792932 7:52986563-52986585 CTTTATTACCAGCATGAAAATGG + Intergenic
1026051467 7:66950576-66950598 CTTTATCAGCAGCATGAGAAAGG + Intronic
1026109433 7:67447110-67447132 CTTTATTAGCAGCATGAGAATGG + Intergenic
1026232558 7:68497930-68497952 CTTTATTAGCAGCATGAGAATGG + Intergenic
1026586644 7:71661091-71661113 CATTGTAACCACAGTGAGCAGGG - Intronic
1026621664 7:71955007-71955029 CTTTATTAGCAGTATGAGAAGGG - Intronic
1027842957 7:83337799-83337821 CTTTATTAACAGCATGAGAAGGG - Intergenic
1028689835 7:93640098-93640120 CTTTTGAGCCAGAATGAGCCAGG - Intronic
1028884286 7:95913672-95913694 CTTTATTAACAGCATGAGAAAGG + Intronic
1030527768 7:110674028-110674050 CTTTATTAGCAGCATGAGAATGG - Intronic
1031175315 7:118341301-118341323 CTTTATTAGCAGTGTGAGCATGG + Intergenic
1031194092 7:118590429-118590451 CTTTATTAACAGCATGAGAACGG + Intergenic
1031413807 7:121472068-121472090 CTTTATTAGCAGCATGAGAACGG - Intergenic
1031521963 7:122777852-122777874 CTTTATTAGCAGCATGAGAATGG + Intronic
1031554635 7:123157612-123157634 TTTTACAACTAGAAAGAGCAAGG - Intronic
1031620359 7:123927694-123927716 CTTTATAACCAAACTAAACAGGG - Intronic
1031778349 7:125930758-125930780 CTTTATCAGCAGCATGAGAAAGG - Intergenic
1031793446 7:126139797-126139819 CTTTATTAGCAGGATGAGAATGG - Intergenic
1032440495 7:131939131-131939153 CTTTATTAGCAGCATGAGAATGG + Intergenic
1032703973 7:134406183-134406205 CTTTATCAGCAGCATGAGAATGG + Intergenic
1032865168 7:135917563-135917585 CTTTATTAGCAGCATGAGAACGG + Intergenic
1033048407 7:137982727-137982749 CTTTATCAGCAGCATGAGAACGG + Intronic
1033129975 7:138737461-138737483 CTTTATCACCAGCATGAAAAGGG + Intronic
1034013011 7:147550545-147550567 CTTTATTAGCAGCATGAGAATGG + Intronic
1034029231 7:147741873-147741895 CTTTATCAGCAGCATGAGAATGG - Intronic
1034040577 7:147873295-147873317 CCTTATTAGCAGAATGAGAATGG - Intronic
1034119959 7:148618182-148618204 CTTTATAAGCAGTGTGAGAATGG - Intergenic
1035116533 7:156529289-156529311 CTTTATTAGCAGCATGAGAATGG - Intergenic
1035561430 8:607097-607119 CTTGAAAACCAGAATGTACAAGG - Intergenic
1035796773 8:2364715-2364737 CTTTATTAGCAGCATGAGAATGG + Intergenic
1036123228 8:6040032-6040054 CTTTATTAGCAGCATGAGAATGG + Intergenic
1036371800 8:8168837-8168859 CTTTGGAGCCAGGATGAGCAAGG - Intergenic
1036373872 8:8183626-8183648 CTTTTGAGCCAGGATGAGCAAGG - Intergenic
1036877031 8:12482015-12482037 CTTTTGAGCCAGGATGAGCAAGG + Intergenic
1036879102 8:12496807-12496829 CTTTGGAGCCAGGATGAGCAAGG + Intergenic
1037151706 8:15643271-15643293 CTTTATTAGCAGCATGAGAATGG + Intronic
1037178527 8:15975059-15975081 CTTTATCAGCAGCATGAGAACGG + Intergenic
1037452418 8:19029379-19029401 CTTTATTAGCAGCATGAGAATGG - Intronic
1037993613 8:23337939-23337961 CTTTATTAGCAGCATGAGAATGG - Intronic
1038150359 8:24937840-24937862 CTTTATTAGCAGCATGAGAATGG + Intergenic
1038159389 8:25022493-25022515 CTTTATTAACAGCATGAGAATGG - Intergenic
1038194861 8:25358107-25358129 CTTTATTAGCAGCATGAGAACGG - Intronic
1038393555 8:27229279-27229301 CTTTATTAGCAGCATGAGAATGG + Intergenic
1038913490 8:31993693-31993715 CTTTATCAGCAGCATGAGAATGG + Intronic
1039029412 8:33293506-33293528 CTTTATCAGCAGCATGAGAATGG - Intergenic
1040384978 8:46908871-46908893 CTTTATTAGCAGTATGAGAAAGG + Intergenic
1040494944 8:47958293-47958315 CTATATAACCTGAATGAATAAGG + Intronic
1040554668 8:48468241-48468263 CTTTATTACCAGCATTAGAACGG - Intergenic
1041333846 8:56757871-56757893 CTTTATTAGCAGCATGAGAATGG - Intergenic
1042011285 8:64247832-64247854 CTTTTTATCCAGAAAGAGAAAGG - Intergenic
1042020357 8:64367570-64367592 CTTTAAAACCAGAACAAGTATGG - Intergenic
1042423600 8:68620457-68620479 CTGTATTACCAGAGTGAGCAAGG + Intronic
1042684447 8:71422557-71422579 CTTTATTAGCAGCATGAGAATGG - Intronic
1042855704 8:73264901-73264923 CTATAAAACCAGAATGAGGTTGG + Intergenic
1043266135 8:78269849-78269871 CTTTATTAACAGCATGAGAATGG - Intergenic
1043595295 8:81878460-81878482 CTTTATTAACAGCATGAGAATGG + Intergenic
1043794786 8:84522870-84522892 CTTTATTAGCAGCATGAGAATGG - Intronic
1044234119 8:89810162-89810184 CTTTATTAGCAGCATGAGAATGG + Intergenic
1044324665 8:90846599-90846621 CTTTATTAGCAGCATGAGAATGG - Intronic
1045251067 8:100483956-100483978 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1045588023 8:103561777-103561799 CTTTATCACCCGAATGAAAATGG - Intronic
1046293779 8:112196038-112196060 CTTTTGAGCCAGAATGAGCCAGG - Intergenic
1046333756 8:112755612-112755634 CTTTATAAACAGGGTGAGAACGG + Intronic
1046408648 8:113809949-113809971 CTTTTTGACCAAAATGAGCCTGG + Intergenic
1046452105 8:114406591-114406613 CTTTATTAGCAGCATGAGAATGG - Intergenic
1046506860 8:115147588-115147610 CTTTATTAGCAGCATGAGAATGG - Intergenic
1046519804 8:115309568-115309590 CTTTATAAGCAGCATGAAAACGG - Intergenic
1046600687 8:116314242-116314264 CTTTATCAGCAGCATGAGAATGG - Intergenic
1046613565 8:116451571-116451593 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1046940337 8:119924924-119924946 CTTTATTAGCAGCATGAGAATGG - Intronic
1047062540 8:121244073-121244095 CTTTATCAGCAGGATGAGAACGG + Intergenic
1047206712 8:122808259-122808281 CTTTATTAGCAGCATGAGAATGG - Intronic
1047478047 8:125254433-125254455 CTTCAGAATCTGAATGAGCATGG - Intronic
1047621686 8:126613942-126613964 CTTTATCAGCAGAATGAAAATGG + Intergenic
1048252322 8:132877001-132877023 CATTGTAACCAGAATGTGGAAGG + Intronic
1048591698 8:135826521-135826543 CTTTATTAGCAGCATGAGAATGG - Intergenic
1048622887 8:136153877-136153899 CTTTATTAGCAGCATGAGAATGG + Intergenic
1048669223 8:136697138-136697160 CTTTATTAGCAGCATGAGAATGG + Intergenic
1050050663 9:1597817-1597839 CCTAATATCCAGAATGAACAAGG - Intergenic
1050118112 9:2281278-2281300 CTTTTTAGCCAGGATGAGCCAGG - Intergenic
1050214257 9:3304813-3304835 CTTTATCAGCAGCATGAGAACGG + Intronic
1050661842 9:7891469-7891491 CTTTATCAGCAGAATGAAAATGG - Intergenic
1051017138 9:12491987-12492009 CTTTATTAGCAGCATGAGAATGG + Intergenic
1051216705 9:14805388-14805410 CTTTTTAACCAGTATGCACAGGG + Intronic
1051263809 9:15291511-15291533 CTTTATCAGCAGCATGAGAACGG + Intronic
1051272479 9:15368700-15368722 CTTTATTAGCAGCATGAGAATGG + Intergenic
1052124149 9:24755107-24755129 CTTTATTAGCAGCATGAGAACGG + Intergenic
1053721093 9:40947267-40947289 CTTTATTAGCAGCATGAGAATGG - Intergenic
1054344896 9:63904888-63904910 CTTTATTAGCAGCATGAGAATGG + Intergenic
1054868443 9:70026463-70026485 CTTTATTAGCAGCATGAGAATGG - Intergenic
1055001876 9:71460381-71460403 CTTTATTAGCAGCATGAGAATGG - Intergenic
1055667526 9:78567525-78567547 GTTTGGAACCAGAAAGAGCAGGG + Intergenic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1055895582 9:81171021-81171043 CTTTAAAACCAGAAAGAGTGGGG - Intergenic
1056064310 9:82917270-82917292 CTTTATTAGCAGCATGAGAACGG - Intergenic
1056505374 9:87253361-87253383 CTTTATCAGCAGCATGAACACGG - Intergenic
1056784320 9:89579204-89579226 CCTTATTAGCAGAATGAGAATGG - Intergenic
1057431839 9:95002067-95002089 CTTTATAAACAGGCTGTGCACGG - Intronic
1058464899 9:105217409-105217431 CTTTATTAGCAGTATGAGAATGG - Intergenic
1058725269 9:107797322-107797344 CTTTATCAGCAGCATGAGAACGG - Intergenic
1058892844 9:109375493-109375515 CTTTATTAGCAGCATGAGAATGG + Intronic
1058998203 9:110320517-110320539 CTTTATTAGCAGCATGAGAACGG + Intronic
1059040811 9:110813803-110813825 CTTTATTAGCAGCATGAGAATGG - Intergenic
1059122776 9:111657317-111657339 CTTTATAACCGGATAGAACAAGG + Intronic
1059490746 9:114665574-114665596 CTTTATTAACAGCATGAGAACGG - Intergenic
1059628455 9:116092720-116092742 CTTTATTAGCAGTATGAGAATGG + Intergenic
1059875625 9:118631497-118631519 CTTTATTAGCAGCATGAGAACGG - Intergenic
1060730197 9:126032190-126032212 CTTTATTAGCAGCATGAGAACGG - Intergenic
1060751954 9:126175972-126175994 CTTTATTAGCAGCATGAGAATGG - Intergenic
1061332728 9:129906668-129906690 CTTTATTAGCAGCATGAGAATGG + Intronic
1061667290 9:132168072-132168094 CTGTATGACCAGAATGACAACGG - Intronic
1203454094 Un_GL000219v1:148883-148905 CTTTATTAGCAGCATGAGAATGG + Intergenic
1185845036 X:3430008-3430030 CTTTATTAGCAGCATGAGAACGG + Intergenic
1186036205 X:5426147-5426169 CTTTATTAGCAGCATGAGAATGG + Intergenic
1186042159 X:5492494-5492516 CTTTATTAGCAGCATGAGAATGG + Intergenic
1186057965 X:5671602-5671624 CTTTATTAGCAGAATGAGAATGG - Intergenic
1186167306 X:6840327-6840349 CTTTATCAGCAGCATGAGAATGG + Intergenic
1186537550 X:10365411-10365433 CTTTATTAGCAGCATGAGAATGG + Intergenic
1186567075 X:10674632-10674654 CTTTATAACCAGAATGAGCATGG + Intronic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1187260893 X:17684226-17684248 CTTTATTAGCAGCATGAGAATGG + Intronic
1188054689 X:25527528-25527550 CTTTATTAGCAGAATGAGAACGG - Intergenic
1188463724 X:30454624-30454646 CTTTTGAGCCAGGATGAGCAAGG + Intergenic
1188749413 X:33886273-33886295 CTTTATTAGCAGTATGAGAATGG + Intergenic
1188918834 X:35946769-35946791 CATTATAACACAAATGAGCATGG - Intronic
1189202842 X:39212495-39212517 CTTTATTAGCAGCATGAGAACGG + Intergenic
1189345520 X:40238253-40238275 TTTTAAAACCAGACTGAGCAGGG - Intergenic
1189433207 X:40968071-40968093 CTTTATTAGCAGCATGAGAATGG - Intergenic
1189983588 X:46533917-46533939 CTTTATCAACAGCATGAGAACGG - Intronic
1190804889 X:53825640-53825662 ATTAATAACCAGAATAAACAAGG + Intergenic
1191227608 X:58061018-58061040 ATTTATAACCAGAATGTATAAGG - Intergenic
1191593487 X:62915518-62915540 CTTTATTAGCAGCATGAGAATGG + Intergenic
1191931672 X:66380173-66380195 CTTTATTAGCAGCATGAGAATGG - Intergenic
1192305228 X:69952225-69952247 CTTTATCAGCAGAATGAAAATGG - Intronic
1192334851 X:70209938-70209960 CTTTATTAGCAGCATGAGAACGG + Intergenic
1192418124 X:71002753-71002775 CTTTATAAGCAGCATGAGAACGG + Intergenic
1193022715 X:76808216-76808238 ATTAATAACCAGAATGCACAAGG + Intergenic
1194049495 X:89052149-89052171 CTTTATTAGCAGAGTGAGAATGG - Intergenic
1194106841 X:89780137-89780159 CTTTATTAGCAGTATGAGAATGG - Intergenic
1194145743 X:90260237-90260259 CTTTATTAACAGCATGAGAACGG - Intergenic
1194506056 X:94735252-94735274 CTTTATCACCAGCATGAAAACGG - Intergenic
1194659844 X:96618639-96618661 CTTTATTAGCAGCATGAGAATGG - Intergenic
1194756468 X:97744451-97744473 CTTTATTAGCAGCATGAGAATGG + Intergenic
1194851838 X:98880473-98880495 CTTTATTAGCATAATGAGAACGG - Intergenic
1194952539 X:100144374-100144396 CTTTATTAGCAGCATGAGAACGG + Intergenic
1195514472 X:105757594-105757616 CTTTAAAATCAGACTGAGTAGGG + Intronic
1195536198 X:106011975-106011997 CTTTATTAGCAGCATGAGAACGG + Intergenic
1195986218 X:110633423-110633445 ATTAATAACCAGAATAAGTAAGG + Intergenic
1196289690 X:113924478-113924500 CTTTATGACCAGAATATACAAGG - Intergenic
1196760646 X:119197913-119197935 CTTTATTAGCAGCATGAGAACGG + Intergenic
1197025870 X:121749055-121749077 CTTTATTAGCAGCATGAGAACGG + Intergenic
1197507611 X:127327334-127327356 CTTTATTAGCAGCATGAGAATGG - Intergenic
1197585657 X:128344640-128344662 CTTTATTACCAGCATGAGAGCGG - Intergenic
1197810580 X:130438721-130438743 ATTAATAACCAGAATATGCAAGG - Intergenic
1197995349 X:132366877-132366899 CTTTATTAGCAGCATGAGGATGG - Intergenic
1198024137 X:132688385-132688407 CTTTATTAGCAGCATGAGAATGG - Intronic
1198452990 X:136786481-136786503 CTTTATTAGCAGCATGAGAATGG - Intergenic
1198598895 X:138264266-138264288 CTTTTGAGCCAGAATGAGCCAGG - Intergenic
1198608898 X:138375232-138375254 CTTTATTAGCAGAGTGAGAATGG - Intergenic
1198919183 X:141707096-141707118 CTTTATTAGCAGCATGAGAACGG - Intergenic
1199044143 X:143148642-143148664 CTTTATTACCAGCATGAGAATGG + Intergenic
1199203961 X:145125378-145125400 CTTTATTAGCAGTATGAGAATGG - Intergenic
1199346338 X:146745851-146745873 CTTTATTAGCAGCATGAGAATGG - Intergenic
1199374890 X:147096759-147096781 CTATATAAACAGAGTGAGCTTGG + Intergenic
1199580978 X:149359404-149359426 ATTAATAACCAGAATAAGCTGGG - Intergenic
1199751409 X:150823179-150823201 CTTTATTAGCAGCATGAGAATGG + Intronic
1200458803 Y:3428002-3428024 CTTTATTAGCAGTATGAGAATGG - Intergenic
1200491494 Y:3829532-3829554 CTTTATTAACAGCATGAGAACGG - Intergenic
1200674984 Y:6139379-6139401 CTTTTGAGCCAGAATGAGCCAGG - Intergenic
1200791261 Y:7301638-7301660 CTTTATTAGCAGCATGAGAATGG - Intergenic
1201184717 Y:11389146-11389168 CTTTATCAGCAGAATGACAACGG + Intergenic
1201589879 Y:15603391-15603413 CTTTATTAGCAGAATGAGAATGG - Intergenic