ID: 1186570908

View in Genome Browser
Species Human (GRCh38)
Location X:10713851-10713873
Sequence CCTCTCTTGATGAAGTACTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186570904_1186570908 1 Left 1186570904 X:10713827-10713849 CCAGGCCAGGGAGAGATGGGGCA 0: 1
1: 0
2: 3
3: 47
4: 418
Right 1186570908 X:10713851-10713873 CCTCTCTTGATGAAGTACTCCGG 0: 1
1: 0
2: 1
3: 12
4: 116
1186570905_1186570908 -4 Left 1186570905 X:10713832-10713854 CCAGGGAGAGATGGGGCACCCTC 0: 1
1: 0
2: 6
3: 28
4: 242
Right 1186570908 X:10713851-10713873 CCTCTCTTGATGAAGTACTCCGG 0: 1
1: 0
2: 1
3: 12
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186570908 Original CRISPR CCTCTCTTGATGAAGTACTC CGG Intronic
902848830 1:19136854-19136876 CATCTCTGGATGAATTTCTCTGG - Intronic
909484863 1:76161450-76161472 CAGCTCTTGATGAAGGACTGAGG - Intronic
911055201 1:93702642-93702664 CCTGTCTTAATGAAGTGCTTTGG - Intronic
912104468 1:106254570-106254592 ATTCTCTTGATGTAGTACTATGG - Intergenic
918535226 1:185566215-185566237 CCTCTCTTGATTAAATTTTCAGG + Intergenic
924531980 1:244901089-244901111 CCTTTCTTGAAGAACTGCTCAGG - Intergenic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1063464297 10:6233022-6233044 CCTCTCCGGAAGAAGTCCTCAGG - Exonic
1064648684 10:17486048-17486070 CATCTCTAGATGAAGTAATCAGG + Intergenic
1064847118 10:19667777-19667799 CCTCTCTTTATAAATTACCCAGG + Intronic
1065498549 10:26355131-26355153 CCTCTCTTGAGGATGTGCCCAGG + Intergenic
1065498607 10:26355704-26355726 TCTCTCTTCATGAACTACCCAGG - Intergenic
1073716671 10:106115252-106115274 ACTCGCTTAATGAAGCACTCTGG - Intergenic
1075235496 10:120723976-120723998 CCTCTCTTCCTGAGGTGCTCTGG + Intergenic
1077580696 11:3415305-3415327 CCTCTCTTGGTGCAGCCCTCGGG - Intergenic
1078360243 11:10662351-10662373 TCTCTCTCGATGATGTACCCGGG + Intronic
1079104477 11:17561468-17561490 CCTCTCTTCAAGGAGTTCTCTGG + Intronic
1079451797 11:20604619-20604641 CCTCTCTAGATAAGATACTCCGG - Intronic
1080109264 11:28547035-28547057 CCTCTCTCAATGAAGAACTGAGG - Intergenic
1084237623 11:67798134-67798156 CCTCTCTTGGTGCAGCCCTCAGG - Intergenic
1087461015 11:98447278-98447300 CCTCTTTTGATGAACTACGGAGG + Intergenic
1091693395 12:2611888-2611910 CCTCTCCTGATGCAGCACTACGG + Exonic
1092408298 12:8235727-8235749 CCTCTCTTGGTGCAGCCCTCGGG - Intergenic
1100164013 12:91895648-91895670 CCTCTCTTGATGCATCATTCAGG - Intergenic
1101526014 12:105531723-105531745 CCTTTCTTTATAAATTACTCAGG - Intergenic
1105829060 13:24148259-24148281 GCTCTGGTGATGAAGTCCTCAGG + Intronic
1114054895 14:18959371-18959393 CCATGTTTGATGAAGTACTCTGG - Intergenic
1114107646 14:19442406-19442428 CCATGTTTGATGAAGTACTCTGG + Intergenic
1120012126 14:79427925-79427947 TCTCTCTCGATGTAGCACTCAGG - Intronic
1121577580 14:95000908-95000930 CCTCTCTTTAAGAACTTCTCAGG - Intergenic
1128881355 15:71246003-71246025 CCTCTCTTGATGCTGGACACTGG - Intronic
1133468424 16:6050689-6050711 TTTCTCTTTAAGAAGTACTCCGG - Intronic
1136405401 16:30043263-30043285 TCTCCCTTGATGAAGTACACTGG + Intronic
1137486613 16:48896400-48896422 CCTCATTTGATGAGGTCCTCTGG + Intergenic
1139555725 16:67708753-67708775 CCTCTCAGGATGCAGTGCTCTGG - Intronic
1143986847 17:10921974-10921996 CTTCTCTTGACCAAGCACTCAGG + Intergenic
1153237375 18:3000866-3000888 CATCTCTTGATGAAGCACCTTGG - Intronic
1155450157 18:25954432-25954454 CATATTTTGATGAAGAACTCTGG + Intergenic
1163489225 19:17607019-17607041 CCTCTATCCCTGAAGTACTCCGG + Intronic
927916936 2:26943118-26943140 CCACTCTTGATGAAGCAAGCGGG + Intronic
929298632 2:40275967-40275989 ACTCTACTGATGGAGTACTCAGG - Intronic
935830461 2:106996405-106996427 CCACTCCTGATGAATTGCTCAGG + Intergenic
937568969 2:123333655-123333677 TCTCTCTTGAAAAAGTAGTCTGG - Intergenic
938472902 2:131582159-131582181 CCGTGTTTGATGAAGTACTCCGG - Intergenic
938619000 2:133030239-133030261 CATCTCATGATGAAGTATTCTGG + Intronic
939689811 2:145244037-145244059 CTTTTCTTGATGCAGTGCTCAGG + Intergenic
940277300 2:151952714-151952736 CCTTTCTCGATGAAGGAATCAGG - Intronic
940334970 2:152516868-152516890 ACTTTCTTTATAAAGTACTCAGG + Intronic
947693649 2:232163601-232163623 CTTCTCTTGCTGAACTCCTCTGG - Exonic
1172711257 20:36925499-36925521 TCAATTTTGATGAAGTACTCTGG - Intronic
1173054863 20:39601982-39602004 CCACTCAGGATGAAGTGCTCAGG + Intergenic
1174626930 20:51923184-51923206 GATCTCTTGATGAGGTGCTCAGG + Intergenic
1177520878 21:22223319-22223341 CCTTTCTTGATGAAGCCATCTGG - Intergenic
1178102342 21:29283355-29283377 CCTCTCTTCAGGCAGTAATCTGG + Intronic
1178877785 21:36426050-36426072 CCACTCTTGACGAAGTATTATGG - Intergenic
1180473377 22:15681921-15681943 CCATGTTTGATGAAGTACTCTGG - Intergenic
1184546973 22:45177184-45177206 CCTGTCTCAATGCAGTACTCTGG - Intronic
952605232 3:35139150-35139172 TTTCTCTTGATTAATTACTCTGG - Intergenic
952925559 3:38316946-38316968 CCAGTCTTGATGAAGGACTCTGG + Intronic
954088234 3:48264051-48264073 CCCCTCCTGATGATGTACACTGG - Intronic
955829537 3:62986497-62986519 CCTCTCTTGATCTAGTAAGCTGG + Intergenic
956231986 3:67027868-67027890 CCTCTCCTGCTGAAGGTCTCTGG + Intergenic
956765437 3:72480753-72480775 CCTCTCATGATGAAGTGACCTGG + Intergenic
957053578 3:75427901-75427923 CCTCTCTTGGTGCAGCCCTCGGG - Intergenic
957589639 3:82179430-82179452 ACTCTCATGCTGAAGTGCTCGGG - Intergenic
957679869 3:83420028-83420050 CCTCTCTTGAATATGTGCTCTGG + Intergenic
961301255 3:125923649-125923671 CCTCTCTTGGTGCAGCCCTCAGG + Intergenic
962084508 3:132175976-132175998 CCTCTCTGGATGAAGTAATGGGG - Intronic
964235043 3:154515677-154515699 CTTCTCTTGCTGAATTTCTCTGG + Intergenic
967203622 3:187098941-187098963 CCTGTCTTGCTCCAGTACTCAGG - Intergenic
968996372 4:3948213-3948235 CCTCTCTTGGTGCAGCCCTCGGG - Intergenic
969133136 4:5006881-5006903 CCTCTGTTGATGGAGAACTTAGG - Intergenic
969757615 4:9160475-9160497 CCTCTCTTGGTGCAGCCCTCGGG + Intergenic
969817593 4:9698006-9698028 CCTCTCTTGGTGCAGCCCTCGGG + Intergenic
976169551 4:82288750-82288772 CCTCTCTTGGTGAAGCATACAGG + Intergenic
976633790 4:87266907-87266929 CCTTTCTTGATGAAGATCTATGG - Intergenic
978327961 4:107579858-107579880 ACTCACTTAATGAAGCACTCTGG - Intergenic
979570990 4:122224505-122224527 CCCCTGTGGATGAAGTACTCAGG + Exonic
979670942 4:123359654-123359676 GCTCTCCTGATGATGCACTCTGG - Intergenic
980684990 4:136216012-136216034 TTTCTCTTGATTAATTACTCTGG + Intergenic
981273889 4:142875237-142875259 GCTCTCTTAATGAAGCACTCTGG - Intergenic
981805175 4:148707032-148707054 CCTGTCTTCATGAATTACTCAGG + Intergenic
981889903 4:149723352-149723374 CCTCTCTTGTTCTAGTACTTAGG + Intergenic
982337579 4:154257593-154257615 CCTCTGTTGATGCAGTCCTGGGG - Intronic
983820968 4:172193169-172193191 ACTCACTTAATGAAGCACTCTGG - Intronic
984489539 4:180415569-180415591 TCTCTGTTGATGAAGTGCACTGG + Intergenic
984489564 4:180415867-180415889 CTTCTGTTGATGAAGTACACCGG + Intergenic
985849102 5:2375433-2375455 CCTCTCTTCATGAAGGTCACAGG + Intergenic
986265233 5:6184861-6184883 CCTCTCCTGAGGAAGGACTTAGG + Intergenic
990798918 5:59577140-59577162 CTTCTCTTGATAAAGGTCTCAGG - Intronic
991441659 5:66656617-66656639 CCTCTCTTGATTAGGTTCACTGG + Intronic
992353680 5:75957066-75957088 TCTTTCTTGATTATGTACTCAGG - Intergenic
992403754 5:76436282-76436304 CCTGTCTTGTTCCAGTACTCAGG + Intronic
993480361 5:88417043-88417065 CTCCTCTTGATGAAGAAATCAGG + Intergenic
999865317 5:155694713-155694735 CTTCTCTTGTTGATGTTCTCTGG + Intergenic
1001124564 5:169007819-169007841 CTTCTCTTGCTGAAGCACTCAGG + Intronic
1002864371 6:1108027-1108049 CCTCTCCTGTTGAAGTTCTAGGG + Intergenic
1008594843 6:53031664-53031686 CCTCTCTTGCTGCAGTACTCAGG - Intronic
1010060258 6:71614685-71614707 CCTCTATTGAGAATGTACTCTGG - Intergenic
1017307923 6:152940748-152940770 ATTGTCTTGATGGAGTACTCTGG - Intergenic
1018262082 6:161980319-161980341 CTTCTCTTGATAAAGTAATGGGG + Intronic
1018286827 6:162249510-162249532 CCTTTCTTCTTGAAGTTCTCAGG - Intronic
1020320648 7:6936627-6936649 CCTCTCTTGGTGCAGCCCTCGGG - Intergenic
1023651508 7:42373995-42374017 CCTCGTTTGATGATGTGCTCTGG + Intergenic
1024102447 7:46046386-46046408 GCTCTGTTGATGAAGTTCTTTGG - Intergenic
1027587149 7:80072550-80072572 CTTCTCTTGCTGAATTGCTCTGG - Intergenic
1029669514 7:102019550-102019572 CCCCTCTTGATCAGGAACTCAGG + Intronic
1032315590 7:130835590-130835612 CCTCTCTAGATGATCTAATCTGG + Intergenic
1035840562 8:2808413-2808435 CCTGTCTTGATTGAGTACTGTGG - Intergenic
1036380879 8:8235801-8235823 CCTCTCTTGGTGCAGCCCTCGGG + Intergenic
1036848706 8:12186826-12186848 CCTCTCTTGGTGCAGTCCTCAGG - Exonic
1036870067 8:12429107-12429129 CCTCTCTTGGTGCAGTCCTCAGG - Exonic
1038752839 8:30312925-30312947 CCTTTCTTTATAAATTACTCAGG + Intergenic
1039962253 8:42258111-42258133 CTTCTCTTGATAAAATACTGTGG - Intergenic
1043700313 8:83279099-83279121 CCACTCCTGGTGAAGTCCTCAGG + Intergenic
1043806547 8:84679363-84679385 TCTCTCTGGATGAAGTAGTGGGG - Intronic
1045051289 8:98328486-98328508 CTTCTCTTGATGGACAACTCTGG + Intergenic
1046301446 8:112297304-112297326 TCTCTGTTTATGAAGTACTTTGG - Intronic
1047900189 8:129412376-129412398 CATCCCTTTATAAAGTACTCCGG - Intergenic
1186570908 X:10713851-10713873 CCTCTCTTGATGAAGTACTCCGG + Intronic
1188704922 X:33315552-33315574 CCTCTCCTCATGAAGTCATCTGG - Intronic
1190334944 X:49256745-49256767 ACTCACTTGAGGAAGTCCTCTGG + Exonic
1193170864 X:78333867-78333889 CCTCTCTTGATGAAACATCCTGG + Intergenic
1193659181 X:84236556-84236578 ATTCTCTTGATGAAAGACTCAGG + Intergenic
1194930459 X:99881152-99881174 ACCCGCTTAATGAAGTACTCTGG - Intergenic
1195007091 X:100696184-100696206 CTTCTCTTGAGTAAGTACCCAGG + Intronic
1200523689 Y:4245142-4245164 CCTCTTTTGATGAAGTCATTGGG + Intergenic
1202245275 Y:22813635-22813657 TCTCTCTTTATGCAGGACTCAGG - Intergenic
1202398265 Y:24447381-24447403 TCTCTCTTTATGCAGGACTCAGG - Intergenic
1202472516 Y:25222705-25222727 TCTCTCTTTATGCAGGACTCAGG + Intergenic