ID: 1186573535

View in Genome Browser
Species Human (GRCh38)
Location X:10741150-10741172
Sequence AACCTTGGACTATTAAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186573530_1186573535 4 Left 1186573530 X:10741123-10741145 CCTTTACATTTCTAAAGCCCAGG 0: 1
1: 0
2: 0
3: 25
4: 182
Right 1186573535 X:10741150-10741172 AACCTTGGACTATTAAAGCTAGG 0: 1
1: 0
2: 0
3: 7
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186573535 Original CRISPR AACCTTGGACTATTAAAGCT AGG Intronic
907572015 1:55492280-55492302 AACCCTGGACTATAAAACCCTGG + Intergenic
907599306 1:55750667-55750689 TACATTGGACTAAGAAAGCTGGG - Intergenic
910765524 1:90778699-90778721 AACCCTTGACTAATAAAGATAGG + Intergenic
915712671 1:157916400-157916422 AATCTTGGACTGTTAAATATGGG + Intergenic
916611628 1:166397469-166397491 CACCTTAAACTAATAAAGCTTGG + Intergenic
919233720 1:194809438-194809460 AACCATGCACTTTTAAATCTTGG - Intergenic
919290083 1:195618905-195618927 AGCATTGGTCTATGAAAGCTAGG - Intergenic
921816027 1:219564363-219564385 AACCATGCACAATTACAGCTGGG + Intergenic
923844500 1:237713868-237713890 GGCCTTGGACATTTAAAGCTAGG + Intronic
1075580352 10:123613013-123613035 AAACTTGGGCTTTCAAAGCTTGG + Intergenic
1077773612 11:5247873-5247895 AACCTTGAATTCCTAAAGCTTGG + Intergenic
1079768819 11:24432136-24432158 AACCTTGGACTACTTAGGGTAGG + Intergenic
1079917499 11:26387859-26387881 AAGCTTGGACAACTAAAGCTGGG - Intronic
1082097541 11:48143734-48143756 AAACTTGGGCTTTTAAATCTAGG - Intronic
1088937402 11:114417168-114417190 AAACTCTGGCTATTAAAGCTTGG - Intronic
1092800809 12:12164241-12164263 AGAATTGGAATATTAAAGCTAGG - Intronic
1093689199 12:22090481-22090503 CATCTTGGACTATTAGAGCAGGG - Intronic
1095743672 12:45633929-45633951 AACTTTGGACTGTTTAATCTGGG - Intergenic
1096375067 12:51102286-51102308 AACCTTCCACTATCTAAGCTGGG + Intronic
1099990754 12:89718522-89718544 AACCATGGAGTTTTAAAGGTAGG + Intergenic
1103378699 12:120477266-120477288 AACCCTGGGCTCTTAAAGCTGGG - Intronic
1110058366 13:71007670-71007692 AACCTATGGCTATTCAAGCTTGG + Intergenic
1110173689 13:72532051-72532073 AAGCCTGCACTCTTAAAGCTGGG + Intergenic
1119109922 14:71961954-71961976 ATTCATTGACTATTAAAGCTGGG - Intronic
1120320475 14:82953954-82953976 AATCTTGGAGTCTTAAAGCATGG - Intergenic
1145737583 17:27243821-27243843 GTTCTTGGACTTTTAAAGCTGGG + Intergenic
1145772459 17:27503383-27503405 AACCTTGCACTATTAACATTTGG - Intronic
1150947298 17:69761856-69761878 AAACTTGGACTTTTGAAGGTAGG + Intergenic
1155160659 18:23192880-23192902 AACCTTAGCCAATTAAATCTGGG + Intronic
1155692416 18:28642007-28642029 AAGCTTGGATTATGGAAGCTTGG + Intergenic
1158085455 18:53645881-53645903 TGCCTTGGACTAATGAAGCTAGG - Intergenic
930749520 2:54919678-54919700 AACCTTGGTCTACTAAAACCAGG - Intronic
933239385 2:79902946-79902968 AACCTTGGAATATTTACTCTTGG - Intronic
941281714 2:163560153-163560175 ATCCTTTTACTGTTAAAGCTTGG - Intergenic
943114857 2:183655901-183655923 AAACTTGGAATATTAGAGTTGGG - Intergenic
943295967 2:186139517-186139539 ACCCTTGGAGTTTTAAATCTTGG + Intergenic
943938653 2:193960836-193960858 CACCTTGGACTATTATAAATAGG + Intergenic
945006117 2:205408867-205408889 AAATTGGGACTATTAAAACTGGG - Intronic
946863431 2:224021773-224021795 CACCTTGGCCTCTTAAAGTTGGG - Intronic
1174430217 20:50462703-50462725 AAGCTTGGAGTTTTAAAGCTGGG + Intergenic
1175683783 20:61011262-61011284 ATCCTAGGACTACTAAATCTAGG - Intergenic
1178751020 21:35303152-35303174 AACCTTGGACTTTGAGATCTTGG + Intronic
1183854684 22:40623243-40623265 AACTTTGGTCTATTAAAGATTGG - Intronic
949109063 3:236643-236665 AACCTTGGCCTGTTACAACTTGG - Intronic
951846720 3:27092506-27092528 AACCCTGGGCTATTAAAGGCTGG + Intergenic
953923508 3:46968156-46968178 AACCTTGGAGTCTGAGAGCTTGG + Intronic
956315205 3:67927760-67927782 AACATTGGAATATTAAAGCATGG - Intergenic
959882583 3:111461788-111461810 AATTTTGGACTGTTAGAGCTGGG - Intronic
967479171 3:189954721-189954743 CACATTGGACTATTTAACCTAGG + Intergenic
967882378 3:194310872-194310894 AATCTTGGAAGATTAAATCTTGG - Intergenic
968862752 4:3185581-3185603 AAGCTTAGACTATTTTAGCTTGG + Intronic
968880878 4:3299338-3299360 TATCTTGGACTCTTCAAGCTGGG + Intronic
970271147 4:14348972-14348994 TTCCTTGGAATATTAAAGATTGG + Intergenic
976983487 4:91262199-91262221 AACCTTGGGCTCTCAAACCTTGG + Intronic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
979722471 4:123917528-123917550 AAGCATGGAGTCTTAAAGCTAGG - Intergenic
987130320 5:14854371-14854393 AACCTAGCTCTTTTAAAGCTTGG + Intronic
989080744 5:37617774-37617796 AAAATTAGACTATGAAAGCTAGG - Intronic
990746439 5:58963809-58963831 AACCTTTGGCTATTAGAGGTAGG - Intergenic
1005652650 6:27898563-27898585 CACCTTGGCCTCTGAAAGCTGGG + Intergenic
1008874425 6:56310030-56310052 AATCTTGGACTTTTAAAGCCTGG - Intronic
1014527468 6:122518289-122518311 AATCTTGAACTCTTAAAGCAGGG - Intronic
1025244595 7:57307083-57307105 AAGCTTGGAGTTTTAAAGCTGGG - Intergenic
1027186468 7:75974119-75974141 AACCCTGTCCTATTAAAGATGGG + Intronic
1027666736 7:81049405-81049427 ATCCTTTGAGTCTTAAAGCTTGG + Intergenic
1027757023 7:82226884-82226906 TAACTTGTACTATAAAAGCTGGG + Intronic
1030908825 7:115221026-115221048 AACTGTGGATTATTACAGCTTGG + Intergenic
1031100899 7:117479290-117479312 AACCTGAAACTAATAAAGCTTGG + Intronic
1042934420 8:74044437-74044459 TGCCTTGGCCTCTTAAAGCTGGG + Intergenic
1043220770 8:77660847-77660869 AACCTTGAGCTATTTCAGCTAGG + Intergenic
1051144023 9:14007553-14007575 ATCCTGGGCCTATGAAAGCTCGG + Intergenic
1051498488 9:17751429-17751451 AACTTTTGGCTATCAAAGCTGGG + Intronic
1059916781 9:119112529-119112551 AAACATAGACTATTAAAGATAGG + Intergenic
1186302082 X:8211328-8211350 ATCCTTGGAAACTTAAAGCTGGG + Intergenic
1186573535 X:10741150-10741172 AACCTTGGACTATTAAAGCTAGG + Intronic
1195487601 X:105426865-105426887 AACCTTGGGCTAGGAAAGCCTGG + Intronic
1195785672 X:108519184-108519206 ATCCTTGGACTAGTAAAGAATGG + Intronic
1195894992 X:109736874-109736896 AATCTTCGACTATTAGTGCTGGG + Intergenic
1198556836 X:137803287-137803309 AACCTAAAACTATAAAAGCTTGG - Intergenic