ID: 1186574318

View in Genome Browser
Species Human (GRCh38)
Location X:10749437-10749459
Sequence GTACTCACCTTGAAGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186574316_1186574318 7 Left 1186574316 X:10749407-10749429 CCAGGATGGTTTATGTGCACACG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1186574318 X:10749437-10749459 GTACTCACCTTGAAGAAAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 200
1186574315_1186574318 14 Left 1186574315 X:10749400-10749422 CCTTTTACCAGGATGGTTTATGT 0: 1
1: 0
2: 0
3: 4
4: 150
Right 1186574318 X:10749437-10749459 GTACTCACCTTGAAGAAAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186574318 Original CRISPR GTACTCACCTTGAAGAAAGA GGG Intronic
900808982 1:4786869-4786891 GAGATCACCTTGATGAAAGAGGG - Exonic
905465945 1:38153332-38153354 GAACTCACCTTCAGGGAAGAAGG + Intergenic
906047237 1:42841110-42841132 GTACTCTGCCTGAAGGAAGATGG - Intronic
907563099 1:55409382-55409404 GTTCTCACATGGTAGAAAGAGGG + Intergenic
907639578 1:56173205-56173227 GAATTCAGCTTAAAGAAAGAAGG - Intergenic
910980283 1:92953564-92953586 CTATTCACCTTTAAAAAAGAAGG + Intronic
912550780 1:110483900-110483922 GTACTGACACTGAAGACAGACGG - Intergenic
913222742 1:116672210-116672232 GTAATCACCCAGAAGAAAGCTGG - Intergenic
919675260 1:200375908-200375930 TCACTCACCTTGAAGCAGGAGGG - Intergenic
920757370 1:208746417-208746439 GTATTCACCCTTAAAAAAGAAGG - Intergenic
921709513 1:218359582-218359604 GTACTCAGATTATAGAAAGAGGG + Intronic
921744802 1:218727877-218727899 GTAAGCTCCTTGAAGACAGAGGG - Intergenic
922842440 1:228654046-228654068 GTACTTACATGGAAGAAAGCTGG - Intergenic
923096071 1:230776210-230776232 GTCCTCACATGGTAGAAAGAGGG + Intronic
1062940876 10:1420590-1420612 GTCCTCATCTTCCAGAAAGAGGG + Intronic
1064514958 10:16137162-16137184 CTACTCAGCTTTAAAAAAGATGG + Intergenic
1069392759 10:67953546-67953568 GAGCTCTCCTTGAACAAAGATGG + Intronic
1071339337 10:84628980-84629002 GTACTCGCCTTTAAAAAAGTAGG + Intergenic
1072254428 10:93607671-93607693 ATCCTCACATGGAAGAAAGAGGG + Intergenic
1072615258 10:97045004-97045026 GTCCTCACATGGTAGAAAGAGGG - Intronic
1074903704 10:117841485-117841507 ATACCCACCTTGAAGATGGATGG + Intergenic
1075280076 10:121131528-121131550 GAAATAAGCTTGAAGAAAGAAGG + Intergenic
1079711508 11:23688905-23688927 CTGCTTGCCTTGAAGAAAGAAGG - Intergenic
1082281784 11:50278573-50278595 GTACAGTCCTTGAAGGAAGAGGG - Intergenic
1083031157 11:59593717-59593739 TGACTCACCTTGAAGAAATCAGG + Exonic
1084837807 11:71816650-71816672 GAACTCACCTTGGAGAAAAGTGG - Intergenic
1086234056 11:84606526-84606548 GTACTTATTTTAAAGAAAGATGG - Intronic
1088307053 11:108421828-108421850 CTACTAAACTTGAAGAAAGCAGG - Intronic
1088728473 11:112659839-112659861 TTACTCAGGTGGAAGAAAGAAGG + Intergenic
1089645846 11:119878236-119878258 GTACATACTTTGAAGAAAAATGG + Intergenic
1090075499 11:123578033-123578055 GTACTCACCTGGCAGAGAGGAGG + Intronic
1090697602 11:129264046-129264068 GTATTCACCCTTAAAAAAGAAGG + Intronic
1091091046 11:132771795-132771817 AGAGTCACCTTGAAGAGAGATGG - Intronic
1092314480 12:7396016-7396038 GTACTGACTAAGAAGAAAGAAGG + Intronic
1093412278 12:18880994-18881016 GTCCTCAGATTGCAGAAAGAAGG + Intergenic
1093540415 12:20276849-20276871 GTACTCAACTTGTAAAGAGAGGG - Intergenic
1094290677 12:28845598-28845620 CTACTGAGCTTGAAGAAATATGG - Intergenic
1095564408 12:43604970-43604992 CTATTCAGCCTGAAGAAAGAAGG - Intergenic
1101033021 12:100678393-100678415 GGTCTCACCTTTGAGAAAGAAGG - Intergenic
1101288064 12:103336960-103336982 GTACAACCCTTGAAGGAAGAAGG + Intronic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1104825677 12:131707586-131707608 GTAGGCACTTTGAAGGAAGAAGG - Intergenic
1105298629 13:19113639-19113661 GTACTCACCATGAAAGAAAAAGG + Intergenic
1107554168 13:41503003-41503025 GGACTCACCTTGAAGATGGAAGG - Intergenic
1110241964 13:73278212-73278234 TTACTTACCTTTAAAAAAGAAGG + Intergenic
1114140771 14:19907868-19907890 GAAATCACCTTGAAGGAAGTTGG - Intergenic
1115076398 14:29397291-29397313 TTCTTCACATTGAAGAAAGAGGG - Intergenic
1116687887 14:48065499-48065521 GTACACACCTTAATGAAAGTTGG + Intergenic
1117498311 14:56327649-56327671 ATCCTCACTTTGTAGAAAGATGG + Intergenic
1117792245 14:59353333-59353355 GTGCTCACTATGAAGACAGAGGG + Intronic
1118006268 14:61566624-61566646 TCACTCACCTTCAAGAAAGCAGG - Intronic
1118230635 14:63945317-63945339 GTGCTCACCTTTAGGAAAGGAGG - Intronic
1118540224 14:66814753-66814775 GTGGTCATCTGGAAGAAAGAAGG - Intronic
1119161710 14:72458336-72458358 GTTCTCACCATGAAGGATGATGG + Exonic
1122369555 14:101221798-101221820 GTCCTCACATGGTAGAAAGAGGG - Intergenic
1125034718 15:35110763-35110785 TGACTCACCTTGAATAAACAAGG - Intergenic
1126528258 15:49682622-49682644 ATTCTCTCCTTGAAGATAGAGGG - Intergenic
1127176005 15:56358305-56358327 TTACTGAACTTGAAGAAAGTAGG - Intronic
1128025395 15:64432204-64432226 GTACTTATCCTGAAGAGAGATGG + Intronic
1128047831 15:64634653-64634675 GTACTCACCTAGAGGAGAGATGG + Intronic
1130214356 15:81954264-81954286 GTAGTCACCTTGTAGAAAGAGGG - Intergenic
1131237984 15:90713608-90713630 GTATTCACCTTGAAGGCAAATGG + Intergenic
1131285301 15:91051975-91051997 TTATTCAACTTGAAAAAAGAAGG - Intergenic
1135173640 16:20208989-20209011 GGACTCACCTGCAACAAAGACGG - Intergenic
1135737718 16:24945795-24945817 GTACTCTCCTAAAAGAAAAATGG - Intronic
1137260882 16:46829172-46829194 GTCCTCACATGGCAGAAAGAGGG - Intronic
1139302330 16:65956030-65956052 GTACTGACCATAAAGAAAGCTGG + Intergenic
1143987705 17:10929387-10929409 ATTCTGACCTTGAAGGAAGAGGG + Intergenic
1144264253 17:13552923-13552945 GTCCTCCCCTTTAAGCAAGAAGG + Intronic
1145814624 17:27786693-27786715 GTACCCACCTTGCAGGAGGAGGG - Intronic
1147198841 17:38785882-38785904 GTTCTGACCCAGAAGAAAGAAGG - Intronic
1148517230 17:48231398-48231420 TTACACAGCCTGAAGAAAGAAGG + Intronic
1148749566 17:49937026-49937048 GTACTCACAAAGAAGAAATAAGG - Intergenic
1149161216 17:53695285-53695307 GTACTCAAATTTAAGAAATATGG - Intergenic
1149931006 17:60755352-60755374 GTACTCACCCTGAAGAATAGTGG - Intronic
1151570734 17:74924150-74924172 AAATTCACCTTGGAGAAAGATGG + Intergenic
1153997582 18:10455025-10455047 GAACTCACCGTGAAGCAGGAGGG - Exonic
1155634877 18:27940632-27940654 GTAGTGACCTTGAAGAATGGAGG - Intergenic
1158794460 18:60826536-60826558 TTACTCACATTGAAGATAGAGGG - Intergenic
1160335763 18:78037723-78037745 GTCCTCACATTGTAGAGAGATGG - Intergenic
1162799078 19:13101188-13101210 GTACTCACCTGTGGGAAAGAAGG + Exonic
1167888159 19:52518821-52518843 GACCTCACCCTGTAGAAAGACGG - Intergenic
1168227185 19:55004159-55004181 ATACACACGTTGGAGAAAGATGG - Intergenic
925115198 2:1372650-1372672 GTGCTCACCGTGAAGGAAGATGG + Intergenic
926648124 2:15312176-15312198 ATACTCACATTGAAGAATCAAGG - Intronic
927191283 2:20518834-20518856 GTCCTCACATGGAAGGAAGATGG - Intergenic
929419653 2:41777751-41777773 GTACTTACCTGGAACAATGATGG + Intergenic
930019291 2:46991600-46991622 TTACTCACCTTAAAAGAAGAAGG + Intronic
931075098 2:58702121-58702143 GTTCCCACCTTGATGATAGAAGG - Intergenic
933034685 2:77379727-77379749 GAACTACCATTGAAGAAAGAAGG - Intronic
933182229 2:79240373-79240395 GGACTTACCTTGAGGATAGAGGG - Intronic
935384883 2:102489490-102489512 CTTCTGAACTTGAAGAAAGATGG - Intronic
935818872 2:106873927-106873949 AGATTCAACTTGAAGAAAGAGGG + Intronic
935924523 2:108052626-108052648 TAACTCACCTTCAAGTAAGATGG + Intergenic
936562826 2:113556566-113556588 GCACTCACCTTGAAGTTAAAAGG - Intergenic
939089701 2:137765223-137765245 CTACTCTCCTAGGAGAAAGAAGG - Intergenic
941047030 2:160688019-160688041 TTACTGACCTTGAAGTAACATGG + Intergenic
941187720 2:162337697-162337719 GTACTCTCCTGGTACAAAGAGGG - Intronic
942745350 2:179225675-179225697 GTCCTCACATTGCAGAAAGATGG + Intronic
944226063 2:197349661-197349683 CTCCTCACCTGGTAGAAAGAGGG - Intergenic
945142469 2:206701446-206701468 GTACTCAGCCTTAGGAAAGAAGG + Intronic
946808058 2:223492067-223492089 TTGCTCACCTTGAAGATAGAGGG - Intergenic
1169245773 20:4023341-4023363 GATCTCACCTTGAAGCAAGAGGG + Intergenic
1172064618 20:32210178-32210200 GTACTCACGTTGGTGAAAGGAGG - Exonic
1172755823 20:37283643-37283665 GTCCACACCTTGTAGAAAGCAGG + Intergenic
1173044167 20:39493552-39493574 GGACTAACCTCAAAGAAAGAAGG - Intergenic
1174283061 20:49453238-49453260 GATCCCACCTTGCAGAAAGAGGG + Intronic
1174582581 20:51582645-51582667 TTTCTCAACTTGAATAAAGATGG + Intergenic
1177111317 21:17032937-17032959 GTCCTCACATAGAAGACAGAGGG + Intergenic
1177662338 21:24101377-24101399 GTACTAACCTTGAATATAAATGG - Intergenic
1179136564 21:38684876-38684898 GTTCTCACTTGGCAGAAAGATGG + Intergenic
1179656204 21:42846544-42846566 GTAATCAAAATGAAGAAAGACGG + Intronic
1182575955 22:31272985-31273007 GTTCTCACCATGGAGAGAGAAGG - Intronic
951822564 3:26828353-26828375 GCACTCATCTGGATGAAAGAAGG - Intergenic
951942945 3:28101744-28101766 ATAATCACCTTGAAGACAGGTGG - Intergenic
952774718 3:37033834-37033856 GTAATCACCTCTAAGGAAGAAGG - Intronic
952839256 3:37630486-37630508 GTCCTCACCTTGAGGCAAGAGGG + Intronic
954571394 3:51643960-51643982 CCACTCACCTTGTAGAGAGAAGG - Exonic
954891538 3:53934813-53934835 TTAGTCACTTTTAAGAAAGAGGG + Intergenic
955552563 3:60100038-60100060 GCACTCACAGTGAAGAAAGGGGG - Intronic
955662762 3:61318888-61318910 GTACACACAATGAAGGAAGATGG - Intergenic
958863159 3:99468914-99468936 GTACTCACTTTTCAGAAAGCAGG + Intergenic
959137818 3:102446847-102446869 GTAAGCTCCTTGAAGAAACAGGG + Intronic
960273607 3:115701325-115701347 GAACTCACCTGAAAGAGAGATGG - Intronic
961988191 3:131159229-131159251 GTGGTCACCTGGAGGAAAGAAGG - Intronic
964762251 3:160145635-160145657 GTCCTCACATTGCAGAAAGAGGG + Intergenic
965248518 3:166309188-166309210 GTAATCACATTGTAGAAACATGG - Intergenic
966209593 3:177439315-177439337 GTACTCACCCAGCAGAAATATGG - Intergenic
966565774 3:181379352-181379374 GTACTCATTTTAAAGATAGATGG + Intergenic
968867427 4:3222399-3222421 GTACTCAGTTTGAAGAAACTTGG + Exonic
971512209 4:27440746-27440768 GTGCTCACCTAGAAGAAAAATGG - Intergenic
972164010 4:36260543-36260565 ATCCTCACATGGAAGAAAGAGGG - Intergenic
973576134 4:52291183-52291205 GTCCTCACATGGCAGAAAGAGGG + Intergenic
973620300 4:52719752-52719774 GAGCTCACTTTGAAGAAATAAGG + Intergenic
973851473 4:54965532-54965554 GTCCTCACATGGAAGACAGAGGG - Intergenic
973873306 4:55188292-55188314 GTCCTCACATGGCAGAAAGATGG - Intergenic
979047720 4:115890628-115890650 GTACAGAGCTTGAAGAAAGATGG + Intergenic
979677689 4:123427883-123427905 TCACTCCACTTGAAGAAAGAGGG + Intergenic
980058851 4:128106437-128106459 GTACTCACCTTTTAGAAATTAGG - Intronic
980838617 4:138229235-138229257 AGACTCACTTTGAAGAAAGCAGG + Intronic
981623063 4:146725679-146725701 GCAAACACCTTGATGAAAGATGG - Intronic
982076595 4:151743224-151743246 AGACTCACCATGAAGAAAGCAGG - Intronic
982450726 4:155549467-155549489 ATCCTCACATTGCAGAAAGACGG + Intergenic
983839144 4:172434376-172434398 GTACTCAGCTTAAAGGGAGAAGG - Intronic
986688623 5:10295645-10295667 GTTCTCACCCAGCAGAAAGAAGG - Intronic
987118595 5:14745862-14745884 GTTCTCACCTTGTCGAAAGCAGG + Exonic
988675301 5:33427388-33427410 GTGATCACTTGGAAGAAAGAAGG + Intergenic
988857435 5:35242463-35242485 GTCTTCACCTTGAAGCCAGAAGG - Intergenic
989531603 5:42514105-42514127 GAACTGACCTTGAAGACAAATGG + Exonic
989567039 5:42910999-42911021 CCAGTCACCTTAAAGAAAGATGG - Intergenic
992174256 5:74134050-74134072 GCACTTCCCTTGAGGAAAGAAGG + Intergenic
992491489 5:77248570-77248592 GTACCTACCGTGAAGAAACAAGG + Intronic
992963672 5:81980387-81980409 TTACTTACCTTGACAAAAGAGGG + Intronic
993340028 5:86713660-86713682 ATAGCCACCTTTAAGAAAGAAGG - Intergenic
993689520 5:90982131-90982153 ATACATACCTTTAAGAAAGATGG - Intronic
995446805 5:112253975-112253997 GTACTCTCCTTAAAGCAAGCCGG + Intronic
995556999 5:113340013-113340035 TGACTCACCTTGAAGGAAAAAGG + Intronic
998027109 5:138827449-138827471 TTTCTCACCTTGAATAAAGAAGG + Intronic
998505089 5:142665958-142665980 GGTCTCACCTTGAAAAAAGAAGG - Intronic
999314417 5:150574890-150574912 GAACTCACCTTGGAGCAAGGTGG - Intergenic
999573167 5:152943631-152943653 GGACTCACCTTTAGGATAGATGG - Intergenic
1001098617 5:168795779-168795801 TAACTCTCCTTGGAGAAAGAGGG + Intronic
1003804296 6:9708623-9708645 TTACTCAGCTTTAACAAAGAAGG + Intronic
1005566953 6:27105850-27105872 ATTCTCACCTGGCAGAAAGAAGG - Intergenic
1005677179 6:28166665-28166687 GTAGGCACATGGAAGAAAGACGG + Intergenic
1005743390 6:28813946-28813968 GTACAGCCCTTGAAGGAAGAGGG - Intergenic
1012056241 6:94414540-94414562 GTATTCATCTTAAAGCAAGATGG + Intergenic
1014461102 6:121696627-121696649 TTACTCACTTTGAAGATAGAGGG - Intergenic
1015470279 6:133597558-133597580 GTTCTCACATGTAAGAAAGAAGG - Intergenic
1016502279 6:144734940-144734962 GTAAGCTCCTTGAAGACAGAGGG + Intronic
1016930735 6:149405557-149405579 TTACTCAGCCTTAAGAAAGAAGG + Intronic
1020737564 7:11970290-11970312 GTAAACTCCTTGATGAAAGATGG + Intergenic
1021563814 7:21996877-21996899 TTACTCACCCTTAAGAAGGAAGG - Intergenic
1023597545 7:41847530-41847552 GTATTCACCCTTAAAAAAGAAGG - Intergenic
1024109571 7:46131621-46131643 ATACTCAACTTGTAGTAAGAAGG + Intergenic
1024376349 7:48642908-48642930 GTACAGACCTTGAAGCAATAAGG + Intronic
1030985685 7:116239007-116239029 GTACTCACCTTTAAGTGCGAGGG + Intronic
1032527305 7:132588614-132588636 GAACACACCTTGAGGAAGGAAGG + Intronic
1033321347 7:140342563-140342585 GTACTAATTTTGTAGAAAGATGG - Intronic
1033656218 7:143376477-143376499 GGGCTGACCCTGAAGAAAGAAGG + Intergenic
1034714890 7:153232996-153233018 GTACTAACCTTAAATAAAAATGG - Intergenic
1034824345 7:154248082-154248104 GTTCTCACATGGCAGAAAGAGGG + Intronic
1039774244 8:40719942-40719964 GGACTCACCTTGGAGAAGCATGG - Intronic
1040987644 8:53314022-53314044 GTCCTCACATGGTAGAAAGAGGG + Intergenic
1041242626 8:55861338-55861360 GTCCTCACTTGGCAGAAAGAGGG + Intergenic
1041348388 8:56924571-56924593 CTGCTCACCTTAAAGAAGGAAGG + Intergenic
1044904369 8:96984468-96984490 GTCCTCACATAGAAGACAGAAGG - Intronic
1045976477 8:108135115-108135137 TTATTCAGCTTTAAGAAAGAAGG + Intergenic
1052449312 9:28607274-28607296 GAAGTCACCATGAAGAAAAAAGG + Intronic
1055188126 9:73481453-73481475 ATGATCACCTTGAAGAAAAAAGG - Intergenic
1055839059 9:80480843-80480865 TTACTCAGCATGAAAAAAGATGG - Intergenic
1058693904 9:107543083-107543105 GTACTCACCTGAAATACAGAAGG + Intergenic
1059772549 9:117441269-117441291 GTATTTACCTGGAAGAATGAAGG + Intergenic
1059964647 9:119601783-119601805 GTACTCATCATGCAGGAAGAGGG + Intergenic
1059979371 9:119752939-119752961 GTAATTACCTTGAAGAAAACTGG + Intergenic
1060864081 9:126981113-126981135 GTATTTAGCTTGAAAAAAGAAGG + Intronic
1061972087 9:134050366-134050388 GTGCTCACCTTGACGACAGGCGG + Exonic
1185764208 X:2711730-2711752 GTATTCAGCTTTAAAAAAGAAGG + Intronic
1186574318 X:10749437-10749459 GTACTCACCTTGAAGAAAGAGGG + Intronic
1186714697 X:12239112-12239134 GTACTTGTCTTAAAGAAAGAAGG - Intronic
1186940645 X:14503630-14503652 GCCCTCACCTTGAAGAATGCTGG - Intergenic
1187749616 X:22447427-22447449 GTCCTCATCTTGTACAAAGAGGG + Intergenic
1188297140 X:28463315-28463337 GAACTTACCATGAAGGAAGAGGG - Intergenic
1188746009 X:33844717-33844739 GAACTCACATTGGTGAAAGAAGG - Intergenic
1189530141 X:41871886-41871908 CTACTCTCCTTGAAAACAGAGGG + Intronic
1190556245 X:51638356-51638378 CTACTCACCTACAAGAAAGAAGG + Intergenic
1191217245 X:57946246-57946268 ATACTAACCTTGAATAAAAATGG - Intergenic
1192033692 X:67542788-67542810 TTACTTACCTTGACCAAAGAAGG - Intergenic
1193079994 X:77397385-77397407 CTACTGACTTTGAAGAAGGAAGG - Intergenic
1194370821 X:93069484-93069506 GTACTCCCCTTCAAGACAGCAGG - Intergenic
1194376199 X:93136672-93136694 GTCCTCACATGGAAGAAAGAAGG - Intergenic
1197846341 X:130807650-130807672 GTACTCACCTTGGTTAAGGAAGG - Intronic
1198414691 X:136408036-136408058 GTACTCACTCTGTGGAAAGAGGG + Intronic
1198684141 X:139209939-139209961 GTCCTCACCTTTAAGAAACTTGG + Intronic
1199317562 X:146399003-146399025 GTCCTAACCTGGAAGAAAAAGGG - Intergenic
1200678616 Y:6181376-6181398 GTACTCCCCTTCAAGACAGCAGG - Intergenic
1201447213 Y:14070643-14070665 GTACTCAACTTGAATAATCAAGG + Intergenic
1201519015 Y:14851768-14851790 CTAAACACCTTGCAGAAAGAGGG - Intergenic